Revision as of 07:14, 3 October 2011 by TaKeZo (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Contents 1 HokkaidoU Japan 2 Experimental Procedures 2.1 General Protocols 2.1.1 Preparation of Competent cells (E. coli DH5a) 2.1.2 Bacterial Transformations 2.1.3 Mini-prep (Alkaline SDS Method) 2.1.4 PCR 2.1.5 Electroporation 2.1.6 PCIAA and CIAA extraction 2.1.7 Ethanol presipitation 2.1.8 Mini-prep (QIAprep Spin Miniprep Kit) 2.1.9 Gel Extraction (Wizard® SV Gel and PCR Clean-Up System) 2.2 Infection assay 2.2.1 Preparation of T3SS E. coli 2.2.2 Infection assay using onion cells 2.2.3 Infection assay using HeLa cells 2.2.4 Detection of injected protein using GSK tag 3 Notebook 3.1 Week 1: Jul. 31th - Aug. 6th 3.2 Week 2: Aug. 7th - Aug. 13th 3.3 Week 3: Aug. 14th - Aug. 20th 3.4 Week 4: Aug. 21th - Aug. 27th 3.5 Week 5: Aug. 28th - Sep. 3rd 3.6 Week 6: Sep. 4th - Sep. 10th 3.7 Week 7: Sep. 11th - Sep. 17th 3.8 Week 8: Sep. 18th - Sep. 24th 3.9 Week 9: Sep. 25th - Oct. 1st 4 Primers 4.1 Note 4.2 General Primers 4.3 Primers Used for Backbone Construction 4.4 Sequencing Primer

Experimental Procedures

General Protocols

Preparation of Competent cells (E. coli DH5a)

Reagents

TB (Transformation Buffer)(at 4C, filtration)

reagents	amount	Final concentration
1 M CaCl2 (at RT, autoclaved)	0.75 mL	15 mM
4 M KCl (at RT, autoclaved)	3.125 mL	250 mM
1 M MnCl2 (at 4C, autoclaved)	2.75 mL	55 mM
1 M PIPES (pH 6.7 by NaOH, at 4C, filtration)	0.5 mL	10 mM
Total	50 mL

Procedure

1. Single colony isolation on LB plate
2. Incubate the plate for 15-19 hrs at 37C
3. Lift a colony into 2 mL of LB
4. Culture cells at 37C for 12-16 hrs at 180-200 rpm
5. Transfer 30 uL, 100 uL, 300 uL of the culture into 100 mL SOB medium, respectively
6. Culture cells at 20C (for 24 hrs over) at 180-200 rpm (to ΔOD_550nm = 0.5~0.6)
7. Leave the 300 mL flask for 10 min on ice
8. Transfer the culture into two 50 mL Falcon tube
9. Centrifuge 7500 rpm at 4C for 20 min (TOMY TA-22 rotor), and discard sup
10. Suspend the pellet in ice-cold 15 mL of TB (Transformation Buffer)(7.5 mL/tube)
11. Centrifuge 7500 rpm at 4C for 2 min (TOMY TA-22 rotor), and discard sup
12. Suspend the pellet in ice-cold 3.2 mL of TB
13. Add 0.24 mL of DMSO (stirring, bit by bit)
14. Leave the 50 mL Falcon tube for 10 min on ice
15. Dispense 50 uL into 0.5 mL tube
16. Freeze the suspension in liquid nitrogen
17. Store at -80C

Bacterial Transformations

1. Add DNA solution to thawed competent cells
2. Incubate the cells on ice for 30 min
3. Heat shock the cells by immersion in a pre-heated water bath at 42C for 60 sec
4. Incubate the cells on ice for 5 min
5. Add 200 uL of SOB broth
6. Incubate the cells at 37C for 2 hrs while the tubes are shaking
7. Plate 200 uL of the transformation onto the dish
8. Incubate the plate at 37C for 12-14 hrs

Mini-prep (Alkaline SDS Method)

Reagents Solution I (at RT, filtration 0.2 um, 50 mL)

reagents	amount	Final concentration
Glucose (at RT)	0.45 g	50 mM
1 M Tris-HCl (pH8.0, at RT, autoclaved)	1.25 mL	25 mM
0.5 M EDTA (pH8.0, at RT, autoclaved)	1 mL	10 mM
Total	50 mL

Solution II (at RT, filtration 0.2 um, 20 mL)

reagents	amount	Final concentration
10 N NaOH (at RT)	0.4 mL	0.2 N
10% SDS (at RT, filtration)	2 mL	1%
Total	20 mL

Solution III (at RT, filtration 0.2 um, 50 mL)

reagents	amount	Final concentration
5 M CH3COOK	30 mL	3 M
CH3COOH	5.75 mL
H2O	14.25 mL
Total	50 mL

Procedure

1. Lift colony E. coli into 2 mL LB contained antibiotics
2. Culture cells at 37C for 16-20 hrs at 180-200 rpm
3. Transfer 1.2-1.5 mL of culture into 1.5 mL tube
4. Centrifuge the culture at 15,000 rpm for 1 min at 4C and discard sup
5. Suspend the pellet in ice-cold 100 uL of Solution I
6. Add 200 uL of Solution II to the suspension
7. Mix by inverting the tube 10-20 times
8. Add ice-cold 150 uL of Solution III to the suspension
9. Mix by inverting the tube 10-20 times
10. Leave the tube for 5 min on ice
11. Add 10 uL of Chloroform
12. Mix by inverting the tube 5-10 times
13. Centrifuge the suspension at 15,000 rpm for 5 min at 4C
14. Transfer the supernatant into new 1.5 mL tube↓
15. Add equal volume of isopropanol and mix by voltexing
16. Leave the tube for 5 min at RT
17. Centrifuge the suspension at 15,000 rpm for 10 min at 4C and discard sup
18. Rinse the ppt by 70% EtOH and mix by voltexing
19. Centrifuge the suspension at 15,000 rpm for 2 min at 4C and discard sup
20. Dry up the ppt
21. Dissolve the ppt in 50 uL of TE (pH 8.0)
22. Add 1 uL of 10 mg/mL RNase A (4C and stock at –20C)
23. Incubate for 30 min at 37C
24. PCIAA and CIAA extraction
25. Ethanol precipitation
26. Dry up the ppt
27. Dissolve the ppt in 50 uL of TE (pH 8.0)

PCR

Vector Standard reaction setup

Component	Volume
10x PCR Buffer	5 uL
2mM dNTPs	5 uL
25mM MgSO4	3 uL
Suffix-F primer	1 uL
Prefix-R primer	1 uL
Template DNA	1 uL
KOD -Plus- Neo	1 uL
DW	X uL
Total	50 uL

Cycling conditions (2-step cycle)

Stage	Temperature and Time
Predenature	94C 2 min
Denature	98C 10 sec
Extension	68C X sec (30 sec/kb)
Hold	4C

• 30-40 cycles

Insert Standard reaction setup

Component	Volume
10x PCR Buffer	5 uL
2mM dNTPs	5 uL
25mM MgSO4	3 uL
EX-F primer	1 uL
PS-R primer	1 uL
Template DNA	1 uL
KOD -Plus- Neo	1 uL
DW	X uL
Total	50 uL

Cycling conditions (2-step cycle)

Stage	Temperature and Time
Predenature	94C 2 min
Denature	98C 10 sec
Extension	68C X sec (30 sec/kb)
Hold	4C

• 30-40 cycles

Colony PCR

• resuspend a colony into 10 uL of DW (template suspension)

Standard reaction setup

Component	Volume
template suspension	4.8 uL
Quick Taq	5 uL
Forward primer	0.1 uL
Reverse primer	0.1 uL
Total	10 uL

Cycling conditions (2-step cycle)

Stage	Temperature and Time
Predenature	94C 2 min
Denature	94C 10 sec
Extension	68C X sec (60 sec/kb)
Hold	4C

• 30-40 cycles

Electroporation

Preparation of electro-competent cells

1. Cell culture in 400 mL of SOB or LB and grow to ΔOD₆₀₀ = 0.5~0.6
2. Dispense the medium into 8 Falcon 50 mL tube
3. Centrifuge at 3500 rpm for 5 min at 4C and discard sup
4. Add 5 mL of DW and suspend the ppt, mix 8 suspensions into single Falcon tube
5. Centrifuge at 3500 rpm for 5 min at 4C and discard sup
6. Add 40 mL of DW and suspend the ppt
7. Centrifuge at 3500 rpm for 5 min at 4C and discard sup
8. Add 10 mL of 10% Glycerol and suspend the ppt
9. Centrifuge at 3500 rpm for 5 min at 4C and discard sup
10. Add 10 mL of 10% Glycerol and suspend the ppt
11. Centrifuge at 3500 rpm for 5 min at 4C and discard sup
12. Add 5 mL of 10% Glycerol and suspend the ppt
13. Dispense 100 uL of the suspensions into 0.5 mL Eppendorf tube, respectively
14. Store at -80C freezer

Electroporation

PCIAA and CIAA extraction

Reagent

• PCIAA = Phenol : CIAA = 1 : 1
• CIAA = Chloroform : IsoAmyl Alcohol = 24 : 1

Procedure

1. Add equal volume of PCIAA and vortex vigorously
2. Centrifuge at 15,000 rpm for 2 min at RT
3. Transfer the aqueous phase to a new tube, being careful not to transfer the phase interface
4. Add equal volume of CIAA and vortex vigorously
5. Transfer the aqueous phase to a new tube
6. Ethanol precipitation

Ethanol presipitation

1. Add 1/10 volume of 3M CH₃COONa
2. Add 2.5 volume of 100% ethanol (EtOH)
3. Incubate on ice for few min
4. Centrifuge at 15,000 rpm for 10 min at 4C and discard sup
5. Wash precipitation with 100 uL of 70% EtOH (EtOH has to be cold)
6. Centrifuge at 15,000 rpm for 5 min at 4C and discard sup
7. Dry up the ppt (no EtOH should be left)
8. Resuspend ppt in wanted volume of TE

Mini-prep (QIAprep Spin Miniprep Kit)

1. Resuspend pelleted bacterial cells in 250 µl Buffer P1 and transfer to a micro-centrifuge tube
2. Add 250 µl Buffer P2 and mix thoroughly by inverting the tube 4–6 times
3. Add 350 µl Buffer N3 and mix immediately and thoroughly by inverting the tube 4–6 times
4. Centrifuge for 10 min at 13,000 rpm (~17,900 x g) in a table-top microcentrifuge
5. Apply the supernatants from step 4 to the QIAprep spin column by decanting or pipetting
6. Centrifuge for 30–60 s. Discard the flow-through
7. Recommended: Wash the QIAprep spin column by adding 0.5 ml Buffer PB and centrifuging for 30–60 s. Discard the flow-through
8. Wash QIAprep spin column by adding 0.75 ml Buffer PE and centrifuging for 30–60 s
9. Discard the flow-through, and centrifuge for an additional 1 min to remove residual wash buffer
10. Place the QIAprep column in a clean 1.5 ml microcentrifuge tube. To elute DNA, add 50 µl Buffer EB (10 mM Tris·Cl, pH 8.5) or water to the center of each QIAprep spin column, let stand for 1 min, and centrifuge for 1 min

• [http://www.qiagen.com/products/plasmid/qiaprepminiprepsystem/qiaprepspinminiprepkit.aspx see details (Official website)]

Gel Extraction (Wizard® SV Gel and PCR Clean-Up System)

1. Following electrophoresis, excise DNA band from gel and place gel slice in a 1.5 mL microcentrifuge tube
2. Add 10 uL Membrane Binding Solution per 10 mg of gel slice
3. Vortex and incubate at 50–65C until gel slice is completely dissolved
4. Insert SV Minicolumn into Collection Tube
5. Transfer dissolved gel mixture or prepared PCR product to the Minicolumn assembly
6. Incubate at room temperature for 1 min
7. Centrifuge at 16,000 g for 1 min
8. Discard flowthrough and reinsert Minicolumn into Collection Tube
9. Add 700 uL Membrane Wash Solution (ethanol added)
10. Centrifuge at 16,000 g for 1 min
11. Discard flowthrough and reinsert Minicolumn into Collection Tube
12. Repeat Step 4 with 500 uL Membrane Wash Solution
13. Centrifuge at 16,000 g for 5 min
14. Empty the Collection Tube and recentrifuge the column assembly for 1 min with the microcentrifuge lid open (or off) to allow evaporation of any residual ethanol
15. Carefully transfer Minicolumn to a clean 1.5 mL microcentrifuge tube
16. Add 50 uL of Nuclease-Free Water to the Minicolumn
17. Incubate at room temperature for 1 min
18. Centrifuge at 16,000 g for 1 min
19. Discard Minicolumn and store DNA at 4C or –20C

• [http://www.promega.com/applications/pcr/featuresandbenefits/Wizard_SV_Gel_PCR_Clean-Up_System.htm see details (Official website)]

Infection assay

Preparation of T3SS E. coli

Infection assay using onion cells

Infection assay using HeLa cells

Detection of injected protein using GSK tag

Protein extraction from infected HeLa cells

SDS-PAGE and Western Blot analysis

HeLa cell lysates were subjected to SDS-PAGE, and separated proteins were transferred to an Immobilon-P membranes (Millipore). The membranes were blocked with Blocking buffer (20 mM Tris, 150 mM NaCl, 0.05% Tween 20, 5% nonfat milk) for 1 h at room temperature. The blots were probed with Phospho-GSK-3β (Ser9) antibody (Cell Signaling Technology #9336) or GSK-3β antibody (Cell Signaling Technology #9315) diluted 1/1000 in Blocking buffer and incubated overnight at room temperature. Blots were washed three times with TTBS (20 mM Tris, 150 mM NaCl, 0.05% Tween 20) for 15 min each time. Secondary antibody (alkaline phosphatase-conjugated anti-rabbit immunoglobulin G) was diluted 1/1000 in Blocking buffer and incubated with the blots for 1.5 h at 37C. Blots were washed as described above and developed with BCIP/NBT.

Notebook

Week 1: Jul. 31th - Aug. 6th

No experiments were conducted.

We were planning the project of this year.

Week 2: Aug. 7th - Aug. 13th

• Sunday
  • Transformation of BBa_R0040(2011 distribution 1-6I)
• Monday
  • Cultivation of E.coli which has the complex we made last year for the next day's mini-prep.
  • Cultivation of E.coli which has been transformed yesterday for the next day's mini-prep.
• Tuesday
  • Replacing Arabinose promoter (BBa_I0500) of the complex by TetR promoter (BBa_R0040)
    • mini-prep:
    • PCR (EX_RBS_SlrP_F / PS_SlrP_R) → gel extraction. This Parts will be used as insert.
• Wednesday
  • Promoter replacing (continuation from yesterday)
    • digestion
      • Insert (RBS-SlrP-GFP-double terminator): XbaI, PstI
      • Vector (TetR promoter which is on pSB1A2 vector): SpeI, PstI
    • Gel extraction and Ethanol precipitation of digestion products.
    • Ligation and transformation(in DH5-alpha).
• Thursday
  • Promoter replacing (continuation from Tuesday)
    • Result of yesterday's transformation: FAILIRE because of over cultivation.
  • Re-try
    • Insert PCR and Gel extraction.
    • Digestion, Gel extraction, and Ethanol precipitation.
    • Ligation, Transformation, and Cultivation.
• Friday
  • Promoter replacing (Re-try, continuation from yesterday)
    • Result of yesterday's transformation: FAILURE because of mistake of ligation
  • Promoter replacing (Re-Re-try)
    • Insert PCR and Gel extraction.
• Saturday
  • Promoter replacing (Re-Re-try, continuation from yesterday)
    • digestion, Gel extraction and Ethanol precipitation.
    • Ligation, transformation, and Cultivation.

Week 3: Aug. 14th - Aug. 20th

• Sunday
  • promoter Replacing (Re-Re-try)
    • Result: SUCCEED
    • Single colony isolation of the E.coli and cultivate it in LBA (liquid)
• Monday
  • Backbone Construction
    • We find irrelevant BsaI site in pSB1A2 Vector, so we decide that replace vector pSB1A2 to pSB1K3
    • mini-prep of cultivated E.coli
      • FAILURE: wrong protocol. DNA maight be shone
    • Single colony isolation (again)
  • Verification of Promoter Replacing - 1
    • idea: We use 2010 complex as substrate, and this is on pSB1T3 Vector. However, after replasing, the product is on pSB1A2 vector because TetR Promoter is on pSB1A2. So, cultivating the product in LBT, and then confirm that E.coli in LBT does not increase.
    • cultivating E.coli in LBT.
• Tuesday
  • Verification of Plomoter Replacing
    • result: SUCCEED. E.coli in LBT did not decidedly increase.
  • mini-prep of E.coli for backbone constructing
    • FAILURE: Cultivating E.coli in LB. We can't know what other kinds of Bacteria are in the medium.
  • Verification of Plimoter Replacing -2
    • idea: taking some kinds of PCR, and checking the length of its products by electrophoresis.
      1. EX_F / PS_R: expected length=2.7kbp
      2. X_NLS*3_GFP / 200dn_PS_R: expected length=2kbp
      3. 100up_EX_F / PS_SlrP_R: expected length=1.3kbp
    • result: SUCCEED. We observed appropriate bands.
• Wednesday
  • Backbone constructing
    • mini-prep(again-again)
    • PCR of the complex with EX_F / PS_R.
      • The product (EX-TetR-RBS-SlrP-NLS-NLS-NLS-GFP-dt-TetR-RBS-RFP-dt-SP) will be insert.
    • Gel extraction of PCR product.
    • digestion
      • insert: EcoRI / PstI
      • vector(pSB1K3, distributed from iGEM HQ): EcoRI / PstI
    • Gel extraction
• Thursday
  • Backbone constructing
    • Ethanol precipitation of yesterday's digestion product.
    • Ligation, transformation, and cultivation.
• Friday
  • Backbone constructing
    • vector replacing
      • result: SUCCEED.
• Saturday
  • No experiments because required primers had not arrived.

Week 4: Aug. 21th - Aug. 27th

• Sunday
  • No experiments because required primers had not arrived.
• Monday
  • cultivate E.coli which has plasmid that its promoter and vector were replaced.(for next day's mini-prep)
• Tuesday
  • mini-prep of cultivated E.coli
• Wednesday
  • No experiments because required primers had not arrived.
• Thursday
  • preparation of next day's PCR
    • idea: The complex has two double terminators, so we were anxious that the PCR product would be full of smear because our forward primer is annealed to 5' terminal of double terminator seaquence. Thus, we thought it is nice to cut away the unwanted double terminator by digesting with endonucleases, NdeI and CpoI. The recognition site of NdeI is in GFP coding sequence, and the one of CpoI is in RFP sequence.
      • digestion of the comples with NdeI / CpoI (Both of them were stocked in our laboratory.)
        • result: FAILURE. We think the endonucleases are too old.
• Friday
  • Primers came.
  • Backbone constructing
    • final PCR
      • Because of yesterday's failure of double terminator removing, we must deal with the primer mis-binding problem. So we decided to adopt "Step-Down PCR" protocol.
      • PCR: BsaI_SlrP_R / BsaI_dt_F Extension time is 2-minutes (because KOD_Plus_Neo will extent 1kbp/30sec, the manual says and PCR product will be 3.0kbp)
      • result: FAILURE. Extension time might be too short.
• Saturday
  • Backbone construction
    • final PCR (Re-try)
      • We set the extension time 4 minutes
      • result: SUCCEED. We obserbed appropriate band by electrophoresis
    • Gel extraction of PCR product

Week 5: Aug. 28th - Sep. 3rd

• Sunday
  • No experiment
• Monday
  • No experiment
  • Meeting: we report the completion of backbone, and discuss the plan of next step.
• Tuesday
  • No experiment
• Wednesday
• Thursday
  • Making linear backbone plasmid: Inserting Fluorescent Protein coding sequence
    • Selecting insert DNA: CFP(BBa_E0020) and RFP(BBa_E1010)
    • Xba-byebye PCR of insert DNA
    • Gel extraction
    • Digestion
      • insert(Sba-byebye-PCRed): NotI / SpeI
      • vector(BsaI backbone): BsaI(2 cutting sites are there)
    • Gel extraction and Ethanol precipitation
    • Ligation, transformation, and cultivation.
• Friday
  • Making plasmid
    • result: FAILURE
    • Discussing the cause.
      • We decide re-make the backbone from the first step.
• Saturday

Week 6: Sep. 4th - Sep. 10th

• Sunday
• Monday
• Tuesday
• Wednesday
• Thursday
• Friday
• Saturday

Week 7: Sep. 11th - Sep. 17th

• Sunday
• Monday
• Tuesday
• Wednesday
• Thursday
• Friday
• Saturday

Week 8: Sep. 18th - Sep. 24th

• Sunday
• Monday
• Tuesday
• Wednesday
• Thursday
• Friday
• Saturday

Week 9: Sep. 25th - Oct. 1st

• Sunday
• Monday
• Tuesday
• Wednesday
• Thursday
• Friday
• Saturday

Primers

Note

Primer Name	Whole Sequence
	F/R	Annealing Sequence	Tm	Adding Sequence

General Primers

EX_F	gcagaattcgcggccgcttctagag
	Forward	Biobrick Prefix	74.5 C	None
PS_R	agcctgcagcggccgctactagta
	Reverse	Biobrick Suffix	74.6 C	None
suffix_F	tactagtagcggccgctgcaggct
	Forward	Biobrick Suffix	74.6 C	None
prefix_R	ctctagaagcggccgcgaattctgc
	Reverse	Biobrick Prefix	74.5 C	None
100up_EX_F	aacctataaaaataccgcatacac
	Forward	100bp upstream from Biobrick prefix	62.7 C	None
200dn_PS_R	tcccctgattctgtggataaccgt
	Reverse	200bp downstream from Biobrick suffix	66.6 C	None

• [http://partsregistry.org/wiki/index.php?title=Part:BBa_K496000 See details of 100up_EX_F/200dn_PS_R] (partsregistry)

Primers Used for Backbone Construction

EX_RBS_SlrP_F	GCAGAATTCGCGGCCGCTTCTAGAaaagaggagaaaatatgtttaatattactaatatacaatctacggc
	Forward	RBS sequence, 5' terminal of SlrP coding sequence	69.7 C	Biobrick Prefix
PS_SlrP_R	AGCCTGCAGCGGCCGCTACTAGTggtaagtcctaatattttcagacgaag
	Reverse	3'terminal of SlrP coding sequence	64.5 C	Biofusion Suffix
Bsa1_dt_F	GGCGACTAGAGAGACCccaggcatcaaataaaacgaaag
	Forward	5'terminal of double terminator sequence	63.6 C	BsaI recognition site and its cleavage site
Bsa1_SlrP_R	GGCCTGGCCTGAGACCCCggtaagtcctaatattttcagacga
	Reverse	3'terminal of SlrP coding Sequence	63.0 C	BsaI recognition site and its cleavage site
Bsa1_GSK_SlrP_R	GGCCTGGCCTGAGACCCCACTTTCAGCGAAACTTGTAGTGCGAGGGCGACCACTCATggtaagtcctaatattttcagacga
	Reverse	3'terminal of SlrP coding Sequence	63.6 C	GSK Tag, BsaI recognition site and its cleavage site

• See details of BsaI Backbone (Project Page)

Sequencing Primer

SlrP_373_to_394_F	gaaagtcagtcacctatacccg
	Forward	SlrP coding sequence, from 373bp to 394 bp	63.4 C	None