"

From 2011.igem.org

Home	Team	Project	Parts Submitted to the Registry	Modeling	Notebook	Solutions	Safety	Attributions	Hardware	Material Safety Data Sheets	[http://partsregistry.org/assembly/libraries.cgi?id=35|MIT Parts Registry]

Baltimore's iGEM Team 2011 is continuing the work begun in 2010. Last year we had a strong DIY focus.We still have that focus, as well as an academic slant to the Team.

The Taq project: Our goal has been and is to provide a way for anyone to be able to make their own Taq polymerase instead of having to purchase it. Below is a diagram of the construct made using a program called PlasmaDNA. This program is available as a free download and is a good program for diagramming cloning strategies. The plasmid was never sequenced, but checks out with respect to restriction mapping and produces a protein of the correct size 92 kd that has thermostable polymerase activity.

Notice that in our model you can see the restriction enzymes enzyme sites that were used to splice in the Pol1 coding sequence for Taq polymerase.

File:PET-taq model.pdf

The modeling for However the gene for Taq polymerase has a PstI site located within the coding sequence which makes it incompatible with the BioBrick assembly standard. So the first order of business was to change the sequence through site directed mutagenesis in a way that would maintain the amino acid sequence of the protein but change the DNA sequence of the gene.

Step 1. Download the sequence of the Taq polymerase gene (Genbank accession # J04639) into a restriction mapping program such as web cutter or into gene designer (available free of charge but requires registration from DNA 2.0). Gene designer has the benefit of displaying the amino acid sequence and you can see directly which codons have to be changed and the alternates. Last year we used this to design two primers (listed below) that can be used for the mutagenesis procedure. Coupled with the biobrick primers you should be able to convert the taq pol 1 gene to make it compatible with the biobrick assembly standard.

Primers for mutagenesis:

TAQ Rm ctcccggtactgaaggatcttctccac G to T change at base 1461 in Taq CDS (1582 in genebank) removes Pst I site

TAQ FM gtggagaagatccttcagtaccgggag complimentary primer for Taq mutagenesis

Primers for adding on BioBrick prefix and suffix to Taq pol I gene

Fwd Pol I + BB prefix gtttcttcgaattcgcggccgcttctagagatgctgcccctctttgagcc

Taq + BB suffix gtttcttcctgcagcggccgctactagtatcactccttggcggagagccttccgctgtcctggcccacatggaggccacgggggtgcgcctggacgtggcctatctcagggccttgtccttccgctgtc ctggcccaca tggaggccac tggggtgcgc ctggacgtgg cctatctcag ggccttgtcc

Step 2. Mutagenesis. The enclosed plasmid (pET-Taq 4A4) is the Taq polymerase cloned into the NdeI and Eco RI sites of the plasmid pET-17b.

You can use this plasmid to do the mutagenesis and biobricking. If for some reason you want to start with genomic DNA I have some of that available as well and have included a bit. The biobrick suffix and prefix primers will amplify about a 2.5 kb band. For the mutagenesis probably the best strategy is to use the quick change procedure. Basically this entails doing a PCR reaction with the plasmid and the mutagenic primers such that you copy the entire plasmid. The plasmid is then destroyed by digestion with the enzyme DpnI, the PCR product isn’t destroyed because it’s not methylated where as the plasmid being isolated from a bacterial cell is methylated. The PCR product is then transformed into cells where they repair the single stranded nicks. Last year we tried making our own mutagenesis reaction which may explain why it didn’t work out so well. Stratagene, now Agilent (http://www.genomics.agilent.com/GenericB.aspx?PageType=Family&SubPageType=FamilyOverview&PageID=155) , has a kit with the pfu turbo polymerase and optimized dNTP’s mix that would probably make things easier but it costs money-if you decide to go the homegrown route read the Agilent manual and pay attention to the details of primer, template, and dNTP concentration-you also might want to look up on Pub Med and see if you can find out ways in which the reaction is optimized. Once you have colonies (amp resistant) do colony PCR to identify the correct clones and cut with PstI to insure you have removed the site-you can use the 4a4 plasmid as a control. Next use the biobrick prefix and suffix to add the biobrick sites, ligate it into one of the biobrick vectors and you should have a part that you can submit to the registry. Next steps: having the part is one thing but you want to make the protein available to people so that means adding a suitable promoter (arabinose, IPTG) RBS and transcriptional terminators. Look in the registry for suitable parts for this assembly and draw or write out the sequence of steps necessary to get to a composite part that contains the promoter, RBS, CDS, and terminators. Now you have another part that can be submitted to the registry. You should think about doing a careful analysis of the part by way of looking at the purification steps. I’ve included a protocol that I use in my classes, but be aware that this is for the pET-Taq plasmid so your induction conditions might be different, although the purification process should work. Other things that you might want to consider: What if you could get the Taq secreted from the cells? I’m not sure how to do this with E. coli-that would require some research on your part- but one thing to consider is producing the protein in yeast-there are a couple of efficient secretion sequences that can be added to the amino terminus of the protein. This way you could induce, spin out the cells and have an extract that might have thermostable polymerase activity. I say might because yeast glycosylates proteins ( you can look for potential glycosylation sites using the EXpasy site ( http://expasy.org/) and this could have an effect on polymerase activity. If you decide to go this route I have some vectors you could use or you can see what’s available in the registry.