"
Team:NTNU Trondheim/Journal
From 2011.igem.org
Lab Journal
Thursday 23/6
Lab equipment was prepared: Pipette tips, 1.5 ml tubes, toothpicks, SOC, LA with 100 µg/ml ampicillin/ 100 µg/ml spectinomycin (from 1988). Recipies are given in recipies section.
Friday 24/6
Biobricks were taken out from kit by resuspending them in sterile water followed by transformation to E.coli DH5 alpha. The biobricks that were taken out are given below:
| Abbreviation | Name | Part number | Resistance |
|---|---|---|---|
| P1 | rrnB P1 | BBa_K112118 | Spec |
| lambda pR | lambda pR mod | BBa_R0051 | Amp |
| RFP | TetR + p(TetR)+RFP | BBa_K092600 | Amp |
| Lux | TetR + p(TetR)+RFP+luxI | BBa_K092700 | Amp |
Saturday 25/6
Plates with transformants were moved to fridge.
Sunday 26/6
Transformants were inoculated in 3 ml LB + proper antibiotics to prepare for isolation of plasmid.
Monday 27/6
Plasmids that contained P1, lambda pR, RFP and Lux biobricks were isolated by using miniprep kit from Promega.
Consentrations of the biobricks were measured and were as follows:
| Biobrick | Concentration (ng/µl) |
|---|---|
| P1 | 98.4 |
| lamda pR | 43.8 |
| RFP | 141.8 |
| Lux | 62.8 |
Transformants from Lux/RFP constructs were not red as expected. It was suggested that the phenotype could be explained by presence of TetR in the system. Since tetracycline (Tc) is an inhibitor of TetR we tried to grow the transformants in sublethal consentrations of Tc. E. coli with RFP were grown in 3 ml LB with 0, 0.1, 0.3, 0.6, 1.0, 1.5 and 100 µg/ml Tc.
Tuesday 28/6
It's Jon's birthday! Happy day!
Growing the bacteria in Tc did not result in red color of the culture
lambda pR was ligated to RFP backbone:
- RFP and Luc construct were cut with EcoRI and XbaI.
- lambda pR was cut with EcoRI og SpeI
Restriction digestion was done using [http://partsregistry.org/Help:Protocols/Restriction_Digest iGEM's protocol]
Since the restriction digestion gave unexpected fragments and we had not yet seen any pigmentation, we started looking for other designs that could give the result that we wanted. We came up with a different design that used pLac promoter and lacI repressor instead of the pTet/TetR system.
To start constructing the alternative system 3 new biobricks were transformed to E. coli:
| Abbreviation | Name | Part number |
|---|---|---|
| LacI | LacI + RBS | BBa_J24679 |
| pLac | Lac promoter hybrid | BBa_R0011 |
| mCherry | mCherry + RBS + term | BBa_J06702 |
Wednesday 29/6
Lambda Pr, RFP and Lux was cut:
- RFP with XbaI and PstI
- Lux with XbaI and PstI
- Lambda Pr with SpeI and PstI
The cutting gives RFP and Lux as insert and Lambda pR the backbone.
The restriction fragments were separated on agarose gel:
The restriction fragments for lambda pR were as expected but not for RFP or Lux.
Lambda pR was isolated from gel (2110 nt) by using DNA gel extraction kit.
DNA concentration of lambda pR was measured to 5.2 ng/µl
Biobricks that were transformed yesterday were inoculated in 3 ml LB with proper antibiotics to prepare for isolation of plasmids.
Anders ordered a biobrick that should contain LacI + RBS + double terminator from iGEM HQ: BBa_K292006
Thursday 30/6
Plasmid was isolated from lac-design biobricks. Concentration of DNA:
| Biobrick | Concentration (ng/µl) |
|---|---|
| pLac | 16.5 |
| lacI | 37.1 |
| mCherry | 36.7 |
pLac biobrick was cut with SpeI and PstI mCherry was cut with XbaI and PstI
Makes pLac backbone and mCherry insert
Tried direct ligation of restriction fragments using following reaction mix:
| Compound | Amount (µl) |
|---|---|
| H20 | 11 |
| Backbone | 2 |
| Insert | 2 |
| T4 ligase buffer | 2 |
| Ligase | 1 |
Reaction mix were mixed and incubated 30 min at 16C. Heat destruction of enzymes for 20 min at 80C. 2 µl of ligation mix were used for transformation. Red colonies were to be selected from transformation. Mix, spin down, 30 min 16C, heat kill 20 min 80C. Transform 2µL. Selektere for røde kol.
The rest of the ligation mix were separated on agarose gel and mCherry insert (895 nt and pLac backbone (2116 nt) were isolated from gel using Quiaquick Gel Extraction Kit. DNA concentration was measured:
| Biobrick | Concentration (ng/µl) |
|---|---|
| pLac | 8.5 |
| mCherry | 2.1 |
The directly ligated restriction fragments transformed to E. coli were plated out on LA + Amp and LA + IPTG and grown ON.
The biobrick that has been ordered (BBa_K292006) was investigated and was found to be identical to the biobrick that we were planning to make, given that the sequence is as given in the registry.
relA
The nucleotide sequence of relA (codes for protein that synthesize ppGpp) was found in database. One hickup in making this gene a biobrick; there is a PstI site inside the gene (at 1383-1388 nt if added prefix). To overcome this problem we could use partial digestion or we could introduce a silent mutation that removes the restriction site. By changing CTGCAG → CTACAG or CTGCAA this could be done.
LacI-negative E.coli
To make the lac-system work we should use a strain that is lacI-negative. According to [http://partsregistry.org/Part:BBa_K177038 another iGEM group] the strain Top10 is lacI-negative.
Friday 1/7
mCherry insert and pLac backbone was isolated from gel using Quiquick Gel Extraction kit and then ligated using the following reaction mix:
| Compound | Amount (µl) |
|---|---|
| Insert | 14 |
| Backbone | 3 |
| T4 ligase buffer | 2 |
| Ligase | 1 |
The ligation mix was ligated at 16C for 1 hour.
Ligation mix was then transformed to LA + Amp, LA + Amp + IPTG and LA + Amp + more IPTG
Two new biobricks were also transformed and plated out on LA + Amp:
| Abbreviation | Biobrick | Part name |
|---|---|---|
| GFP | GFP + LVA | BBa_K082003 |
| RBS | Ribosome binding site | BBa_B0034 |
Monday 4/7
Plasmid isolation of GFP, RBS and LacP+mCherry. Concentrations were measured.
| Biobrick | Concentration (ng/µl) |
|---|---|
| GFP | 60.1 |
| RBS | 16.2 |
| pLac + mCherry | 29.1 |
Restriction cutting of RBS and GFP:
- RBS: SpeI and PstI making it the backbone
- GFP: XbaI and PstI making it the insert.
Gel Extraction:
Extracted RBS backbone, and GFP insert form the gel.
| Biobrick | Concentration (ng/µl) |
|---|---|
| GFP | 3.0 |
| RBS | 4.6 |
Plating:
Plating of pLac + mCherry on amp plates, amp plates with additional IPTG (7µL), amp + IPTG plates and amp + IPTG plates with additional IPTG (7 µL). Incubating on 30 and 37 degrees.
Tuesday 5/7
Ligation of RBS backbone and GFP insert.
10μL Ligation Mix
1.0 μL 10X T4 ligase buffer
6:1 molar ratio of insert to vector (~10ng vector)
Add (8.5 - vector and insert volume)μl ddH2O
0.5 μL T4 Ligase
Used 2,5 µL RBS backbone and 6 µL GFP insert. Incubating at 16 degrees celsius. Then heating at 80 degrees celsius.
PCR amplification of rrnB P1 from BioBrick Resuspend primers in dH20. Primers will amplify the whole rrnB P1 BioBrick (rrnB.FWD and REV), and only the assumed promoter sequence (pro.FWD and REV), and will add normal prefix and suffix instead of BBb format.
Primers used:
| Primer | Type | Sequence |
|---|---|---|
| rrnB P1 F | Forward | GTTTCTTCGAATTCGCGGCCGCTTCTAGAGACGTATCCTACGCCCGTGGT |
| rrnB P1 R | Reverse | GTTTCTTCCTGCAGCGGCCGCTACTAGTACGCCTTCCCGCTACAGAGTCA |
| proL F | Forward | GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCCTCTTGTCAGGCCGGAATAACTCC |
| proL R | Reverse | GTTTCTTCCTGCAGCGGCCGCTACTAGTAGCGGCGTGTTTGCCGTTGTT |
PCR mix
Work on ice
Dillute P1 DNA 1µL + 9µL dH2O → ( 9,84 g/µL P1 DNA)
2 x PCR tubes 0,5 µL DNA
5 µL 10x PCR buffer 2 (w/MgCl)
0,5 µL 10 mM dNTPs
1 µL fwd primer (rrnBL og proL)
1 µL rev primer (rrnBL og proL)
0,5 µL polymerase
41,5 µL H20
Heat cycles:
Heated lid Initial denaturation: 94C 2 min Denaturing: 94C 30 s Annealing 58C 30 s Elongation 72C 60 s Repeat 2-4 34 times Final elongation 72C 7 min Cooling 4 C HOLD
Running products on 1,5 % agarose to find short fragment (promoter sequence). Should give 552 bp (rrnB) and 129 bp (pro)
Inoculated "LacI with RBS", TERM and LacP+MC biobrick. LacP+MC with and without IPTG and incubating at 30 and 37 degrees celsius.
Wednesday 6/7
