Team:Potsdam Bioware/Labjournal/October

From 2011.igem.org

Revision as of 18:03, 28 October 2011 by JessicaE (Talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Contents

98th Labday 2011-09-24

Colony PCR of E.coli XL1 blue transformed UP_SG2 (1.5%)

Investigators: Stefan, Paul, Sebastian


Aim: checking for positive clones for further tasks


Methode:

Primer: 42,67

  • picked clones where incubated over night at 4°C in 1 ml LB media
  • 5 µl Buffer S with 25 mM MgCl2 (purchased by Genaxxon)
  • 2,5 µl each Primer (10 mM, see list below)
  • 1 µl dNTP (each 10 mM)
  • 0.5 µl Taq Polymerase (purchased by Genaxxon)
  • 2 µl 25 mM MgCl2 (purchased by Genaxxon)
  • 36.5 µl H2O
  • Total volume: 50 µl


PCR Program:

Initial denat = 6min 94°C

30x

denat: 30sec 94°C

anneal: 30sec 55°C

extend: 30sec 72°C

final extend: 10min 72°C



Results:

no positive clone probably due to rubbishy digestion


Further tasks:

Subcloning of 14 3C and AraC into SG2 (1.5%)

Investigators: Stefan, Paul, Sascha


Aim: digestion of 14 3C protease


Methode:

  • 14 µL H20
  • 2 µL buffer
  • 1 µL EcoRI
  • 1 µL PstI
  • 2 µL DNA
  • Total volume: 20 µl

digest over 2h or overnight depends how long Jessica is here


Results:


Production of phages containing pPDV089 in XL1-blue cells

Investigators: Sabine, Sandrina


Aim: control if geneIII-mdnA will be expressed on the phage and performing phage display


Method/Materials:

  • amplification of XL1-blue cells
  • 50 ml over night culture will be inoculated with the cells, so that OD600 = 0.1
  • add tetracyclin to the medium
  • cells should be incubated 37 °C till OD600 = 0.3-0.5 (here: 0.356) is reached
  • add 30 µl phages carrying mdnA-myc-gene III on their surface
  • incubate for 10 min at 37 °C without shaking
  • incubate for 50 min shaking at 37°C
  • phage purification:
  • centrifuge cell culture at 5000 x g/ 15 min
  • fill supernatant in a new 50 ml falcon and centrifuge again (5000 g/15 min)
  • 40 ml of the supernatant with 8 ml PEG-NaCl (20% (w/v) PEG-8000, 2,5 M NaCl)
  • incubate over night at 4°C


Further tasks:

  • go on with phage purification

99th Labday 2011-09-25

Agarose gel electrophoresis of maxiprimer I

Time: 2011-09-25, 20:00-23:00

Investigators: Nicole

Idea:Examination if PCR for Amplification of maxiprimer I works

Materials

  • Maxiprimer a and b, PCR done by Nadja, 2011-09-25
  • Broad range agarose
  • 1x TAE buffer
  • Gel red
  • Gene Ruler 100 bp ladder (Fermentas)
  • Gene Ruler DNA ladder mix (Fermentas)
  • 6x loading dye (Promega)


Methods:

  • 2 % agarose gel (1 g agarose and 50 ml 1x TAE buffer)
  • addition of 2 µl gel red


  • Load 50 µl sample and 8 µl loading dye
  • 3.5 µl of each DNA ladder


Results:

Label Sample Expected size in bases
1 100bp DNA ladder
2 A 129
3 A 129
4 B 129
5 B 129
6 DNA ladder mix


Media: UP_



Further tasks:

  • DNA extraction
  • Maxiprimer PCR I using the extracted DNA as forward primer
  • Gel electrophoresis and DNA extraction, expected size 431 bases
  • Maxiprimer PCR II using the extracted DNA as forward primer
  • Agarose gel electrophoresis and DNA extraction, expected size 6619 bases
  • Restriction enzyme digestion using EcoRI and SpeI
  • Ligation with pSB1C3
  • Transformation

Purification of phages containing pPDV089

Investigators: Sabine, Sandrina


Aim: control if geneIII-mdnA will be expressed on the phage, repeated phage display


Method/Materials:

  • after over night incubation:
  • centrifuge precipitaed phages: 5000 x g/ 45 min
  • discard supernatant
  • centrifuge again, 5000 x g/ 5 min
  • remove supernatant carefully
  • take pellet in 1 ml TBS
  • move in 1.5 ml Eppi
  • centrifuge again: 17000 x g/10 min
  • supernatant in a new Eppi with 200 µl PEG-NaCl (mix!)
  • incubate on ice for 60 min
  • centrifuge precipitated phages: 17.000 x g/ 10 min (4°C)
  • resuspend pellet in 300 µl TBS
  • centrifuge:17 000 x g/ 10 min (4°C)
  • supernatant in a fresh eppi= purified phages


Further tasks:

  • ELISA and phage display


Maxiprimer PCR I – Amplification of the end of the mdn cluster (Repetition, usage of two different polymerases)

Time: 2011-09-25, 20:00-23:00

Investigators: Nicole

Idea:Checking out two different polymerase to obtain amplification

Materials

  • purified Maxiprimer a and b, PCR done by Nadja, 2011-09-25
  • pARW089 clone 2, 85.7 ng/ µl
  • PfuUltra
  • PfuUltra HF Buffer
  • Primer reverse: r_mdnABCDE_iGEM (10 µM)
  • LongPCR Enzyme Mix (Fermentas)
  • Long PCR Enzyme Mix buffer (Fermentas)
  • dNTPs (10 mM)


Methods:

1. PfuUltra Polymerase

PCR mixture, maxiprimer A

Volume in µl
PfuUltra Buffer HF 5
dNTPs 1
Template DNA, pARW089 1.2
r_mdnABCDE_iGEM 1
Maxiprimer A 5.9
PfuUltra Polymerase 1
H2O 34.9

Labeled: P1



PCR mixture, maxiprimer B

Volume in µl
PfuUltra Buffer HF 5
dNTPs 1
Template DNA, pARW089 1.2
r_mdnABCDE_iGEM 1
Maxiprimer B 8.2
PfuUltra Polymerase 1
H2O 32.6

Labeled: P2



Thermal cycling program

Step Temperature in °C Time in seconds
Hot start 95 Hold
Initial Denaturation 95 120
Denaturation 95 30
Annealing 54 30
Extension 72 60
Cycle number 30
Final extension 72 600



2. Long PCR enzyme mix

PCR mixture, maxiprimer A

Volume in µl
Long PCR enzyme mix buffer 5
dNTPs 1
Template DNA, pARW089 1.2
r_mdnABCDE_iGEM 1
Maxiprimer A 24.1
Long PCR enzyme mix 0.3
H2O 17.4

Labeled: L1



PCR mixture, maxiprimer B

Volume in µl
Long PCR enzyme mix buffer 5
dNTPs 1
Template DNA, pARW089 1.2
r_mdnABCDE_iGEM 1
Maxiprimer B 21.8
Long PCR enzyme mix 0.3
H2O 19.7

Labeled: L2



Thermal cycling program

Step Temperature in °C Time in seconds
Hot start 94 Hold
Initial Denaturation 94 300
Denaturation 95 20
Annealing 54 30
Extension 68 22
Cycle number 10
Denaturation 94 20
Annealing 68 30
Extension 68 24
Cycle number 15
Final extension 68 600



Output:

  • 2 samples (L1 and L2) in right Thermocycler
  • 2 samples (P1 and P2) in left Thermocycler


Further tasks:

  • Gel electrophoresis and DNA extraction, expected size 431 bases
  • Maxiprimer PCR II using the extracted DNA as reverse primer
  • Gel electrophoresis and DNA extraction, expected size 6619 bases
  • Restriction enzyme digestion using EcoRI and SpeI
  • Ligation with pSB1C3
  • Transformation


100th Labday 2011-09-26

Repeated Phage Display with another trypsin protease

Investigator: Sandrina, Sabine


Time: 2011-09-16, 9:00-18:00


Aim:check if unmodified mdnA on the surface of the phages binds to an immobilized protease. interactions of microviridin L with this protease were already detected


Material/Method:

  • in ELISA plate:
  • coat wells with protease trypsin- EDTA in water for 2 h
  • blocking in 3% milk powder for 2 h
  • wash 6x with TBS-T (0,005%)
  • panning with phages 1:1 helper phages and phages of interest (presenting mdnA-geneIII fusion protein on their surface, 1 h)
  • wash 6x with TBS-T
  • elute bound phages with 0,2 M Glycin-HCl, 10 min
  • neutralize with 1 M Tris (pH 7-8)
  • mix eluted phages with preparatory culture of XL1-blue cells
  • store over night at 4°C


Further tasks:

check binding of phages by plating them

ELISA with purified phages

Investigators: Sabine, Sandrina


Time: 2011-09-16, 12:00-21:00

Aim: control if mdnA-myc-geneIII will be expressed on the phage


Method/Materials:

  • ELISA plate coated with 5 µg/ml anti-c-myc antibody in phosohate buffer (pH 7,4), volume 100 µl/ well
  • incubate for 4 h at room temperature
  • blocking in 2 % milk powder in TBS (300 µl/ well)
  • incubate for 2 h at room temperature
  • add 100 µl phages, produced in XL1-blu cells diluted 1:1 in TBS-T (0,005%)
  • incubate shaking for 60 min at room temperature
  • wash 5 x with TBS-T (0,05%)
  • add anti-gene-8-antibody (HRP coupled)
  • incubate shaking for 60 min
  • wash 5 x with TBS-T
  • put substrate on the samples
  • measure in plate photometer
  • reference: helper phages


Resluts: positive but weak weak signal at wells with mdnA phages because of the low concentration of phages


Control of Phage Display

Investigator: Sandrina, Sabine


Time: 2011-09-2


Aim:check if unmodified mdnA on the surface of the phages binds to an immobilized protease. interactions of microviridin L with this protease were already detected


Material/Method:

  • over night culture of XL1-blue cells was infected with eluted phages
  • 1000 cells were infected with 10.000 phages and plated on agar with kanamycin and on agar with ampicillin
  • control: 1:1 mix of helperphages and produced phages of interest carrying mdnA-geneIII plated also on agar with kanamycin and on agar with ampicillin


Further tasks:

  • check cell growth

101th Labday 2011-09-27

SDS- PAGE for coomassie staining with purified phages carrying mdnA on their surface

Investigators: Sabine, Sandrina


Aim: preparing geneIII-myc-mdnA-protein for mass spectrometry


Method/Materials:

  • seperating gel:
  • acryl amide: 2,5 ml
  • seperating gel buffer 4x: 1,5 ml
  • water: 1,94
  • APS: 60 µl


  • stacking gel:
  • acryl amide: 0,28 ml
  • stacking gel buffer: 0,5 ml
  • water: 1,22 ml
  • APS: 10 µl


  • loading dye: RotiLoad1
  • incubate samples at 95°C for 20 min
  • run at 50 V for half an hour, then switch to 20 mA


Further tasks:

  • coomassie staining

Coomassie staining

Investigators: Sabine, Sandrina


Aim: control if geneIII-myc-mdnA could be enriched for mass spectrometry


Method/Materials:

  • 20 ml water
  • 20 ml methanol
  • 60 ml coomassie stock solution
  • gel storage over night in coomassie solution shaking

Further tasks:

  • destaining of the gel


102th Labday 2011-10-06

Amplification of megaprimers for site-directed mutagenesis

Time: 2011-10-06, 9:00-12:00

Investigators: Nicole

Idea:Site-directed mutagenesis of XbaI restriction sites within the mdn cluster (use as biobrick)

Materials

  • Primer:
    • pf_muta_XbaI, 10 µM, 54°C (TATATTGAGGCATCAAGATCCAATTG)
    • pr_muta_XbaI, 10 µM, 55°C (GCTTTCATCTTCTTGATAAAAATGTTATCA)
    • pr_ohne_muta, 10 µM, 55°C (GCTTTCATCTTCTAGATAAAAATGTTATCA)
  • pARW089 clone 2, 8.57 ng/ µl
  • Genaxxopn Taq Polymerase S
  • 10x Genaxxon Taq Polymerase Buffer (15 mM MgCl2)
  • 25 mM MgCl2
  • dNTPs (10 mM)


Methods:

PCR mixture for A

A = mdn cluster without XbaI recognition sites at both sites

Volume in µl
dNTPs (10 mM) 1
10x Genaxxon Taq Polymerase Buffer 5
25 mM MgCl2 2
pf_muta_XbaI (10 µM) 1.5
pr_muta_XbaI 1.5
Template DNA, pARW089, 8.57 ng/ µl 1
Genaxxon Taq Polymerase S 0.5
H2O 37.5

Labeled: A1 and A2



PCR mixture for B

A = mdn cluster without XbaI recognition sites at one sites

Volume in µl
dNTPs (10 mM) 1
10x Genaxxon Taq Polymerase Buffer 5
25 mM MgCl2 2
pf_muta_XbaI (10 µM) 1.5
pr_ohne_muta 1.5
Template DNA, pARW089, 8.57 ng/ µl 1
Genaxxon Taq Polymerase S 0.5
H2O 37.5

Labeled: B1 and B2



Thermal cycling program

Program named MAXI1A

Step Temperature in °C Time in seconds
Hot start 94 Hold
Initial Denaturation 94 180
Denaturation 94 45
Annealing 51 45
Extension 72 45
Cycle number 25
Final extension 72 600



Output:

  • 2 samples (A1, A2, B1, B2) in left thermocycler


Further tasks:

  • Gel electrophoresis and DNA extraction, expected size 127 bases
  • Megaprimer PCR using the extracted DNA as primer
  • DpnI digestion with the half of each PCR reaction
  • Transformation using XL1-Blue cells


Agarose gel electrophoresis and DNA extraction of megaprimers

Time: 2011-10-06, 12:00-14:00


Investigators: Nicole, Jessica

Idea:Purification of megaprimers (used for site-directed mutagenesis)

Materials

  • Agarose
  • Gel red
  • 1x TAE Buffer
  • PCR products (A1, A2, B1, B2)
  • 6x Loadig Dye (Promega)
  • 100bp DNA ladder (Fermentas)
  • DNA ladder mix (Fermentas)
  • NucleoSpin Extract Kit II (Machery Nagel)

Methods:

Preparation of 2% Agarose gel

  • 1 g Agarose in 50 ml TAE
  • 2 µl Gel red

Loading of samples

  • 8 µl 6x Loading Dye and 50 µl of each PCR product
  • 5 µl 100 bp DNA ladder
  • 8 µl DNA ladder mix

Running agarose gel

DNA extraction and purification

  • using NucleoSpin Extract II (Machery Nagel)
  • following maufacturer's protocol
  • A1 and A2 resp. B1 and B2 using one column
  • Elution buffer: H2O, volume: 35 µl, incubation 5 min at 70°C

Results:

Expected sizes and positions of samples

Position Label Expected size in bases
1 100bp DNA ladder
2 A1 127
3 A2 127
4
5 B1 127
6 B2 127
7 DNA ladder mix


Gel picture

File:UP


DNA concentrations

  • A: c = 18.9 ng/ µl
  • B: c = 23.0 ng/ µl


Output:

  • Megaprimer A (both mutations), stored PCR box
  • Megaprimer B (one mutation, stored PCR box

Further tasks:

  • PCR using these megaprimers
  • DpnI digestion
  • transformation


Megaprimer PCR for site directed mutagenesis

Time: 2011-10-06, 14:00-17:00

Investigators: Nicole, Jessica

Idea:Site-directed mutagenesis of XbaI restriction sites within the mdn cluster (use as biobrick)

Materials

  • Megaprimer (A and B), 2011-10-06, Jessica&Nicole
  • pARW089 clone 2, 85.7 ng/ µl
  • PfuUltra Polymerase (Agilent)
  • 10x PfuUltra Polymerase Buffer
  • dNTPs (10 mM)

Methods:
PCR mixture

  • A = mdn cluster without XbaI recognition sites at both sites
  • B = mdn cluster without XbaI recognition sites at one sites
dNTPs (10 mM) 1
10x PfuUltra Polymerase Buffer 5
Megaprimer 0.5 (approx. 3.91 ng needed)
25 mM MgCl2 2
Template DNA, pARW089, 85.7 ng/ µl 1.2
PfuUltra Polymerase 2
H2O 40.3



Thermal cycling program

Program named MAXI5

Step Temperature in °C Time in seconds
Hot start 94 Hold
Initial Denaturation 94 300
Denaturation 94 30
Annealing 60 60
Extension 68 20 min 50 sec
Cycle number 7
Denaturation 94 30
Annealing 60 60
Extension 68 20 min 50 sec + 10 sec per cycle
Cycle number 8



Output:

  • 2 samples in left thermocycler, labeled 2A and 2B

Further tasks:

  • DpnI digestion with the half of each PCR reaction
  • Transformation using XL1-Blue cells


103th Labday 2011-10-07

DpnI digestion and Transformation of mutated pARW089

Time: 2011-10-07

Investigators: Nicole für Sebastian ;), done by Jessica

Aim:Site-directed mutagenesis of the mdn cluster (use as biobrick)

Materials:

  • DpnI (10 U/ µl)
  • PCR products, 2A and 2B, stored in freezer (or thermal cylcer)


  • LB medium
  • 4 agar plates with ampicillin


Methods:

DpnI digestion

  • add 0.5 µl DpnI to 25 µl of the PCR product
  • 0.5 µl DpnI
  • 25 µl PCR product
  • 2.8 µl NEB 4 buffer
  • mix gently and thoroughly by pipetting up and down or by vortexing
  • incubate 1 hour at 37°C


  • the other 25 µl of PCR product: undigested



Transformation

  • add 2 µl PCR product (one sample = DpnI digested, second sample = undigested) to competent cells
  • incubate 30 min one ice
  • heat pulse: 45 sec at 42°C
  • 2 min on ice
  • add 750 µl LB medium to each sample
  • incubate 1 hour at 37°C and 850rpm
  • cenrifugation and resuspend in 500 µl LB medium
  • plate 250 µl on each of two plates with ampicillin or kanamycin antibiotic
  • incubate the transformation plates at 37°C for more than 16 hours


Output:

plates in incubator:

  • Sample a (cluster without any XbaI recognition site), DpnI digested
  • Sample a (cluster without any XbaI recognition site), undigested
  • Sample b (cluster with one XbaI recognition site), DpnI digested
  • Sample b (cluster with one XbaI recognition site), undigested


Further tasks:

  • preparation of overnight cultures of several clones, especially from DpnI digested samples
  • Miniprep


Retransformation of XL1blue-cells with pPDV089

Investigators: Sandrina


Aim: produce cells for phage display


Method/Materials:

  • addition of 0,3 µl ligated vector pPDV089 from clone 2S14 (after plasmid preperation) to competent XL1-blue cells
  • incubation 25 min on ice,
  • heat shock 45 sec at 42°C,
  • incubation 2 min on ice,
  • addition of 750 µl LB medium,
  • incubation 60 min at 37 °C and 750 rpm
  • plating on agar plates containing 100 µg/ml ampicillin
  • storage over night at 37°C


Further tasks:

  • over night culture, amplification of cells for phage display, test digestion

104th Labday 2011-10-11

Oligo-Fillin for Phage-display-mdnA-library (carrying AgeI restriction site)

Investigators: Nicole

Time: 2011-10-11, 9:00-14:00

Aim: Production of a library carrying mutated mdnA for phage-display (carrying ageI restriction site)


Material:

  • oligos (25 mM, HPLC purified, ordered by Sigma Aldrich):
    • o_mdnA_library, 76
    • o_focused_library_AgeI, 85


  • 10x Klenow buffer
  • dNTPs (10 mM)
  • H2O


  • Machery Nagel NucleoSpin Extract II Kit


Method:

  • Reaction mix (total volume: 50 µl)
    • 3 µl fw-oligonucleotide
    • 3 µl rev-oligonucleotide
    • 5 µl dNTPs
    • 5 µl Klenow buffer
    • 34 µl H2O


  • Reaction conditions
    • Program: ORIGAMI1


  • after finishing program ORIGAMI1:
    • addition of 1 µl Klenow-fragment
    • incubation 1 hour, 37°C


  • PCR purification using Machery Nagel NucleoSpin Extract II Kit, following manufacturer's protocol


Results:

  • purified hybridized oligos for production of mdnA-library


Output:

  • hybridization product: purified AgeI-library, named AgeI 2
  • stored in box: library, freezer


Further tasks:

  • restriction enzyme digestion and ligation


Troubleshooting: Site-directed mutagenesis of pARW089 (for use as biobrick)

Investigators: Nicole

Time: 2011-10-11, 11:00

Aim: Site-directed mutagenesis of XbaI recognition site within the mdn-cluster


Ideas:

Based on QuickChange II Site-Directed mutagenesis Kit, Instruction manual

  • 2nd Transformation: increased DpnI treated DNA -> 4 µl
  • Agarose gel --> at least 80% of DNA supercoiled
  • Ethanol precipitation of DpnI digested PCR product, resuspension in decreased water volume and transformation


  • 2nd PCR using LongPCR enzyme mix (Fermentas)


Further tasks:

see ideas


Megaprimer PCR for site directed mutagenesis

Time: 2011-10-06, 11:30-13:00

Investigators: Nicole, Jessica

Idea:Site-directed mutagenesis of XbaI restriction sites within the mdn cluster (use as biobrick)

Materials

  • Megaprimer (A and B), 2011-10-06, Jessica&Nicole
  • pARW089 clone 2, 85.7 ng/ µl
  • LongPCR enzyme mix (Fermentas)
  • 10x Long PCR enzyme mix buffer (15 mM MgCl2)
  • dNTPs (10 mM)

Methods:
PCR mixture

  • based on [[File: ]]
  • A = mdn cluster without XbaI recognition sites at both sites
  • B = mdn cluster without XbaI recognition sites at one sites
dNTPs (10 mM) 1
10x LOng PCR enzyme mix (Fermentas) 5
Megaprimer 0.5 (approx. 50 pmol)
Template DNA, pARW089, 85.7 ng/ µl 1.2
PfuUltra Polymerase 0.3
H2O 42



Thermal cycling program

Program named MAXI5

Step Temperature in °C Time in seconds
Hot start 94 Hold
Initial Denaturation 94 300
Denaturation 94 20
Annealing 60 60
Extension 68 8 min 50 sec
Cycle number 7
Denaturation 94 20
Annealing 60 60
Extension 68 8 min 50 sec + 5 sec per cycle
Cycle number 8



Output:

  • 2 samples in left thermocycler, labeled A and B

Further tasks:

  • DpnI digestion with the half of each PCR reaction
  • Transformation using XL1-Blue cells


Digestion of ligation product geneIII into pARW089 (pARWIII) for ligation with generated mdnA library

Investigator: Sandrina


Aim: get digested pARW089 (without mdnA) and geneIII for ligation with generated mdnA library


Material/Method:

  • 30 µl/160 µg/ml pARWIII
  • 1 µl restriction enzyme SfoI
  • 1 µl restriction enzyme AatII
  • 4 µl NEB 10x buffer 4
  • 2 µl water
  • 3 h, 37°C


Further Task:

  • purification
  • ligation


DpnI digestion and Transformation of mutated pARW089

Time: 2011-10-11

Investigators: Jessica, Nicole

Aim:Site-directed mutagenesis of the mdn cluster (use as biobrick)

Materials:

  • DpnI (10 U/ µl)
  • PCR products, A and B
  • LB medium
  • 4 agar plates with ampicillin


Methods:

DpnI digestion

  • add 0.5 µl DpnI to 25 µl of the PCR product
  • 0.5 µl DpnI
  • 25 µl PCR product
  • mix gently and thoroughly by pipetting up and down or by vortexing
  • incubate 1 hour at 37°C


  • the other 25 µl of PCR product: undigested



Transformation

  • add 2 µl PCR product (one sample = DpnI digested, second sample = undigested) to competent cells
  • incubate 30 min one ice
  • heat pulse: 45 sec at 42°C
  • 2 min on ice
  • add 750 µl LB medium to each sample
  • incubate 1 hour at 37°C and 850rpm
  • cenrifugation and resuspend in 500 µl LB medium
  • plate 250 µl on each of two plates with ampicillin or kanamycin antibiotic
  • incubate the transformation plates at 37°C for more than 16 hours


Output:

plates in incubator:

  • Sample a (cluster without any XbaI recognition site), DpnI digested
  • Sample a (cluster without any XbaI recognition site), undigested
  • Sample b (cluster with one XbaI recognition site), DpnI digested
  • Sample b (cluster with one XbaI recognition site), undigested


Further tasks:

  • preparation of overnight cultures of several clones, especially from DpnI digested samples
  • Miniprep


Over night culture of retransformed pPDV089

Investigator: Sandrina


Aim: production of phages carrying mdnA on their surface


Material/Method:

  • LB medium with ampicillin (1:1000)
  • incubate shaking over night at 37°C


Further Task:

production of phages

Digestion of geneIII for ligation with generated mdnA library

Investigator: Sandrina


Aim: get digested geneIII for ligation with generated mdnA library


Material/Method:

  • 50 µl/10 µg/ml geneIII
  • 1 µl restriction enzyme NgoMIV
  • 6 µl NEB 10x buffer 1
  • 3 µl water
  • 1 h, 37°C


Further Task:

  • ligation


Transformation of mutated pARW089 with increased amount

Time: 2011-10-11, 17:00-20:00

Investigators: Jessica, Nicole

Aim:Site-directed mutagenesis of the mdn cluster (use as biobrick)

Materials:

  • PCR products, 2A and 2B
  • LB medium
  • 2 agar plates with ampicillin


Methods:

  • add 2 µl PCR product (one sample = DpnI digested, second sample = undigested) to competent cells
  • incubate 30 min one ice
  • heat pulse: 45 sec at 42°C
  • 2 min on ice
  • add 750 µl LB medium to each sample
  • incubate 1 hour at 37°C and 850rpm
  • cenrifugation and resuspend in 500 µl LB medium
  • plate 250 µl on each of two plates with ampicillin or kanamycin antibiotic
  • incubate the transformation plates at 37°C for more than 16 hours


Output:

plates in incubator:

  • Sample 2A (cluster without any XbaI recognition site), DpnI digested
  • Sample 2B (cluster with one XbaI recognition site), DpnI digested


Further tasks:

  • preparation of overnight cultures of several clones, especially from DpnI digested samples
  • Miniprep


Digestion of mdnA library (for phage display) using AgeI

Investigator: Jessica, Nicole

Time: 2011-10-11, 17:00-18:00

Aim: Production of pUPIII (carrying mdnA-library and gene III) for screening by phage display


Materials:

  • NEB Buffer 1
  • AgeI (NEB)
  • purified oligos, lib AgeI, Nic, 2011-10-11


Methods:

  • 25 µl purified PCR product (lib AgeI)
  • 3 µl NEB Buffer 1
  • 2 µl AgeI


Result/ Output:

  • digested library for phage display, digested lib AgeI, stored freezer (box library)


Further Task:

  • purification of digested lib AgeI
  • tripple ligation with gene III and pARWIII
  • transformation


Purification of digested mdnA library and digested gene III

Investigator: Sandrina, Jessica, Nicole

Time: 2011-10-11, 18:00-19:00

Aim: Production of pUPIII (carrying mdnA-library and gene III) for screening by phage display


Materials:

  • Machery Nagel Nucleo Spin Extract II Kit


Methods:

  • following Machery Nagel Nucleo Spin Extract II Kit
  • Exceptions:
    • Elution buffer: H2O
    • Elution volume: 25 µl
    • Incubation 5 min, 70°C (before 1 min centrifugation)


Results:

  • concentrations:
    • mdnA library: c = 174 ng/ µl
    • gene III: c = 20.7 ng/ µl


Output:

  • purified and digested
    • gene III
    • mdnA library


Further Task:

  • tripple ligation with gene III and pARWIII
  • transformation


Triple Ligation with pARWIII, mdnA-library and gene III

Investigator: Sandrina, Jessica, Nicole

Time: 2011-10-11, 19:00-20:00

Aim: Production of pUPIII (carrying mdnA-library and gene III) for screening by phage display


Materials:

  • T4 DNA ligase buffer (Fermentas)
  • T4 DNA ligase
  • purified and digested gene III, 2011-10-11, Nic
  • purified and digested mdnA library, 2011-10-11, Nic
  • purified and digested pARWIII, 2011-10-11, San


Methods:

Concentrations and size of inserts and backbone

Concentration in ng/ µl Size in bases
gene III 20.7 541
mdnA library 174 161
pARWIII 34.8 9989


Ligation mix

  • 2 µl T4 DNA ligase buffer
  • 1 µl T4 DNA ligase
  • 13 µl pARWIII
  • 3.5 µl gene III
  • 1 µl mdnA library


  • for transformation control: instead of geneIII and mdnA library 4.5 µl H2O


Results/ OUtput:

  • ligation product, named geneIII mdnA lib pARWIII, 2011-10-11, stored in freezer (libary box)
  • transformation control, named H2O, 2011-10-11, stored in freezer (library box)


Further Task:

  • transformation


Transformation of triple ligated mdnA library, gene III and pARWIII

Time: 2011-10-11, 19:45-22:00

Investigators: Sandrina, Jessica, Nicole

Aim:Site-directed mutagenesis of the mdn cluster (use as biobrick)

Materials:

  • XL1-Blue chemocompetent cells
  • ligation product, named geneIII mdnA lib pARWIII, 2011-10-11
  • transformation control, named H2O, 2011-10-11


  • add 2 µl PCR product to competent cells (for ligation product 5 samples overall)
  • incubate 25 min one ice
  • heat pulse: 45 sec at 42°C
  • 2 min on ice
  • add 750 µl LB medium to each sample
  • incubate 45 min at 37°C and 850rpm
  • cenrifugation and resuspend in 200 µl LB medium
  • plate 200 µl on plates with ampicillin
  • incubate the transformation plates at 37°C for approx. 16 hours


Output:

plates in incubator:

  • pUPIII 1-5, 2011-10-11, San&Nic
  • transformation control, 2011-10-11, San&Nic


Further tasks:

  • preparation of overnight cultures of several clones
  • Miniprep


Sidedirected mutagenesis of HRV14 3C protease

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul, Sebastian


Aim: Sidedirected mutagenesis of TEV and PreSciccion protease

Materials:

  • HRV14 3C protease vector (P10 by Gunther Stier)
  • different Primers
  • Phusion polymerase kit by NEB

Methode:

PCR

  • Template: 1 µL
  • Nucleotides: 1 µL of 10 mM ready to use dNTP mix
  • 10 µL 5 x Phusion GC Buffer
  • 2,5 µL primers = 25 pmol absolute (2,5 µL of each primer, see list below)
  • 32,5 µL of pure water
  • 0,5 µL Phusion HF polymerase


Program:

  • Denat: 30 sec 98°C
  • 30x

Denat: 10 sec 98°C

Annealing+Extend: 25 sec 72°C

  • Final Extend: 10min 72°C


Used Primers:

Fragment 1 of HRV14 3C protease (P1):

  • f_HRV14 3C_AraFusion_NgoMIV
  • r_HRV14 3C_ACCAGC

Fragment 2 of HRV14 3Cprotease (P2):

  • f_HRV14 3C_ACCAGC
  • r_HRV14 3C_tm_Xba208_A-T

Fragment 3 of HRV14 3Cprotease (P3):

  • f_HRV14 3C_tm_Xba208_A-T
  • r_HRV14 3C_tm_Xba280_A-T

Fragment 4 of HRV14 3Cprotease (P4):

  • f_HRV14 3C_tm_Xba280_A-T
  • r_HRV14 3C_iGEM_BamHI

Further Tasks:

PCR purification, analytical Gel to check sizes of the amplified fragments, assembly PCR of Fragment

Analytical gelelctrophoresis and PCR clean up of sidedirected mutated fragments P1, P2,P3 and P4 of HRV14 3C

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul, Sebastian


Aim: Check the size of amplified fragments and clean them up after PCR

Materials:

  • PCR fragments P1-P4
  • Fermentas 6x loading dye
  • 100bp ladder (Gene Ruler by Fermentas)
  • Macherey-Nagel Nucleo Spin II Kit for clean up

Methode:

  • Clean up after manual for PCR purification of the used Kit
  • gel electophoresis (1.5 % agarose gel with analytical gel pockets): 30 min at 110 V

Results:

The sizes of the fragments of the PCR products are matching the fragment sizes extracted with Geneious.

Further Tasks: Merge of PCR fragments P5 and P6 into PreSciccion protease, digestion of TEV protease with NgoMIV and BamHI, Ligation of TEV protease with digested AraC induction system (NgoMIV and HindIII) and digested pJC354_ssTorA_XhoI_CS-TEV_NheI_BlaFL (HindIII and BamHI)

Assembly PCR of mutated HRV14 3C protease fragments

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Stefan, Sebastian


Aim: Assembly of mutated TEV and PreSciccion protease fragments

Materials:

  • HRV14 3C protease fragments P1 and P2 --> P5
  • HRV14 3C protease fragments P3 and P4 --> P6
  • different Primers
  • Phusion polymerase kit by NEB

Methode:

PCR

  • Template: 2 µL (1µl of each fragment after sizes were checked and fragments got cleaned up with PCR clean up kit from Macherey-Nagel (Nucleo Spin Kit))
  • Nucleotides: 1 µL of 10 mM ready to use dNTP mix
  • 10 µL 5 x Phusion HF Buffer
  • 2,5 µL primers = 25 pmol absolute (2,5 µL of each primer, see list below)
  • 31,5 µL of pure water
  • 0,5 µL Phusion HF polymerase


Program:

  • Denat: 30 sec 98°C
  • 30x

Denat: 10 sec 98°C

Annealing+Extend: 35 sec 72°C

  • Final Extend: 10min 72°C


Used Primers:

Assembly of fragment 1 and fragment 2 of HRV14 3C protease (P1+P2)--> mutated HRV14 3C protease fragment 5 (P5):

  • f_HRV14 3C_AraFusion_NgoMIV
  • r_HRV14 3C_tm_Xba208_A-T

Assembly of fragment 3 and fragment 4 of HRV14 3C protease (P3+P4)--> mutated HRV14 3C protease fragment 6 (P6):

  • f_HRV14 3C_tm_Xba208_A-T
  • r_HRV14 3C_iGEM_BamHI

Further Tasks:

PCR purification, analytical Gel to check sizes of the amplified fragments, assembly PCR of Fragment

Analytical gelelctrophoresis and PCR clean up of sidedirected mutated fragments P5 and P6 of HRV14 3C

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul, Sebastian


Aim: Check the size of amplified fragments and clean them up after PCR

Materials:

  • PCR fragments P5 and P6
  • Fermentas 6x loading dye
  • 100bp ladder (Gene Ruler by Fermentas)
  • Macherey-Nagel Nucleo Spin II Kit for clean up

Methode:

  • Clean up after manual for PCR purification of the used Kit
  • gel electophoresis (1.5 % agarose gel with analytical gel pockets): 30 min at 110 V

Results:

The sizes of the fragments of the PCR products are matching the fragment sizes extracted with Geneious.

Further Tasks: Merge of PCR fragments P5 and P6 into PreSciccion protease, digestion of TEV protease with NgoMIV and BamHI, Ligation of TEV protease with digested AraC induction system (NgoMIV and HindIII) and digested pJC354_ssTorA_XhoI_CS-TEV_NheI_BlaFL (HindIII and BamHI)

Assembly PCR of mutated HRV14 3C protease fragments P5 and P6

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Stefan, Sebastian


Aim: Assembly of mutated TEV and PreSciccion protease fragments

Materials:

  • PreSciccion protease fragment P5
  • PreSciccion protease fragment P6
  • different Primers
  • Phusion polymerase kit by NEB

Methode:

PCR

  • Template: 2 µL (1µl of each fragment after sizes were checked and fragments got cleaned up with PCR clean up kit from Macherey-Nagel (Nucleo Spin Kit))
  • Nucleotides: 1 µL of 10 mM ready to use dNTP mix
  • 10 µL 5 x Phusion HF Buffer
  • 2,5 µL primers = 25 pmol absolute (2,5 µL of each primer, see list below)
  • 31,5 µL of pure water
  • 0,5 µL Phusion HF polymerase


Program:

  • Denat: 30 sec 98°C
  • 30x

Denat: 10 sec 98°C

Anneal+Extend: 35 sec 72°C

  • Final Extend: 5 min 72°C


Used Primers:

Assembly of fragment 5 and fragment 6 of HRV14 3C protease (P3+P4)--> mutated PreSciccion portease fragment 6 (P6):

  • f_HRV14 3C_AraFusion_NgoMIV
  • r_HRV14 3C_iGEM_BamHI

Further Tasks:

PCR purification, analytical Gel to check sizes of the amplified fragments, digest and ligation with other fragments

105th Labday 2011-10-12

Production of phages containing pPDV089 in XL1-blue cells

Investigators:Sandrina


Aim: production of phages carrying unmodified mdnA on their surface


Method/Materials:

  • first step: amplification of cells containing pPDV089 (clone: 2S14):
  • 500 ml LB medium will be inoculated with the cells, so that OD600 = 0.1
  • add antibiotics tetracyclin and ampicillin to the medium
  • cells should be incubated 37 °C till OD 600 = 0.3-0.5 (here: 0.356) is reached
  • second step: infection with helper phages
  • add helper phages 10^11 phages/50 ml (3,5 µl)
  • incubate for 10 min at 37°C (without shaking!)
  • add 0,5 mM IPTG
  • incubate 50 min at 28°C and rpm
  • add 70 µg/ml kanamycin and incubate for 5 h at 28°C (...)
  • third step: phage purification
  • centrifuge cell culture at 5000 x g/ 15 min
  • fill supernatant in a new 50 ml falcon and centrifuge again (5000 g/15 min)
  • 40 ml of the supernatant with 8 ml PEG-NaCl (20% (w/v) PEG-8000, 2,5 M NaCl)
  • incubate over night at 4°C


Further tasks:

  • go on with phage purification

Production of microviridin

Time: 2011-10-12, 09:30-19:30

Investigators: Sandrina, Jessica, Nicole

Aim: Culturing cells to produce microviridin

Materials:

  • LB medium
  • overnight cultures of pARW089
  • 500mM Tris-HCL

Method:

  • 17 ml overnight culture + 374 ml LB medium
  • incubation for 7.5 h
  • one @ 30°C
  • one @ 37°C
  • centrifuged @ 4000g for 15 min
  • washed with 500mM Tris-HCL
  • centrifuged
  • supernatant discarded
  • pellet stored @ -20°C


Output:

  • four 50 ml falcons (2x 30°C, 2x 37°C)


Further tasks:

  • preparing samples for HPLC


Digest of HRV14 3C, AraC and Vector SG11

Investigator: Paul Stefan Sebastian


Material:

Enzymes: (all pruchased from NEB)

  • EcoRI-HF
  • PstI-HF
  • NgoMIV

DNA-Fragments:

  • mutated HRV14 3Cprotease
  • AraC
  • SG11

NEBuffer 4


Methode:

All digestion batches got a total volume of 10µl and were incubated for 2 h at 37°C:

  • 1µl Buffer
  • 1µl each Enzyme
  • 0,1 µl BSA if required
  • 7 or 6,9 µl DNA

HRV14 3C got digested with PstI-HF+NgoMIV, AraC was digested with NgoMIV+EcoRI-HF. Vector SG11 which containing the cleavage site for the HRV14 3C got digested with EcoRI-HF+PstI-HF.


Output:

Digested fragements:

  • NgoMIV_HRV14 3C_PstI
  • EcoRI_AraC_NgoMIV
  • PstI_SG11_EcoRI


Further Tasks:

Clean up of all fragments with PCR CleanUp Kit by M&N, ligation of fragments and transformation into E.coli XL1 blue.

Ligation of digested fragments of HRV14_3C protease and vector SG11 and Transformation of XL1 blue with Ligation products

Investigators: Stefan, Sascha, Paul

Materials:

Fragments:

  • NgoMIV_PreSciccion_PstI
  • EcoRI_AraC_NgoMIV
  • PstI_SG11_EcoRI

QuickLigase purchased by Fermentas

QuickLigase 10x Buffer purchased by Fermentas

Methodes:

Standard ligation protocol from Fermantas for QuickLigase Kit. Ratio between vector and both fragments (protease and AraC-induction system) where 3:3:1.

Batch was incubated for 10 min at 37°C. After 10 min, all batches where put on ice.

Output:

  • ligation batch

Next Step:

Transformation of XL1 blue E.coli with ligation batch using the standard protocol for heat shock transformation. Transformed cells were platted on agar plates containing cm as antibiotic.

Further tasks:

  • colony PCR to get to know, which clones are positive and for all positive clones: mini-prep of plasmid DNA, sequencing and preparation of glycerol stock clutures.

106th Labday 2011-10-13

Preparation of samples for HPLC analysis

Time: 2011-10-13

Investigators: Jessica, Nicole

Material:

  • pellets of pARW089 samples (from 2011-10-13)
  • 100% methanol
  • 5% methanol
  • sterile water
  • Sep-Pak Cartridges
  • speed vac

Method:

  • pellet was resuspended in 5 ml of sterile water
  • the resuspended sample was sonicated for 4 min (2 sec on, 2 sec off)
  • centrifugation for 15 min @ 4000 rpm in eppendorf Centrifuge 5810 R
  • supernatant was transfered to Sep-Pak Plus C18 Cartridges, that were equilibrated with 2 ml of 100% methanol
  • cartridges were washed with 2 ml water
  • samples were loaded
  • cartridges were washed with 2 ml of 5% methanol
  • samples were eluted with 2 ml of 100% methanol
  • samples were put in a speedvac so that the methanol can evaporate


Transformation of mutated pARW089 using super competent XL1 gold cells

Time: 2011-10-13, 16:30-19:00

Investigators: Jessica, Nicole

Aim: Site-directed mutagenesis of pARW089 (carrying XbaI recognition sites) for use as biobrick

Material:

  • super competent XL1 gold cells (tet and cm resistance), given by Site directed mutagenesis lightening kit (stratagene)
  • PCR product of site-directed mutagenesis, DpnI digested, Nic&Jes 2011-10-07
  • ß-Mercaptoethanol
  • SOC medium
  • Agarplate containing Amp


Method:

Followed by manufacturer's protocol File:UP

  • use 45 µl cells (thawn at ice)
  • add 2 µl ß-mercaptoethanol
  • incubate 2 min on ice
  • add 2 µl DpnI-treated sample (mixing)
  • incubate 30 min on ice
  • heat impulse: 42°C 30 sec
  • incubate 2 min on ice
  • add 500 µl SOC medium
  • incubate 1 hour at 37°C and 250 rpm
  • plate 500 µl on one agarplate (Amp)
  • incubate over night at 37°C


Results/ Output:

  • agar plate with mutated pARW089, named DpnI dig. pARW089 2011-10-13
  • stored in 37°C incubator


Further tasks:

  • Picking over night cultures
  • miniprep


Purification of phages containing pPDV089

Investigators: Sabine, Sandrina


Aim: phages carrying unmodified mdnA on their surface


Method/Materials:

  • after over night incubation:
  • centrifuge precipitaed phages: 5000 x g/ 45 min
  • discard supernatant
  • centrifuge again, 5000 x g/ 5 min
  • remove supernatant carefully
  • take pellet in 1 ml TBS
  • move in 1.5 ml Eppi
  • centrifuge again: 17000 x g/10 min
  • supernatant in a new Eppi with 200 µl PEG-NaCl (mix!)
  • incubate on ice for 60 min
  • centrifuge precipitated phages: 17.000 x g/ 10 min (4°C)
  • resuspend pellet in 300 µl TBS
  • centrifuge:17 000 x g/ 10 min (4°C)
  • supernatant in a fresh eppi= purified phages


Further tasks:

  • ELISA and phage display


Colony PCR of plated HRV14_3C containing colonies

Investigators: Stefan, Paul, Sebastian

Aim:

Checking for positive clones

Used Primer:

f_HRV14_3C_iGEM, r_HRV14_3C_iGem:BamHI

Method:

  • 2,5µl of each primer (10µM) = 5µl
  • 5µl 10y polymerase buffer
  • 2µl 25mM MgCl2
  • 1µl dNTP mix
  • 0,5µl Taq-Polymerase (GenAxxon)
  • 36,5 µl H2O

=50µl

Colonies were picked with a 20µl tip, dipped into PCR batch, and then plunged into 1ml LB to grew cells from picked colony (from these 1ml batches overnight cultures will be inoculated in case of positive clones).

  • 20 colonies were picked HRV14 3C protease (see entry from 01.09.2011) = 20 PCR batches.

PCR Program:

Initial denat = 3min 94°C

25x

denat: 2min 10sec 94°C

anneal: 2min 10sec 70°C

extend: 1min 72°C

final extend: 10min 72°C

  • The PCR products were resolved on a 1% analytical agarose gel

Results:

all clones were positive, 2 were selected for further studies.

Further Tasks:

overnight culture, mini prep, test digest, sequencing of clones and survival screening

107th Labday 2011-10-14

Digest of pARWIII and ligation with library

Time: 2011-10-14

Investigators: Sandrina, Jessica, Nicole

Material:

Method:

Digest of pARWIII

Gel electrophoresis

Gel purification

Digest of geneIII

Purification

Ligation

  • 2 µl T4 ligase buffer
  • 1 µl T4 ligase
  • 6 µl pARW089
  • 10 µl geneIII
  • 1 µl mdnA library

Output:

  • 3 ligation products stored @ -20°C

Further task:

  • transformation of one ligation product and control


108th Labday 2011-10-15

Transformation with library for phage display

Time: 2011-10-15

Investigators: Sabine, Jessica

Material:

Method:

Output:

Further task:


Miniprep, Glycerol stock cultures and Survival-Test of HRV14 3C clone(SG24-P10)

Investigators: Paul, Stefan, Sascha

Aim: Getting Plasmid DNA, establish a glycerol stock culture and test whether TorA-detection device is working

Mateials::

  • Mini prep Kit purchased by M&N
  • steril Glycerol
  • different Agarplates
  • overnight culture of SG24

Plates:

  • 1x Cm (25 µg/ml)
  • 1x Cm + 1mM IPTG
  • 1x Cm + 2% Ara
  • 1x Cm + 2% Ara +1mM IPTG
  • 1x Cm + Amp (100 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (25 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (50 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (75 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (100 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (150 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (200 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (300 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (400 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (600 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (800 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (25 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (50 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (75 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (100 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (150 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (200 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (300 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (400 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (600 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (800 µg/ml)

Method:

  • for glycerol stock, cells were mixed in a 1:1 ratio with steril glycerol
  • plasmid isolation based on the manual of M&N
  • for survival screening 50µl of cell dilution with OD=0.002 were plated on prepared plates

Results:

No Cell death visible, repeat with different Temperature!

Further Tasks:

  • repeat survival test at 30 °C

109th Labday 2011-10-16

Overnight culture of library

Time: 2011-10-16

Investigators: Jessica

Material:

Method:

Output:

Further task:


Survival-Test of one HRV14_3C clone( SG24-P10)

Investigators: Paul, Stefan, Sascha

Aim: Test whether TorA-detection device functions

Mateial

different agaplates, overnight culture of SG24

Plates:

  • 1x Cm (25 µg/ml)
  • 1x Cm + 1mM IPTG
  • 1x Cm + 2% Ara
  • 1x Cm + 2% Ara +1mM IPTG
  • 1x Cm + Amp (100 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (25 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (50 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (75 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (100 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (150 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (200 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (300 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (400 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (600 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (800 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (25 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (50 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (75 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (100 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (150 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (200 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (300 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (400 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (600 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (800 µg/ml)

Method:

  • for survival screening 50µl of cell dilution with OD=0.002 were plated on prepared plates and incubated for 2 days at 30°c

Results:

No Cell death visible!

Further Tasks:

  • thinking in progress...

110th Labday 2011-10-17

Amplification of megaprimer 1 (site-directed mutagenesis)

Time: 2011-10-17

Investigators: Nadja, Jessica

Aim: Site-directed mutagenesis of pARW089 for use as biobrick, improved strategy was used

Material:

  • primers 86, 87, 88
  • pARW089, 8.57 ng/ µl

Method:

Samples and used primers

  • a) pARW089 with both mutations: pf_muta_XbaI (86), pr_muta_XbaI (87)
  • b) pARW089 with one mutation: pf_muta_XbaI (86), pr_ohne_muta (88)

PCR mixture

Volume in µl
dNTPs (10 mM) 1
10x Genaxxon buffer S 5
25 mM MgCL22
Primer forward (10 µM)1.5
Primer reverse (10 µM)1.5
DNA pARW089 (8.57 ng/ul)1
Genaxxon Taq Polymerase S0.5
H2O 37.5

PCR conditions (Thermal cycler)

Programm IGMI1

Time Temp.
Hold94°C
Initial denaturation 3 min94°C
Denaturation 45 sec 94°C
Annealing 45 sec 51°C
Extension 45 sec 72°C
Number of cycles 30 x
Final extension 10 min 72°C

Output:

  • PCR products, A and B


Further task:

  • Agarose gel ellectrophoresis and purification
  • Megaprimer PCR 2 (with this purified primers)


Megaprimer PCR II (amplification of 2nd megaprimer (2nd part of mdn cluster, site-directed mutagenesis)

Time: 2011-10-18

Investigators: Nadja, Jessica, Nicole

Aim: Site-directed mutagenesis of pARW089 for use as biobrick, improved strategy was used

Material:

  • primers: megaprimer A and B, Jes&Nad 2011-10-17, r_mdn_iGEM
  • pARW089, 8.57 ng/ µl
  • LongPCR enzyme mix + buffer (fermentas)
  • dNTPs (10 mM)


Methods:

Samples and used primers

  • A) pARW089 with both mutations: Megaprimer 1 - A and pr_mdn_iGEM
  • B) pARW089 with one mutation: Megaprimer 1 - B and pr_mdn_iGEM


PCR mixture

Volume in µl
dNTPs (10 mM) 1
Long PCR enzyme mix 5
Primer forward, megaprimer (32 ng/ µl)(20
Primer reverse (10 µM) 1
DNA pARW089 (8.57 ng/ul) 5
Long PCR enzyme mix 0.3
H2O 17.7


PCR conditions (Thermal cycler)

Programm IGMAXI3

Time Temp.
Hold94°C
Initial denaturation 5 min94°C
Denaturation 30 sec 94°C
Annealing 30 sec 55°C
Extension 30 sec 68°C
Number of cycles 15 x
Final extension 10 min 68°C


Output:

  • PCR products, A and B


Further tasks:

  • Gel electrophoresis and purification
  • megaprimer PCR 3


Sequencing of mdnA library (for phage display)

Time: 2011-10-18

Investigators: Sandrina, Nicole

Aim: Producation of mdnA library (for phage display), confirmation of diversity

Material:

  • Library clone 1 and 5, San, 2011-10-18
  • sf_mdnA_1


Methods:

Concentration of DNA and used DNA amount

DNA concentration in ng/ µl Volume DNA in µl Volume H2O in µl
Library clone 1 60.8 20 0
Library clone 5 98.5 14 6


Primer used: sf_mdnA_1



Output:

  • samples sent for sequencing


Further tasks:

  • Analysis of sequencing


Over night culture with created mdnA library for phage display

Investigators: Sandrina


Aim:Phage display with microviridin library


Method/Materials:

  • LB medium
  • ampicillin and tetracyclin


Further tasks:

  • phage production and phage display


111th Labday 2011-10-18

Production of phages containing microviridin library on their surface in XL1-blue cells

Investigators:Sandrina, Sabine


Aim: production of phages carrying modified mdnA on their surfac for screening by phage display


Method/Materials:

  • first step: amplification of cells containing mutated mdnA:
  • 500 ml LB medium will be inoculated with the cells, so that OD600 = 0.1
  • add antibiotics tetracyclin and ampicillin to the medium
  • cells should be incubated 37 °C till OD 600 = 0.3-0.5 (here: 0.356) is reached
  • second step: infection with helper phages
  • add helper phages 10^11 phages/50 ml (3,5 µl)
  • incubate for 10 min at 37°C (without shaking!)
  • add 0,5 mM IPTG
  • incubate 50 min at 28°C and rpm
  • add 70 µg/ml kanamycin and incubate for 5 h at 28°C (...)
  • third step: phage purification
  • centrifuge cell culture at 5000 x g/ 15 min
  • fill supernatant in a new 50 ml falcon and centrifuge again (5000 g/15 min)
  • 40 ml of the supernatant with 8 ml PEG-NaCl (20% (w/v) PEG-8000, 2,5 M NaCl)
  • incubate over night at 4°C


Further tasks:

  • go on with phage purification

Sidedirected mutagenesis of TEV protease

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul, Sebastian


Aim: Sidedirected mutagenesis of TEV protease

Materials:

  • TEV protease vector (P9 by Gunther Stier)
  • different Primers
  • Phusion polymerase kit by NEB

Methode:

PCR

  • Template: 1 µL
  • Nucleotides: 1 µL of 10 mM ready to use dNTP mix
  • 10 µL 5 x Phusion GC Buffer
  • 2,5 µL primers = 25 pmol absolute (2,5 µL of each primer, see list below)
  • 32,5 µL of pure water
  • 0,5 µL Phusion HF polymerase


Program:

  • Denat: 30 sec 98°C
  • 30x

Denat: 10 sec 98°C

Anneal+Extend: 25 sec 72°C

  • Final Extend: 5min 72°C


Used Primers:

Fragment 1 of TEV protease (T1):

  • f_TEV_AraFusion_NgoMIV
  • r_TEV_ACCAGC

Fragment 2 of TEV protease (T2):

  • f_TEV_ACCAGC
  • r_TEV_iGEM_BamHI

Further Tasks:

PCR purification, analytical Gel to check sizes of the amplified fragments, assembly PCR of Fragment

PCR purification and analytical GE

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul, Sebastian


Aim: Clean up PCR Fragments T1 and T2 and check sizes of fragments

Materials:

  • M&N PCR puri Kit

Methode:

Kit was used after manual of M&N

Sizes of fragments were checked in 1% agarose gel, 5µl were mixed with 1µl 6xLoading Dye.

Output

Fragments with the right size and clean fractions of T1 and T2

Further Tasks:

Assembly PCR, Digest of Fragments, Ligation and Transformation


Assembly PCR of TEV protease

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul, Sebastian


Aim: Sidedirected mutagenesis of TEV protease

Materials:

  • Fragments T1 and T2
  • different Primers
  • Phusion polymerase kit by NEB

Methode:

PCR

  • Template: 2µl mix of T1 and T2 in a molar ratio of 1:1
  • Nucleotides: 1 µL of 10 mM ready to use dNTP mix
  • 10 µL 5 x Phusion GC Buffer
  • 2,5 µL primers = 25 pmol absolute (2,5 µL of each primer, see list below)
  • 31,5 µL of pure water
  • 0,5 µL Phusion HF polymerase


Program:

  • Denat: 30 sec 98°C
  • 30x

Denat: 10 sec 98°C

Anneal+Extend: 35 sec 72°C

  • Final Extend: 5min 72°C


Used Primers:

  • f_TEV_AraFusion_NgoMIV
  • r_TEV_iGEM_BamHI

Further Tasks:

PCR purification, analytical Gel to check sizes of the amplified fragments, assembly PCR of Fragment

PCR Purification, analytical GE, Digest and Ligation of TEV protease

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul, Sebastian


Aim: Getting the TEV into its test vector

Materials:

  • mutated TEV protease
  • T4 Ligase, different Restriction Enzymes

Methode:

  • 5µl of the PCR product of mutated TEV protease were checked with anayltical GE on a 1% agarosegel
  • PCR products got cleaned up by use of the M&N kit for PCR purification
  • Mutated TEV and Vector SG6 containing the cleavage site for TEV protease and AraC were digested with different enzymes and cleaned up again.
    • TEV with PstI and NgoMIV
    • AraC with EcoRI and NgoMIV
    • SG6 with PstI and EcoRI
  • the concentration of the fragments were estimated with NanoDrop
  • Ligation of all Fragment with T4 Ligase by Fermentas (see manual of T$ ligase by Fermentas)
  • Ligation Batch is used for Transformation of XL1 blue
  • transformed cells were platted on agarplates containing cm

Further Tasks:

colony PCR, plasmid prep survival screening and sequencing

112th Labday 2011-10-19

Amplification of megaprimer I, using Phusion (Finnzymes)

Time: 2011-10-19

Investigators: Jessica, Nicole

Aim: Site-directed mutagenesis of pARW089 for use as biobrick, improved strategy was used

Material:

  • primers:
    • pf_muta_XbaI
    • pr_muta_XbaI
    • pr_ohne_muta
  • pARW089, 8.57 ng/ µl
  • Phusion HF Buffer (Finnzymes)
  • dNTPs (10 mM)


Methods:

Samples and used primers

A. pARW089 mutation: pf_muta_XbaI and pr_muta_XbaI

B. pARW089 without mutations: pf_muta_XbaI and pr_ohne_muta


PCR mixture

Volume in µl
dNTPs (10 mM) 1
Phusion HF Buffer 10
Primer forward, megaprimer (10 µM) 2.5
Primer reverse (10 µM) 2.5
DNA pARW089 (8.57 ng/ul) 1
Phusion polymerase 0.5
H2O 32.5


PCR conditions (Thermal cycler)

Time Temp.
Hold98°C
Initial denaturation 30 sec98°C
Denaturation 10 sec 98°C
Annealing 20 sec 58°C
Extension 20 sec 72°C
Number of cycles 30 x
Final extension 7 min 72°C


Output:

  • PCR products, A1, A2, A3 and B1, B2, B3


Further tasks:

  • Gel electrophoresis and purification
  • megaprimer PCR 2


Agarose gelelectrophoresis and purification of megaprimer I

Time: 2011-10-19

Investigators: Jessica, Nicole

Aim: Site-directed mutagenesis of pARW089 for use as biobrick, improved strategy was used

Material:

  • Agarose
  • 6x Loading dye
  • DNA Ladder (NEB)
  • Machery Nagel Nucleo Spin Extract II


Methods:

Purification of phages containing microviridin library

Investigators: Sandrina


Aim: phages carrying modified mdnA on their surface


Method/Materials:

  • after over night incubation:
  • centrifuge precipitaed phages: 5000 x g/ 45 min
  • discard supernatant
  • centrifuge again, 5000 x g/ 5 min
  • remove supernatant carefully
  • take pellet in 1 ml TBS
  • move in 1.5 ml Eppi
  • centrifuge again: 17000 x g/10 min
  • supernatant in a new Eppi with 200 µl PEG-NaCl (mix!)
  • incubate on ice for 60 min
  • centrifuge precipitated phages: 17.000 x g/ 10 min (4°C)
  • resuspend pellet in 300 µl TBS
  • centrifuge:17 000 x g/ 10 min (4°C)
  • supernatant in a fresh eppi= purified phages


Further tasks:

  • repeat procedure with ER2738 cells, because no phage pellet could be obserevd after precipitation
  • phage display


Colony PCR of TEV in vivo selcetion

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul, Sebastian


Aim: Getting the positiv clones for TEV in vivo selction

Materials:

  • XL1 clonies containing TorA-BlaFl construct with TEV cleavage site and TEV protease
  • Phusion Polymerase set
  • different primers

Methode:

PCR: 3min intial Dneaturation 98°C, 25 cycles: 10 sec denaturation 98°C, 35 sec annealing+elongation at 72°C. Final elongation for 5min at 72°C.

used primers:

  • f_TEV_iGEM
  • r_TEV_iGEM_BamHI

Colonies were picked with a 10µl tip, some bacterias were used for PCR reaction, the rest were used as pre culture of colnes. After Colony PCR and check via GE in 1% agarose gel positive clones were used for overnight cultures.

Output:

2 positive clones SG25 and SG26

Further Tasks:

plasmid prep, survival screening and sequencing

Making TEV and HRV14_3C Biobricks

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul, Stefan


Aim: Getting the positiv clones for TEV in vivo selction

Materials:

  • Phusion Polymerase set
  • different primers
  • different restriction enzymes
  • pSB1C3 vector

Methode:

PCR: 3min intial Dneaturation 98°C, 25 cycles: 10 sec denaturation 98°C, 35 sec annealing+elongation at 72°C. Final elongation for 5min at 72°C.

used primers for TEV:

  • f_TEV_iGEM
  • r_TEV_iGEM_BamHI

used primers for HRV14_3C:

  • f_HRV14_3C_iGEM
  • r_HRV14_3C_iGEM_BamHI

Mutated TEV and HRV14_3C were amplified out of vector containing mutated proteased (SG25 for TEV, SG24 for HRV14_3C), cleaned up with PCR purification kit form M&N, digested with EcoRI-HF, PstI-HF. Also pSB1C3 vector was digested with EcoRI and PstI. Both, proteases and vector were cleaned up via GE on 1% agarose gel followed by PCR clean up with M&N kit. The different proteases were ligated with pSB1C3 using T4 ligase purchased by Fermentas and the ligation products were transformed into XL1 blue cells using standard heat shock protocol.

Further Tasks:

plasmid prep and sequencing

113th Labday 2011-10-20

ELISA with purified phages carrying unmodified mdnA on their surface

Investigators: Sabine, Sandrina


Time: 2011-09-16, 12:00-21:00

Aim: recontrol if mdnA-myc-geneIII will be expressed on the phage


Method/Materials:

  • ELISA plate coated with 5 µg/ml anti-c-myc antibody in phosohate buffer (pH 7,4), volume 100 µl/ well
  • incubate for 4 h at room temperature
  • blocking in 2 % milk powder in TBS (300 µl/ well)
  • incubate for 2 h at room temperature
  • add 100 µl phages, produced in XL1-blu cells diluted 1:1 in TBS-T (0,005%)
  • incubate shaking for 60 min at room temperature
  • wash 5 x with TBS-T (0,05%)
  • add anti-gene-8-antibody (HRP coupled)
  • incubate shaking for 60 min
  • wash 5 x with TBS-T
  • put substrate on the samples
  • measure in plate photometer
  • reference: helper phages


Resluts: positive signal at wells with mdnA phages


SDS- PAGE with purified phages carrying mdnA on their surface

Investigators: Sabine, Sandrina


Aim: preparing geneIII-myc-mdnA-protein for western blot


Method/Materials:

  • seperating gel:
  • acryl amide: 2,5 ml
  • seperating gel buffer 4x: 1,5 ml
  • water: 1,94
  • APS: 60 µl


  • stacking gel:
  • acryl amide: 0,28 ml
  • stacking gel buffer: 0,5 ml
  • water: 1,22 ml
  • APS: 10 µl


  • loading dye: RotiLoad1
  • incubate samples at 95°C for 20 min
  • run at 50 V for half an hour, then switch to 20 mA


Further tasks:

  • western blot

Western Blot

Investigators: Sabine, Sandrina


Aim: control if geneIII-mdnA is expressed on the phages produced in XL1-blue cells


Method/Materials:

  • membrane impregnated in methanol
  • whatman paper
  • blotting buffer
  • blotting chamber
  • 1 h at 200 mA
  • blocking over night in TBS with 5% milk powder


Further tasks:

  • antibody detection

Colony PCR,Mini-prep and Survival screening

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul, Sebastian


Aim: Getting the TEV into its test vector

Materials:

  • clones containing TEV and TorA-bla construct with TEV protease
  • colonies of TEV and HRV14_3C protease
  • Phusion polymerase Kit
  • different agar plates

Methode:

standard colony PCR protocol were used for TEV and HRV14_3C with same used for ampilication, followed by analytical GE with 1% agarose gel. all positiv clones were used for over night culture for plasmid prep.

The two positive clones SG25 and SG26 were grown over night in LB media, diluted next day and grown again to an OD of 0.3 to get them into exponential growth phase and diluted again to an OD of 0.002. 100µl of the dilution of each clone gots plated on 2 of each different set of agar plates (see below).

used Plates:

  • 4x Cm (25 µg/ml)
  • 4x Cm + 1mM IPTG
  • 4x Cm + 2% Ara
  • 4x Cm + 2% Ara +1mM IPTG
  • 4x Cm + Amp (100 µg/ml)
  • 4x Cm + 1mM ITPG + Amp (25 µg/ml)
  • 4x Cm + 1mM ITPG + Amp (50 µg/ml)
  • 4x Cm + 1mM ITPG + Amp (75 µg/ml)
  • 4x Cm + 1mM ITPG + Amp (100 µg/ml)
  • 4x Cm + 1mM ITPG + Amp (150 µg/ml)
  • 4x Cm + 1mM ITPG + Amp (200 µg/ml)
  • 4x Cm + 1mM ITPG + Amp (300 µg/ml)
  • 4x Cm + 1mM ITPG + Amp (400 µg/ml)
  • 4x Cm + 1mM ITPG + Amp (600 µg/ml)
  • 4x Cm + 1mM ITPG + Amp (800 µg/ml)
  • 4x Cm + 2% Ara + 1mM IPTG + Amp (25 µg/ml)
  • 4x Cm + 2% Ara + 1mM IPTG + Amp (50 µg/ml)
  • 4x Cm + 2% Ara + 1mM IPTG + Amp (75 µg/ml)
  • 4x Cm + 2% Ara + 1mM IPTG + Amp (100 µg/ml)
  • 4x Cm + 2% Ara + 1mM IPTG + Amp (150 µg/ml)
  • 4x Cm + 2% Ara + 1mM IPTG + Amp (200 µg/ml)
  • 4x Cm + 2% Ara + 1mM IPTG + Amp (300 µg/ml)
  • 4x Cm + 2% Ara + 1mM IPTG + Amp (400 µg/ml)
  • 4x Cm + 2% Ara + 1mM IPTG + Amp (600 µg/ml)
  • 4x Cm + 2% Ara + 1mM IPTG + Amp (800 µg/ml)


Each clone was incubated at 30 and 37°C.

Further Tasks:

See results of in vivo selection system, plasmid prep of TEV and HRV14_3C Biobricks and sequencing.

Amplification of megaprimer II, using Phusion (Finnzymes)

Time: 2011-10-20

Investigators: Jessica, Nicole

Aim: Site-directed mutagenesis of pARW089 for use as biobrick, improved strategy was used

Material:

  • primers:
a) Megaprimer A and r_mdn_iGEM
b) Megaprimer B and r_mdn_iGEM
  • pARW089, 8.57 ng/ µl
  • Phusion HF Buffer (Finnzymes)
  • dNTPs (10 mM)


Methods:


PCR mixture

volume in µl
dNTPs (10 mM) 1
Phusion HF Buffer 10
Primer reverse r_mdnABCDE_iGEM (10 µM) 2.5
DNA pARW089 (8.57 ng/ul) 1
Phusion polymerase 0.5

varied volume of megaprimer I

A1a (0.2 µM) A1b (0.5 µM) B1a (0.2 µM)B1a (0.2 µM)A2a (0.2 µM)A2b (0.5 µM)B2a (0.2 µM)B2b (0.5 µM)
Primer forward, Megaprimer I 11.629.09.022.07.2187.418.5
H2O 23.46.026.013.027.81727.616.5


PCR conditions (Thermal cycler)

Time Temp.
Hold98°C
Initial denaturation 30 sec98°C
Denaturation 30 sec 98°C
Annealing 20 sec 72°C
Extension 20 sec 72°C
Number of cycles 30 x
Final extension 7 min 72°C


  • Gelelectrophoresis and Purification

Output:

  • megaprimer A2 and B2


Further tasks:

  • amplification of whole cluster


Amplification of mdn-cluster

Time: 2011-10-20

Investigators: Jessica, Nicole

Aim: Site-directed mutagenesis of pARW089 for use as biobrick, improved strategy was used

Material:

  • primers:
a) Megaprimer A2 and Pf_mdnABCDET7
b) Megaprimer B2 and Pf_mdnABCDET7
  • pARW089, 8.57 ng/ µl
  • Long Enzyme Mix (Fermentas)
  • dNTPs (10 mM)


Methods:


PCR mixture

volume in µl
dNTPs (10 mM) 1
Long enzyme mix (Fermentas) Buffer 5
Primer forward Pf_mdnABCDET7 (10 µM) 1
DNA pARW089 (8.57 ng/ul) 1.2
Long PCR Polymerase 0.3

varied volume of megaprimer II

50 pmol 125 ng 250 ng
Primer forward, Megaprimer II 250.51.0
H2O 16.54140.5


PCR conditions (Thermal cycler)

Time Temp.
Hold98°C
Initial denaturation 3 min94°C
Denaturation 20 sec 94°C
Annealing 30 sec 68°C
Extension 7 min 68°C
Number of cycles 7 x
Denaturation 20 sec 94°C
Annealing 30 sec 68°C
Extension 7 min + 3s/cycle 68°C
Number of cycles 10 x
Final extension 7 min 68°C
  • Gelelectrophoresis and Purification

Output:

  • mdn-cluster A and B


Further tasks:

  • Digest and ligation with pSB1C3


114th Labday 2011-10-21

Antibody detection with blotted membranes

Investigators: Sandrina, Sabine


Aim: control if geneIII-myc-mdnA is presented on the phages


Method/Materials:

  • incubate blocked membrane for 1 h with primary antibody (anti -c-myc- antibody) in TBS with 5% milk powder
  • wash 3x 10 min with TBS buffer
  • incubate for 1 h with secondary antibody
  • wash 3x 10 min with TBS buffer
  • develop membranes with ECL- Kit


Results:

  • signals were seen at positive controls and a very weak signal at mdnA-myc-geneIII lane

Further tasks:

Results of Survival screening at 37°C and mini prep of TEV and HRV14_3C BioBricks

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul, Sebastian


Aim: Getting the TEV and HRV14_3C Biobrick, see if invivo selection at 37°C works

Materials:

  • plasmid prep Kit of M&N

Methode:

  • plasmids were isolated as described in the manual of the Kit
  • looking for clones on plates

Output

  • plasmids for sequencing P1,P2,P4,P7+T1,T2,T6
  • no results for in vivo selection

Further Tasks:

sequencing

Digest of mdn-cluster and pSB1C3 and ligation

Time: 2011-10-21

Investigators: Jessica, Nicole

Material:

  • EcoRI-HF, PstI-HF
  • pSB1C3 (#3)
  • PCR products: mdn-cluster A and B

Methods:

Digest pSB1C3

  • 4 µl NEB bufer 4
  • 15 µl pSB1C3 (250 ng/µl)
  • 2 µl EcoRI-HF
  • 2 µl PstI-HF
  • 17 µl water

Digest mdn-cluster

  • 5 µl NEB buffer 4
  • 33 µl PCR product
  • 2 µl EcoRI-HF
  • 2 µl PstI-HF
  • 8 µl water

Gel purification of pSB1C3

PCR purification of mdn-cluster

Ligation

  • 1 µl T4 ligase buffer
  • 1 µl T4 ligase
  • 1 µl pSB1C3
  • 7 µl mdn-cluster

Output:

  • ligations: pSB1C3+mdn-cluster A, pSB1C3+mdn-cluster B

Further tasks:

  • transformation


115th Labday 2011-10-22

Results of survival screening at 30°C

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul, Sebastian


Aim: see if in vivo selection could work

Materials:

none

Method:

counting colonies on plates

Results

For Both; Sg25 and SG26, cells survival up to 800 µg/ml ampicillin without active protease. Only for SG26 we were able to see cell death, if protease is activated, cells die early --> no clones on plates with 50µg/ml ampicillin.

over night culture of SG26 carrying XL1 blue cells.

Further Tasks:

making comptent cell out of SG26


Transformation with pSB1C3+mdn-cluster

Investigators: Jessica

Time: 2011-10-22

Method:

  • addition of 4 µl ligation reaction to XL1-blue cells
  • incubation 25 min on ice,
  • heat shock 45 sec at 42°C,
  • incubation 2 min on ice,
  • addition of 750 µl LB medium,
  • incubation 60 min at 37 °C and 750 rpm
  • plating on agar plates containing 100 µg/ml tetracyclin and 100 µg/µl ampicillin
  • storage over night at 37°C


116th Labday 2011-10-23

making competent cells and tranformation with Libary of SG26 carrying cells

Investigators: Stefan, Paul, Sascha


Aim: transformig XL1 blue cells SG26 with mdnA libary,


Methode:

Standard protocol for chemical competent cells followed by standard heat shock protocol for transformation. Transformed cells were plated on 10 agar plates containing cm and kan as antibiotics.


Results:

Libary transformed into cells with the TEV in vivo selection system.


further Tasks:

Test cells for surviving at higher ampicillin concentration than 25 µg/ml.

Production of phages containing microviridin library on their surface in ER2738 cells

Investigators:Sandrina, Sabine


Aim: production of phages carrying modified mdnA on their surfac for screening by phage display


Method/Materials:

  • first step: amplification of cells containing mutated mdnA:
  • 500 ml LB medium will be inoculated with the cells, so that OD600 = 0.1
  • add antibiotics tetracyclin and ampicillin to the medium
  • cells should be incubated 37 °C till OD 600 = 0.3-0.5 (here: 0.356) is reached
  • second step: infection with helper phages
  • add helper phages 10^11 phages/50 ml (3,5 µl)
  • incubate for 10 min at 37°C (without shaking!)
  • add 0,5 mM IPTG
  • incubate 50 min at 28°C and rpm
  • add 70 µg/ml kanamycin and incubate for 5 h at 28°C (...)
  • third step: phage purification
  • centrifuge cell culture at 5000 x g/ 15 min
  • fill supernatant in a new 50 ml falcon and centrifuge again (5000 g/15 min)
  • 40 ml of the supernatant with 8 ml PEG-NaCl (20% (w/v) PEG-8000, 2,5 M NaCl)
  • incubate over night at 4°C


Further tasks:

  • go on with phage purification

117th Labday 2011-10-24

Testing mdnA libary with SG26 carrying cells for TEV in vivo selection

Investigators: Stefan, Paul, Sascha


Aim: see if there is any mdnA which leads to cell survival


Methode:

library was harvest from agar plates, put into a preculture containing cm and kan and grown for 3 h at 37°C, deluted to an OD of 0.02 and plated on different agar plates.

  • 1x Cm (25 µg/ml)
  • 1x Cm + 1mM IPTG
  • 1x Cm + 2% Ara
  • 1x Cm + 2% Ara +1mM IPTG
  • 1x Cm + Amp (100 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (20 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (30 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (40 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (50 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (100 µg/ml)
  • 1x Cm + 1mM ITPG + Amp (400 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (20 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (30 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (40 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (50 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (100 µg/ml)
  • 1x Cm + 2% Ara + 1mM IPTG + Amp (400 µg/ml)

all plates were incubated at 30°c for two days


Results:

Libary transformed into cells with the TEV in vivo selection system.


further Tasks:

Test cells for surviving at higher ampicillin concentration than 25 µg/ml.

Purification of phages containing microviridin library

Investigators: Sandrina, Sabine


Aim: phages carrying modified mdnA on their surface


Method/Materials:

  • after over night incubation:
  • centrifuge precipitaed phages: 5000 x g/ 45 min
  • discard supernatant
  • centrifuge again, 5000 x g/ 5 min
  • remove supernatant carefully
  • take pellet in 1 ml TBS
  • move in 1.5 ml Eppi
  • centrifuge again: 17000 x g/10 min
  • supernatant in a new Eppi with 200 µl PEG-NaCl (mix!)
  • incubate on ice for 60 min
  • centrifuge precipitated phages: 17.000 x g/ 10 min (4°C)
  • resuspend pellet in 300 µl TBS
  • centrifuge:17 000 x g/ 10 min (4°C)
  • supernatant in a fresh eppi= purified phages

118th Labday 2011-10-25

Control of sequencing results of sequenced clones from created library for phage display

Investigators: Sandrina, Jessica


Aim:check if mdnA library, which could be screened by phage display was produced


Results:

  • all clones contained the wildtype mdnA-myc-geneIII-gene


Further tasks:

  • repetition of cloning the mdnA library

Colony PCR of pSB1C3+mdn-cluster

Investigators: Jessica

Time: 2011-10-25

Method:

PCR mixture

volume in µl
dNTPs (10 mM) 1
Buffer 4
Primer reverse (10 µM)1
Primer forward (10 µM)1
DNA pARW089 (8.57 ng/ul) 1
polymerase 0.2
water7.8

Gel electrophoresis

Overnight culture of pSB1C3+mdn-cluster A clone 6

Further tasks:

  • miniprep and sequencing

119th Labday 2011-10-26

Phage Display with wildtype mdnA and different proteases

Investigator: Sandrina, Sabine, Jessica


Time: 2011-09-14, 9:00-22:00


Aim:check if unmodified mdnA on the surface of the phages binds to an immobilized protease. interactions of microviridin L with the proteases trypsin, chymotrypsin and elastase were already detected


Material/Method:

  • in ELISA plate:
  • coat wells with proteases trypsin, elastase, chymotrypsin, papain, proteinase K, pepsin and mycolysin in 0,2 M PBS with ph 5.0 , for 2 h
  • blocking in TBS with 3% BSA for 2 h
  • wash 6x with TBS-T (0,005%)
  • panning with phages 1:1 helper phages and phages of interest (presenting mdnA-geneIII fusion protein on their surface, 1 h)
  • wash 6x with TBS-T
  • elute bound phages with 0,2 M Glycin-HCl, 10 min
  • neutralize with 1 M Tris (pH 7-8)
  • mix eluted phages with preparatory culture of ER2738 cells
  • incubate 10 min at 37°C without shaking
  • incubate 50 min at 37°C shaking
  • plate on amp plates and on kan plates


Further tasks:

check cell growing

Digest of pARWIII and ligation with library

Time: 2011-10-26

Investigators: Sandrina, Jessica, Sabine

Material:

Method:

Digest of pARWIII

Gel electrophoresis

Gel purification

Digest of geneIII

Purification

Ligation

  • 2 µl T4 ligase buffer
  • 1 µl T4 ligase
  • 6 µl pARW089
  • 10 µl geneIII
  • 1 µl mdnA library

Output:

  • 3 ligation products stored @ -20°C

Further task:

  • transformation of one ligation product and control

Transformation of triple ligated mdnA library, gene III and pARWIII

Time: 2011-10-26, 19:45-22:00

Investigators: Sandrina, Jessica, Sabine, Nadja

Aim:Phage display with created mdnA library

Materials:

  • XL1-Blue chemocompetent cells
  • ligation product, named geneIII mdnA lib pARWIII, 2011-10-11
  • transformation control, named H2O, 2011-10-11


  • add 2 µl PCR product to competent cells (for ligation product 5 samples overall)
  • incubate 25 min one ice
  • heat pulse: 45 sec at 42°C
  • 2 min on ice
  • add 750 µl LB medium to each sample
  • incubate 45 min at 37°C and 850rpm
  • cenrifugation and resuspend in 200 µl LB medium
  • plate 200 µl on plates with ampicillin
  • incubate the transformation plates at 37°C for approx. 16 hours



Further tasks:

  • preparation of overnight cultures of several clones
  • Miniprep

Miniprep of pSB1C3+mdn-cluster A clone 6 and sending for sequencing

Time: 2011-10-26

Investigators: Sandrina, Jessica, Sabine, Nadja

Materials/Method:

  • NucleoSpin® Plasmid (NoLid) (Macherey-Nagel)
  • Protocol for high-copy plasmids
  • elution with 50 µl H2O


Results: (from 2011-10-28)

  • only part of the cluster could be found in pSB1C3

SDS- PAGE with lysated cells which produced the mdnA-myc-geneIII protein

Investigators: Sabine, Sandrina


Aim: preparing the cells which expressed geneIII-myc-mdnA-protein for detecting the expression of this protein by western blot


Method/Materials:

  • seperating gel:
  • acryl amide: 2,5 ml
  • seperating gel buffer 4x: 1,5 ml
  • water: 1,94
  • APS: 60 µl


  • stacking gel:
  • acryl amide: 0,28 ml
  • stacking gel buffer: 0,5 ml
  • water: 1,22 ml
  • APS: 10 µl


  • loading dye: RotiLoad1
  • incubate samples at 95°C for 20 min
  • run at 50 V for half an hour, then switch to 20 mA


Further tasks:

  • western blot

Western Blot

Investigators: Sabine, Sandrina


Aim: control if geneIII-mdnA is expressed ER2738 cells


Method/Materials:

  • membrane impregnated in methanol
  • whatman paper
  • blotting buffer
  • blotting chamber
  • 1 h at 200 mA
  • blocking over night in TBS with 5% milk powder


Further tasks:

  • antibody detection

120th Labday 2011-10-27

Antibody detection with blotted membranes

Investigators: Sandrina, Sabine


Aim: control if geneIII-myc-mdnA is expressed in the cells


Method/Materials:

  • incubate blocked membrane for 1 h with primary antibody (anti -c-myc- antibody) in TBS with 5% milk powder
  • wash 3x 10 min with TBS buffer
  • incubate for 1 h with secondary antibody
  • wash 3x 10 min with TBS buffer
  • develop membranes with ECL- Kit


Results:

  • signals were seen at lanes loaded with cell lysate --> it can be concluded that mdnA-myc-gneeIII protein is expressed in the cells

control of performed phage display

Investigators: Sandrina, Sabine


Aim: control if phage display in general is possible with mdnA-myc-geneIII


Method/Materials:

  • count growed clones


Results:

  • phages carriying mdnA on their surface could be enriched, when chymotrypsin and elastase acted as targets
Retrieved from "http://2011.igem.org/Team:Potsdam_Bioware/Labjournal/October"