Revision as of 01:51, 5 October 2011 by Sprkata (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Contents 1 HokkaidoU Japan 1.1 Infection assay 1.1.1 Preparation of T3SS E. coli 1.1.2 Infection assay using onion cells 1.1.3 Infection assay using HeLa cells 1.1.4 Detection of injected protein using GSK tag 2 Primers 2.1 Note 2.2 General Primers 2.3 Primers Used for Backbone Construction 2.4 Sequencing Primer

Infection assay

Preparation of T3SS E. coli

Infection assay using onion cells

Infection assay using HeLa cells

Detection of injected protein using GSK tag

Protein extraction from infected HeLa cells

SDS-PAGE and Western Blot analysis

HeLa cell lysates were subjected to SDS-PAGE, and separated proteins were transferred to an Immobilon-P membranes (Millipore). The membranes were blocked with Blocking buffer (20 mM Tris, 150 mM NaCl, 0.05% Tween 20, 5% nonfat milk) for 1 h at room temperature. The blots were probed with Phospho-GSK-3β (Ser9) antibody (Cell Signaling Technology #9336) or GSK-3β antibody (Cell Signaling Technology #9315) diluted 1/1000 in Blocking buffer and incubated overnight at room temperature. Blots were washed three times with TTBS (20 mM Tris, 150 mM NaCl, 0.05% Tween 20) for 15 min each time. Secondary antibody (alkaline phosphatase-conjugated anti-rabbit immunoglobulin G) was diluted 1/1000 in Blocking buffer and incubated with the blots for 1.5 h at 37C. Blots were washed as described above and developed with BCIP/NBT.

Primers

Note

Primer Name	Whole Sequence
	F/R	Annealing Sequence	Tm	Adding Sequence

General Primers

EX_F	gcagaattcgcggccgcttctagag
	Forward	Biobrick Prefix	74.5 C	None
PS_R	agcctgcagcggccgctactagta
	Reverse	Biobrick Suffix	74.6 C	None
suffix_F	tactagtagcggccgctgcaggct
	Forward	Biobrick Suffix	74.6 C	None
prefix_R	ctctagaagcggccgcgaattctgc
	Reverse	Biobrick Prefix	74.5 C	None
100up_EX_F	aacctataaaaataccgcatacac
	Forward	100bp upstream from Biobrick prefix	62.7 C	None
200dn_PS_R	tcccctgattctgtggataaccgt
	Reverse	200bp downstream from Biobrick suffix	66.6 C	None

• [http://partsregistry.org/wiki/index.php?title=Part:BBa_K496000 See details of 100up_EX_F/200dn_PS_R] (partsregistry)

Primers Used for Backbone Construction

EX_RBS_SlrP_F	GCAGAATTCGCGGCCGCTTCTAGAaaagaggagaaaatatgtttaatattactaatatacaatctacggc
	Forward	RBS sequence, 5' terminal of SlrP coding sequence	69.7 C	Biobrick Prefix
PS_SlrP_R	AGCCTGCAGCGGCCGCTACTAGTggtaagtcctaatattttcagacgaag
	Reverse	3'terminal of SlrP coding sequence	64.5 C	Biofusion Suffix
Bsa1_dt_F	GGCGACTAGAGAGACCccaggcatcaaataaaacgaaag
	Forward	5'terminal of double terminator sequence	63.6 C	BsaI recognition site and its cleavage site
Bsa1_SlrP_R	GGCCTGGCCTGAGACCCCggtaagtcctaatattttcagacga
	Reverse	3'terminal of SlrP coding Sequence	63.0 C	BsaI recognition site and its cleavage site
Bsa1_GSK_SlrP_R	GGCCTGGCCTGAGACCCCACTTTCAGCGAAACTTGTAGTGCGAGGGCGACCACTCATggtaagtcctaatattttcagacga
	Reverse	3'terminal of SlrP coding Sequence	63.6 C	GSK Tag, BsaI recognition site and its cleavage site

• See details of BsaI Backbone (Project Page)

Sequencing Primer

SlrP_373_to_394_F	gaaagtcagtcacctatacccg
	Forward	SlrP coding sequence, from 373bp to 394 bp	63.4 C	None