Team:Freiburg/Notebook/15 August

From 2011.igem.org

Revision as of 22:42, 21 September 2011 by UsernameV (Talk | contribs)


This is the wiki page
of the Freiburger student
team competing for iGEM 2011.
Thank you for your interest!

Contents

green light receptor

Order primers

Investigators: Jakob

  • Order new primers for the quickchange of CcaS and CcaR
  • I got the sequence from the iGEM-Team Uppsala THX again!

blue light receptor

Transformation

Investigators: Sophie

Transformation of ligated parts:

  • LovTAP
  • Not-Gate
  • T3 vector


stored in incubator at 37°C.

red light receptor

PCR for Cph8

Investigators:Julia


after protocol from Uppsala. PCR-Mixture for one Reaction:

For a 50 µl reaction use


32,5µl H20
10µl 5x Phusion Buffer
2.5µl Primer fw
2.5µl Primer dw
1µl dNTPs
1µl DNA-Template
0.5 µl Phusion (add in the end)

Primer used:
cph8 Prefix: TTCGAATTCGCGGCCGCTTCTAGATGGCCACCACCGTACAA
cph8 Suffix: CCGCTACTAGTATTATTACCCTTCTTTTGTCATGCCCT

PCR program:
Temp. Time,Nr of cycles
98° 5' 1x
98° 30 10x
65° 30
72° 1'15
98° 30 20x
72° 1'15
72° 7' 1x
4° ∞

Template: Voights plasmid (10x dilution)
Amplicon: 2235 bp

Elongation time Phusion 67,05 sec

Lysis cassette

2A Assembly of the Lysis Cassette (S4+S15)

Investigators:Theo


Since 3A assemly doesn't want to help us, we are going to try a 2A Assembly of S4 with S15.
S4 is cut with SpeI and PstI.
S15 is cut with XbaI and PstI, and is to be run on a gel, cut, isolated, ligated with S4 and finally transformed in competent cells.

After the gel with S15 was run, I noticed there was no band to be seen and our instructor told me it was because I had not used a lot of DNA (500ng).

I am going to repeat this tomorrow.

Precipitator

Ligation

Investigators: Sophie
continue from experiment: Cloning (12.8.11)
Project name: inducible promoter for pbd
Vector: psb1T3
Inserts: IPTG-Promoter,Pbd-GFP
samples stored in Ruediger's box

Transformation

Investigators: Sophie
continue from experiment: Ligation
Project name: inducible promoter for pbd
samples stored in incubator

PCR

Investigators: Rüdiger

PCR of precipitator.

Primer:

  • p44
  • p45
  • p46
  • p48
  • 51
  • 52
  • 53

Primer:

  • p54
  • p47
name primer primer
44 p44 p54
45 p45 p54
46 p46 p54
48 p48 p47
51 p51 p54
52 p52 p54
53 p53 p54


Freiburg 2011 Testdigest1.jpg

Freiburg 2011 tesdigest2.jpg

Freiburg 2011 testdigest3.jpg

                       

Retrieved from "http://2011.igem.org/Team:Freiburg/Notebook/15_August"