Short single stranded DNA fragments will not ligate to 4 bp overhangs. By creating a very short overhang on a PCR of a plasmid backbone, the remnant, when cut with EcoRI and PstI is sufficiently short that it will not anneal at ligation temperature, and will therefore not ligate. This allows us to build high quality construction plasmid backbone without purifying away the cut fragments remaining after PCR.

The prepared construction plasmids are given in the iGEM Distribution Kit as purified PCR products, diluted to standard concentration, but prior to cutting with EcoRI and PstI. Standard assembly will cut this plasmid backbone with EcoRI and PstI at the same time that the two assembled fragments are cut with EcoRI and SpeI and with XbaI and PstI, respectively.

The preparation of this PCR fragment is done with primers having short overhangs past the EcoRI and PstI sites, followed by PCR cleanup, dilution to standard concentration, and quality control testing.

Primers - Dilute to 30 pmol/ul

gccgctgcagtccggcaaaaaaacg,SB-prep-3P

atgaattccagaaatcatccttagcg,SB-prep-2Ea

PCR

• 100 ul PCR supermix high fidelity
• 0.7 ul each primer
• 0.5 ul template DNA at 10 ng/ul (Note: Do not use a sample of linearized plasmid backbones (PCRed) as a template; Registry shipping plasmid backbone is pSB1C3))
• cycle 94/30s; 36x(94/30s;55/30s;68/3:00 min); 68/10 min
• Ethanol precipitate (This step does not appear necessary)
• Digest with DpnI enzyme in 100 ul 2 ul DpnI
• Incubate 37/overnight hour; heat kill 80/20 min

Cleanup

• Add 500 ul Qiagen buffer PB
• Spin through a column twice, discard flowthrough
• Wash 1x with 700 ul buffer PB
• Wash 2x with 760 ul buffer PE
• Discard liquid, spin dry at 17000g for 3 min
• Elute into a new tube twice with 50 ul of TE (100 ul total)

Quality Control

• Run 3 ul on a gel to verify the correct band and concentration and lack of side products
• Quantify concentration on a nanodrop. Expect around 10 ug from a 100 ul PCR reaction (100 ng/ul in 100 ul)
• Perform a ligation test
  • Test for both the EcoRI and PstI cutting and ligation efficiency
  • Digest in a 15 ul final volume
  • 1 ul DNA (approximately 100 ng)
  • 1.5 ul NEB Buffer 2 (Not buffer 4; see E-Gel Buffer Compatibility)
  • .15 ul BSA
  • 0.5 ul either EcoRI-HF or PstI enzyme (not both!)
  • 12 ul water
  • Digest 37/1 hour; 80/20 min
  • Add 5 ul of a 4x ligation master mix
  • Ligate 30 min at room temperature
  • Heat kill the ligase 80/20 min
  • run all 20 ul on a gel
  • Compare intensity of the single and double length bands. Good product should show mostly double length bands.
• Ligation master mix
  • 50 ul final
  • 20 ul T4 DNA ligase buffer
  • 5 ul T4 DNA ligase
  • 25 ul water
• Transformation test
  • Transform 1 ul of the diluted final product into highly competent cells
  • Control transform 10 pg of pUC19
  • plate on the appropriate antibiotic
  • observe few colonies. Any colonies represent background to the three antibiotic assembly process
  • Quantify the effective amount of remaining circular DNA able to transform

Bulk production

• PCR with PCR supermix high fidelity
  • add 19 ul primer SB-prep-2Eb
  • add 19 ul primer SB-prep-3P
  • add 1 ul 10 ng/ul template DNA
  • aliquot 100ul/well in 96 well plate
  • cycle 1 min/94C 40x(30s 94; 30s 58; 3min 68) 10 min/68 hold 4C
• purify Promega SV96 pcr cleanup
  • Add 100 ul pcr cleanup buffer using 8 well pipet, mix
  • transfer to cleanup plate, allow to sit 1 min, vacuum dry
  • wash 3x with 200 ul 80% ethanol, vacuum after each
  • remove from the wash manual, blot on paper towels, reinstall in wash manifold
  • dry 4 min on vacuum
  • transfer to collection manifold
  • elute with 2x 50 ul TE buffer
• Measure concentration on nanodrop, adjust to 25 ng/ul with TE

Use

• Prepare 2x Enzyme master mix (25 ul)
  • 5.0 ul NEB Buffer 4
  • 0.5 ul NEB BSA
  • 0.5 ul EcoRI-HF
  • 0.5 ul PstI
  • 0.5 ul DpnI
  • 18 ul water
  • flick mix, spin down

• Digest construction plasmid
  • Add 4 ul prepared construction plasmid (25 ng/ul)
  • Add 4 ul 2x Enzyme mix
  • digest in a pcr cycler 37C/30 min, heat kill 80C/20 min using a hot lid

• Ligation
  • Add 2ul of digested construction plasmid (25 ng)
  • Add equimolar amount of EcoRI-HF SpeI digested fragment (< 3 ul)
  • Add equimolar amount of XbaI PstI digested fragment (< 3 ul)
  • Add 1 ul NEB T4 DNA ligase buffer
  • Add 0.5 ul T4 DNA ligase
  • Add water to 10 ul if necessary
  • ligate 16C/30 min, heat kill 80C/20 min
  • transform with 1-2 ul of product