"
Team:NTNU Trondheim/rrnB
From 2011.igem.org
rrnB P1
Previous studies have shown that the rrnB P1 promoter is downregulated by ppGpp[1]. That is why we decided to use this promoter as the stress sensing promoter in the stress sensor. A version of rrnB P1 already existed in the Registry of Standard Biological Parts. This version was made by the Berkeley iGEM team in 2008.
The BioBrick that the Berkeley team made is in [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb format]. This means that the BioBrick is flanked by a prefix and a suffix that is different from the ones that are normally used. Therefore, this BioBrick was initially not compatible with the other BioBricks we were planning to use in our construct, as all the other BioBricks we planned to use were in BBa format.
To deal with this problem, the rrnB P1 promoter was amplified using PCR. The original promoter made by the Berkeley iGEM team was used as template DNA. To make the amplified brick compatible with the rest of our construct, the [http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix standard prefix and suffix] was added to our primers.
When we amplified the promoter, we amplified both the whole brick (rrnB P1) and only the assumed promoter sequence (proL). Primers for both amplifications are given below:
rrnB P1.fwd: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGACGTATCCTACGCCCGTGGT
rrnB P1.rev: GTTTCTTCCTGCAGCGGCCGCTACTAGTACGCCTTCCCGCTACAGAGTCA
proL.fwd: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCCTCTTGTCAGGCCGGAATAACTCC
proL.rev: GTTTCTTCCTGCAGCGGCCGCTACTAGTAGCGGCGTGTTTGCCGTTGTT
The nucleotide sequences of both PCR products are given below:
Nucleotide sequence of rrnB P1
[Media:proL sequence.txt]
[1] ppGpp: a global regulator in Escherichia Coli, Lisa U. Magnusson, Anne Farewell, Thomas Nyström, 2005
