Team:Potsdam Bioware/Labjournal/August part 1

From 2011.igem.org

Revision as of 18:05, 20 September 2011 by JessicaE (Talk | contribs)

Contents

50th Labday 2011-08-01

Sequencing of mutated mdnA genes

Investigators: Steffi, Vanessa, Nicole

Aim: Determination of mutation rate employing sequencing of mutated mdnA

Time: 2011-08-01,10:00-13:00

Materials:

  • Miniprep of mutated mdnA and restricted for 2 resp. 3 hours
  • Sequencing Primer: sf_mdna_1
  • Freelabels for Value ReadTube (MWG Eurofins)

Method:

  • DNA concentration (for sequencing): 100 ng/ µl
  • Total volume: 15 µl
  • Primer concentration: 2 pmol/ µl
  • Total volume: 200 µl (approx. 15 µl per sequencing reaction)
  • sent to MWG Eurofins with the aid of Free sample bags

Further tasks:

  • Analyzing sequencing results
  • Determination of mutation rates


Ligation of mdnA and GeneIII for phage display (strategy 2)

Investigators: Leif

Aim:ligation of mdnA and GenIII to get a fusion gene for phage display

Time: 11:00-13:00

Method:

  • ligation-samples from 2011-07-27;

Protocol:

  • 5 µl (ca 25 ng) digested geneIII (NgoMIV, AatII)
  • 3 µl (ca 30 ng) digested mdnA (NarI, AgeI)
  • 2 µl 10x T4 Ligase Buffer
  • 1 µl T4 Ligase
  • 9 µl water

2 h, room temperature


Further tasks:
ligation into vector


Ligation of mdnA/GeneIII-fusion gene into pARW089 for phage display (strategy 2)

Investigators: Leif

Aim: ligation of mdnA and GenIII to get a fusion gene for phage display

Time: 11:00-13:00

Method:

  • ligation-samples from 2011-08-01;

Protocol:

  • 6 µl (ca 70 ng) digested vector pARW089 (NarI, AatII)
  • 1 µl (ca 5 ng) fusion gene mdnA/geneIII
  • 2 µl 10x T4 Ligase Buffer
  • 1 µl T4 Ligase
  • 10 µl water

2 h, room temperature, then over night in the freezer


Further tasks:
transformation of E. coli


Mutagenesis of Precission and TEV proteases to remove iGEM restriction sites from the proteases and introduction of iGEM restriction sites

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul, Sebastian

Aim:

  • Removal of iGEM restriction sites from proteases, amplifying protease fragments with iGEM restriction sites

Materials:

  • Plasmid 1: pET9d_Thrombin-CS_XbaI-TEV-Protease_BamHI
  • Primers: (1) f_TEV_ACCAGC , r_TEV_iGEM_BahmHI (2) r_TEV_ACCAGC , f_TEV_AraFusion_NgoMIV
  • Plasmid 2: pGEX-3_PreSiccion
  • Primers: (1) f_Presiccion_ACCAGC, r_Presiccion_iGEM_BamHI (2) r_PreSiccion_ACCAGC, f_PreSiccion_AraFusion_NgoMIV

Used method:

PCR

  • Template: 1µl = 3,6 ng
  • Nucleotides: 1µl of 10mM ready to use dNTP mix
  • 5µl 10x Amplification buffer S
  • 5µl 25mM MgCl2
  • 2,5µl primers = 25pmol absolute (2,5µl of each primer = 5µl per tube)
  • 32,5µl of pure water
  • 0,5µl TaqPol

Program: iGEM001

  • Denat: 3min 94°C
  • 5x:

Denat: 45sec 94°C

Anneal:45sec 53°C

Extend:45sec 72°C

  • 25x:

Denat: 45sec 60°C

Anneal:45sec 60°C

Extend:45sec 72°C

  • Final Extend: 10min 72°C

Result:

Resolving of PCR products (10µl) on 2% agarose gel

Expected Fragments:

TEV:

  • TEV_mut_fragI: 360bp
  • TEV_mut_fragII: 400bp

Precission:

  • PreSiccion_mut_fragI: 420bp
  • PreSiccion_mut_fragII: 153bp

UP MutPCR TEV PRE BAMHI NgoMIV.jpg

Further going:

  • 40µl of PCR products left:*20µl for preparative agarose gel (2%)
  • 20µl for PCR purification Kit
  • Assembly PCR of purificated products to produce NgoMIV_iGEM_TEV-Protease_iGEM_BamHI and NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI


Amplification of Arabinose Induction System from pBAD_iGEMexpress

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul, Sebastian

Aim:

  • Amplificarion of an arabinose induction system (AraC) from pBAD_iGEMexpress plasmid, produces a 1273bp fragment

Materials:

  • Plasmid: pBAD_iGEMexpress (Nr.4)
  • Primers: f_AraC_HindIII_iGEM , r_AraC_NgoMIV

Used method:

PCR

  • Template: 1µl = 7,2 ng
  • Nucleotides: 1 µl of 10mM ready to use dNTP mix
  • 5µl 10x Amplification buffer S
  • 5µl 25mM MgCl2
  • 2,5µl primers = 25pmol absolute (2,5µl of each primer = 5µl per tube)
  • 32,5µl of pure water
  • 0,5µl TaqPol

Program: iGEM002

  • Denat: 3min 94°C
  • 5x:

Denat: 60sec 94°C

Anneal:60sec 53°C

Extend:60sec 72°C

  • 25x:

Denat: 60sec 60°C

Anneal:60sec 60°C

Extend:60sec 72°C

  • Final Extend: 10min 72°C

Result:

Resolving of PCR products (10µl) on 1% agarose gel

Expected Fragments: HindIII_iGEM_AraC_NgoMIV 1273bp

UP PCR pBAD iGEMexpress AraCcloning.jpg

Further tasks:

  • 30µl of PCR product left: (1) Preparative Agarose Gel + Extraction(2) Digestion of fragment with HindIII and NgoMIV and gel purification (3) Ligation with (digested) NgoMIV_PreSiccion-Protease_iGEM_BamHI or NgoMIV_TEV_iGEM_BamHI fragments (see entry above).

EDIT:

The HindIII_iGEM_AraC_NgoMIV fragment was purificated from a preparative gel (1.5%)

Concentration:12,5ng/µl


Annealing of TEV_mut_fragI and TEV_mut_fragII /PreSiccion_mut_fragI and PreSiccion_mut_fragII

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul, Sebastian

Materials:

TEV:

  • TEV_mut_fragI: 360bp (40µl)
  • TEV_mut_fragII: 400bp (40µl)

Primers for PCR:

  • f_TEV_AraFusion_NgoMIV
  • r_TEV_iGEM_BamHI

Precission:

  • PreSiccion_mut_fragI: 420bp (40µl)
  • PreSiccion_mut_fragII: 153bp (40µl)

Primers for PCR:

  • f_PreSiccion_AraFusion_NgoMIV
  • r_PreSiccion_iGEM_BamHI

Used method:

1. 20µl of EACH fragment were purificated using a preparative agarose gel followed by extraction with "NucleoSpin ExtractII"-KIT and the other 20µl of EACH fragment were purificated with PCR-purification unsing "NucleoSpin ExtractII"-KIT.

2. Annealing of purificated primers using PCR (program iGEM002):

  • Template: Everything from purification (~15µl) = 4 reaction batches: 2x for TEV fragments, 2x Precission fragments from each purification method, respectively.
  • Nucleotides: 1 µl of 10mM ready to use dNTP mix
  • 5µl 10x Amplification buffer S
  • 5µl 25mM MgCl2
  • 2,5µl primers = 25pmol absolute (2,5µl of each primer = 5µl per tube)
  • 17,5µl of pure water
  • 0,5µl TaqPol

Program: iGEM0002

  • Denat: 3min 94°C
  • 5x:

Denat: 60sec 94°C

Anneal:60sec 53°C

Extend:60sec 72°C

  • 25x:

Denat: 60sec 60°C

Anneal:60sec 60°C

Extend:60sec 72°C

  • Final Extend: 10min 72°C

Result:

Resolving of PCR products (5µl) on 1,5% analytical agarose gel

Expected Fragments

for TEV:

NgoMIV_iGEM_TEV-Protease_iGEM_BamHI - 760bp

for Prescission:

NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI - 573bp

UP TEV PRE fragment ligation annot.jpg

Summary:

Ligation of TEV_mut_fragI and TEV_mut_fragII did NOT work.

Ligation of PreSiccion_mut_fragI and PreSiccion_mut_fragII did work.

The two fractions of ligated PreSiccion fragments were combined and PCR-purificated using "NucleoSpin ExtractII"-KIT (Concentration: 25ng/µl)

Further tasks:

Digestion of NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI fragment with NgoMIV and BamHI

Starting a new PCR for to produce new TEV-mut_fragI and TEV_mut_fragII fragments!!


Planning and accomplishing the PCRs of pBAD-mYFP Venus with Arabinosis and pEX_HisII with Lac

Investigators: Nicole, Nadja

Aim:To get Biobricks with Arabinosis and IPTG induction

Time: 2011-08-01,14:00-19:00

Materials:

  • Primer: 1. pr_Ara_Xba1, pf_Ara_EcoR1 and 2. pf_IPTG_EcoR1, pf_IPTG_Xba1
  • Plasmids: 1. pBAD-mYFP Venus and 2. pEX_HisII

Method:PCR

1.pBAD-mYFP Venus with Ara

  • 1,25 µl pBAD-mYFP Venus (1:10, 10,8 ng/µl)
  • 1,00 µl dNTPs
  • 5,00 µl Buffer
  • 2,50 µl pr_Ara_XbaI
  • 2,50 µl pf_Ara_EcoRI
  • 2,00 µl MgCl2
  • 0,50 µl Polymerase S
  • 35,25 µl H2O

2. pEX_HisII with Lac

  • 1,00 µl pEX_HisII(1:20, 9,6 ng/µl)
  • 1,00 µl dNTPs
  • 5,00 µl Buffer
  • 2,50 µl pf_IPTG_EcoRI
  • 2,50 µl pf_IPTG_XbaI
  • 2,00 µl MgCl2
  • 0,50 µl Polymerase S
  • 35,50 µl H2O

3. Program for both: IGBIOB1 (30 cycles)

Step Temperature Time
Hot start 94°C hold
Initial Denaturation 94°C 3min (180s)
Denaturation 94°C 20s
Annealing 44°C 40s
Extension 72°C 73s
Final Extension 72°C 600s

Further tasks:

  • See PCR results on agarose gel and do a gel extraction


51th Labday 2011-08-02

Transformation of BBa_I763007 in E. coli XL1-Blue

Investigators: Jessica, Steffi, Vanessa

Aim:Transformation of plasmid BBa_I763007 (containg Lambda promoter, RBS and RFP) in E. coli XL1-Blue cells to produce glycerol stocks for further use

Time: 2011-08-02,

Materials:

Method:

Further tasks:

  • Picking clones for overnight culturing
  • Producing glycerol stocks


Repetition of the PCRs of pBAD-mYFP Venus with Arabinosis and pEX_HisII with Lac because of less yield further planning and accomplishing the PCR of BBa_I763007 as it is a constitutive one

Investigators: Nadja, Nicole

Aim:To increase the yield and to get a constitutive Biobrick

Time:2011-08-02

Materials:

  • Primer: 1. pr_Ara_Xba1, pf_Ara_EcoR1 and 2. pf_IPTG_EcoR1, pf_IPTG_Xba1 and 3. Pr_constitutive_XbaI, pf_constitutive_EcoRI
  • Plasmids: 1. pBAD-mYFP Venus and 2. pEX_HisII and 3. BBa_1763007

Method:PCR

1. pBAD-mYFP Venus with Ara

  • 1,25 µl pBad (1:10, 10,8ng/µl)
  • 1,00 µl dNTPs
  • 5,00 µl Buffer
  • 2,50 µl pr_Ara_Xba1
  • 2,50 µl pf_Ara_EcoR1
  • 2,00 µl MgCl2
  • 0,50 µl Polymerase S
  • 35,25µl H2O

2. pEX_HisII with Lac

  • 1,00 µl pEX (1:20, 9,6 ng/µl)
  • 1,00 µl dNTPs
  • 5,00 µl Buffer
  • 2,50 µl pf_IPTG_EcoR1
  • 2,50 µl pf_IPTG_Xba1
  • 2,00 µl MgCl2
  • 0,50 µl Polymerase S
  • 35,50 µl H2O

1. BBa_1763007 -constititive

  • 1,00 µl BBa_1763007
  • 1,00 µl dNTPs
  • 5,00 µl Buffer
  • 2,50 µl pr_constitutive_XbaI
  • 2,50 µl pf_ constitutive_EcoR1
  • 2,00 µl MgCl2
  • 0,50 µl Polymerase S
  • 35,5 µl H2O

3. Program for 1. pBAD-mYFP Venus and 2. pEX_HisII: IGBIOB1 (30 cycles)

Step Temperature Time
Hot start 94°C hold
Initial Denaturation 94°C 3min (180s)
Denaturation 94°C 20s
Annealing 44°C 40s
Extension 72°C 73s
Final Extension 72°C 600s

4. Program for BBa_1763007 -constititive: IGBIOC1 (30 cycles: 2-step PCR, first run10x, second run 20x)

Step Temperature Time
Hot start 94°C hold
Initial Denaturation 94°C 3min (180s)
Denaturation 94°C 20s
Annealing 43°C 40s
Extension 72°C 45s
Denaturation 94°C 20s
Annealing 54°C 40s
Extension 72°C 45s
Final Extension 72°C 600s

Further tasks:

  • See PCR results on agarose gel and do a gel extraction

Agarose gel electrophoresis:

Gel 1

  • 5 µl PCR + 1 µl 6x loading dye
lane Sample Volume in µl Expected size in bp
M GeneRuler™ DNA Ladder Mix (diluted 1:10) 10
1 - - -
2 PCR Arabinose promotor 6 ~1200
3 PCR Arabinose promotor 6 ~1200
4 - - -
5 PCR Lac promotor 6 ~1400
6 PCR Lac promotor 6 ~1400

UP AG PCR Ara IPTG 2011-08-03 JE.jpg

Gel 2

  • 5 µl PCR + 1 µl 6x loading dye
lane Sample Volume in µl Expected size in bp
1 PCR Lambda promotor from BBa_I763007 -  ?
2 PCR Lambda promotor from BBa_I763007 -  ?
3 - -
M GeneRuler™ DNA Ladder Mix (diluted 1:10) 10

UP AG PCR BBa 2011-08-03 JE.jpg

Preparing of linearized backbones (pSB1A3, pSB1K3 and pSB1T3) to produce vectors for further applications

Investigators: Nadja, Nicole

Time: 2011-08-02,

Aim: Using linearized backbones for further transformations, iGEM restrictions sites are necessary

Idea:
Producing vectors with different antibiotic resistances (ampicillin, kanamycin and tetracyclin) and iGEM restriction sites to

1. have the choice which resistance you want and then the possibility to clone each gene of interest easily in the chosen vector

2. to clone inducible and constitutive promoter systems in it and use this as expression vector for further experiments


Steps:

1. Restriction enzyme digestion

2. Ligation with reporter gene

3. Transformation and miniprep afterwards

Materials:

  • Linearized backbones from iGEM Registry of Standard biological parts (part of Spring 2010 DNA distribution kits) - only with EcoRI and PstI restriction sites
  • pSB1A3 - ampicillin resistance
  • pSB1T3 - tetracycline resistance
  • pSB1K3 - kanamycin resistance
  • pSB1C3 - we already got from KUK lab


Restriction enzyme digestion of linearized plasmid backbones (pSB1A3, pSB1K3 and pSB1T3)

Investigators: Nadja, Nicole

Time: 2011-08-02,

Aim:Producing vectors, which carry tetracycline, kanamycin and ampicillin resistance genes and have all iGEM restriction sites

Materials:

  • Linearized backbones from iGEM Registry of Standard biological parts (part of Spring 2010 DNA distribution kits) à only with EcoRI and PstI restriction sites
pSB1A3, pSB1T3, pSB1K3
  • NEB Buffer 2
  • Purified BSA (NEB)
  • EcoRI (NEB)
  • pstI (NEB)
  • dH2O

Method:

1. Enzyme master mix

  • 5 µl NEB Buffer 2
  • 0.5 µl BSA
  • 0.5 µl of each EcoRI, PstI
  • 18.5 µl dH2O


  • mix 4 µl linearized plasmid backbone (25 ng/ µl) with 4 µl enzyme master mix

2. Reaction conditions

  • 30 min at 37°C by 750 rpm
  • 20 min at 80°C by 750 rpm

Further tasks:

  • Gel electrophoresis
  • DNA extraction
  • Ligation with reporter genes CFP and YFP
  • Transformation
  • Miniprep
  • Sequencing


Gel electrophoresis of digested (linearized) plasmid backbones (pSB1A3, pSB1K3 and pSB1T3)

Investigators: Nadja, Nicole

Time: 2011-08-02,

Aim:Producing vectors, which carry tetracycline, kanamycin and ampicillin resistance genes and have all iGEM restriction sites, through cloning CFP resp. YFP in the linearized plasmid backbones.

Materials:

  • linearized plasmids backbones (pSB1A3, pSB1K3, pSB1T3) digested with EcoRI and PstI
  • Agarose broad range (Roth)
  • 1x TAE buffer
  • Gel Red
  • DNA Ladder GeneRuler, 100bp plus (1:10) (Fermentas)
  • 6x Loading Dye (Fermentas)

Method:

1. Production of one 1 % and one 1.5 % agarose gels

  • 1 % gel: 0.5 g agarose in 50 ml 1x TAE buffer
  • 1.5 % gel: 0.75 g in 50 ml 1x TAE buffer
  • Adding 2 µl gel red to each gel

2. Loading gels and running

  • Add 6 µl Loading dye to each 30 µl sample
  • Gene Ruler DNA ladder
  • Running conditions: 100 V, approx. 45 min

3. Loading of gels

gel 1 (1 %) gel 2 (1.5 %)
lane Sample Volume in µl Expected size in bp Sample Volume in µl Expected size in bp
1 marker marker 6
2 - - - - - -
3 pSB1T3 36 2206 CFP 36
4 - - - - - -
5 pSB1A3 36 1862 YFP 36
6 - - - - - -
7 pSB1K3 36 1978 - - -

Results:

[[File:]] [[File:]]


The bands were excised and purified using the NucleoSpin Extract II (Macherey-Nagel) extraction Kit.


Further Tasks:

  • Ligation of CFP resp. YFP in each linearized backbone
  • Transformation
  • Minprep and production of glycerol stocks


52th Labday 2011-08-03

Transformation of generated pPDV089 (strategy 2)

Investigators: Leif

Aim:amplification of pPDV089

Time: 13:30-15:00

Method:

  • addition of 10 µl ligation reaction to XL1-blue cells
  • incubation 25 min on ice,
  • heat shock 45 sec at 42°C,
  • incubation 2 min on ice,
  • addition of 750 µl LB medium,
  • incubation 60 min at 37 °C and 750 rpm
  • plating on agar plates containing 100 µg/ml tetracyclin and 100 µg/µl ampicillin
  • storage over night at 37°C

Further tasks:
control cell clones


Ligation of pBAD-mYFP Venus and pEX_HisII with pSB1_K3 and pSB1_A3

Investigators:Nadja, Nicole

Aim:Build Biobricks inducible with IPTG or Arabinosis and detectible with YFP or CFP

Time:2011-08-02,10:00-13:00

Materials:

  • T4 ligase
  • 10x ligase buffer
  • vectors: pSB1_K3 and pSB1_A3
  • insert: pBAD-mYFP Venus and pEX_HisII

Method:

  • total volume of 20µl
  • 1µl T4 ligase
  • 2µl 10x ligase buffer
  • 5µl vector
  • 3µl insert
  • fill up to 20µl with H20
  • incubation over night at 18°C

Further tasks:

  • over night culture
  • miniprep
  • sequenzing


53th Labday 2011-08-04

digestion of vector pARW089 (strategy 2)

Investigators: Leif

Aim: digestion of pARW089

Time: 2011-08-04,10:00-12:00

Digestion of vector pARW089 with NarI (EheI isoschizomere) and AatII

  • 20 µl sample
  • NEB 10x buffer (2 µl)
  • Buffer M 10x buffer (2 µl)
  • 1 µl restriction enzyme NarI
  • 1 µ restriction enzyme AatII
  • 13 µl H2O


  • 2 h at 37°C, then over night in the fridge


Wrong buffer, so the experiment was rerun.

digestion of PCR products vector pARW089 (strategy 2)

Investigators: Leif

Aim: digestion of pARW089

Time: 2011-08-04,10:00-12:00

Digestion of vector pARW089 with NarI (EheI isoschizomere) and AatII

  • 20 µl sample
  • NEB 10x buffer (2 µl)
  • 1 µl restriction enzyme NarI
  • 1 µ restriction enzyme AatII
  • 13 µl H2O


  • 2 h at 37°C, then over night in the fridge

Further Tasks:

  • gel electrophoresis and purification of the two digested fragments
  • Problem: Shaker was on, so no digest possible!

Investigators: Stefan

Aim:digestion of pARW089

Time: 2011-08-04,10:00-12:00

Digestion of vector pARW089 with NarI (EheI isoschizomere) and AatII

  • 40 µl sample
  • NEB 4 10x buffer (4 µl)
  • 1 µl restriction enzyme NarI
  • 1 µ restriction enzyme AatII
  • 32 µl H2O
  • 2 µl pARW089 (undiluted sample)


2 h at 37°C, then heat over night in the fridge


Further Tasks:

  • gel electrophoresis and purification of the two digested fragments


54th Labday 2011-08-05

Digestion of NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI, HindIII_iGEM_AraC_NgoMIV fragments and pJC354-NheI-143C-Xho_blaFL_GGH5 vector

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul, Sebastian

Materials:

NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI - 573bp

HindIII_iGEM_AraC_NgoMIV - 1273bp

pJC354-NheI-143C-Xho_blaFL_GGH5 vector (contains PreSciccion cleavage site)

Digestion protocol:

1: NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI (25ng/µl):

  • 30µl NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI
  • 1µl NgoMIV
  • 1µl BamHI
  • 5µl 10x buffer = NEB 4
  • 0.5µl 100x BSA
  • 12.5µl pure water
  • =50µl

2: HindIII_iGEM_AraC_NgoMIV (12.5ng/µl)

  • 40µl HindIII_iGEM_AraC_NgoMIV
  • 1µl HindIII
  • 1µl NgoMIV
  • 5µl 10x buffer = NEB 4
  • 0.5µl 100x BSA
  • 1.5µl pure water
  • =50µl

3: pJC354-NheI-143C-Xho_blaFL_GGH5 vector (270ng/µl)

  • 4µl pJC354-NheI-143C-Xho_blaFL_GGH5 vector (contains PreSciccion cleavage site)
  • 1µl HindIII
  • 1µl BamHI
  • 5µl 10x buffer
  • 0.5µl 100x BSA
  • 38.5µl pure water
  • =50µl

-->The reaction was allowed to proceed for 2h!

Result:

Resolving of digested fragments (50µl) and digested vector (50µl) on 1.5% and 1% preparative agarose gels, respectively.

1: NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI (band 5) and HindIII_iGEM_AraC_NgoMIV (band 3) fragments

UP AraC Pre digest fragments 20110805.jpg

2: pJC354-NheI-143C-Xho_blaFL_GGH5 vector

UP pJC354 NheI 143C Xho blaFL GGH5 vector digest 20110805.jpg

Summary:

The bands corresponding to digested fragments were excissed and purificated with PCR-purification unsing "NucleoSpin ExtractII"-KIT.

Further tasks:

Triple ligation of digested fragments


digest pSB1A3, pSB1K3 (clone 1-16)

Investigators: Niels

Aim: prove of Insert

Digestion protocol: 16x

  • 5µl DNA - pSB1A3,pSB1K3
  • 0,5µl XbaI
  • 0,5µl EcoRI
  • 2µl 10x buffer = NEB 4
  • 12.5µl pure water
  • total: 20µl

37°C for 1h

Result:

Further tasks: sequencing


Restriction enzyme digestion pARW089 for Phage Display strategy II

Investigators: Leif

Time: 2011-08-05,10:00-12:30

Aim: Restriction enzyme digestion of pARW089 according to the protocol by Nadine from the 2011-07-22

Materials:

  • DNA: 5 µL
  • NEB Buffer 4 (10x): 4 µL
  • Enzyme AatII: 0.8 µL
  • Enzyme NarI: 2 µL
  • H2O: 28.2 µL

Total Volume: 40 µL

Results: Incubation of the digestion for 2 h with 750 rpm caused a breakdown of the restriction enzymes. The expreriment has to be repeated.

Miniprep of overnight cultures from ligation of pARW089 + mutated mdnA and test digest

Investigators: Jessica

Time: 2011-08-05, 10:00-18:30

Aim: DNA for sequencing and confirmation of insert

1. Miniprep:

  • 20 overnight cultures (1A-2a(2 h digest, clone a),1A-2b,2A-2a,...,5A-3b)
  • NucleoSpin® Plasmid (NoLid) (Macherey-Nagel)
    • Protocol for high-copy plasmids
    • elution with 50 µl H2O
  • measuring concentration with NanoDrop:
Sample concentration in ng/µl
1A-2a 435.9
2A-2a 480.1
3A-2a 464.3
4A-2a 362.7
5A-2a 433.9
1A-3a 528.3
2A-3a 489.5
3A-3a 487.3
4A-3a 422.7
5A-3a 537.3
1A-2b 422
2A-2b 297.4
3A-2b 538.2
4A-2b 427
5A-2b 452
1A-3b 375.5
2A-3b 549.9
3A-3b 307.8
4A-3b 450.1
5A-3b 462.3

2. Preparation of glycerol stocks:

  • adding 300 µl glycerol to 700 µl culture

3. Digest:

  • 2µl DNA (10 samples, only clone a)
  • 0,5µl NarI
  • 0,5µl AatII
  • 2µl 10x buffer NEB 4
  • 15µl H2O
  • total: 20µl
  • 37°C for 1h

4. Agarose gel electrophoresis:

  • 1% agarose gel
  • 1 h at 115 V

Samples

  • 20 µl digest + 4 µl 6x loading dye
lane Sample Volume in µl Expected size in bp
M GeneRuler™ DNA Ladder Mix (diluted 1:10) 10
1 1A-2a 24 10296, 116
2 2A-2a 24 10296, 116
3 3A-2a 24 10296, 116
4 4A-2a 24 10296, 116
5 1A-3a 24 10296, 116
6 5A-2a 24 10296, 116
7 2A-3a 24 10296, 116
8 3A-3a 24 10296, 116
9 4A-3a 24 10296, 116
10 5A-3a 24 10296, 116

UP AG digest 1A2a-5A3a 2011-08-05 JE 001.jpg

Result:

  • Inserts could be confirmed for samples from clone a

Further tasks:

  • sequencing to determine mutation rate


Miniprep of overnight cultures from ligation of pBAD-mYFP Venus and pEX_HisII with pSB1_K3 and pSB1_A3

Investigators: Nicole, Nadja

Time: 2011-08-05

Aim: DNA for sequencing and confirmation of insert

Materials/Methods:

1. Miniprep:

  • 16 overnight cultures
  • NucleoSpin® Plasmid (NoLid) (Macherey-Nagel)
  • Protocol for high-copy plasmids
  • elution with 50 µl H2O
  • measuring concentration with NanoDrop:

2. Preparation of glycerol stocks:

  • adding 300 µl glycerol to 700 µl culture

Further tasks:

  • sequenzing


55th Labday 2011-08-06

2nd Mutagenesis of TEV proteases to remove iGEM restriction sites from the proteases and introduction of iGEM restriction sites

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul

Aim:

  • Removal of iGEM restriction sites from proteases, amplifying protease fragments with iGEM restriction sites

Materials:

  • Plasmid 1: pET9d_Thrombin-CS_XbaI-TEV-Protease_BamHI
  • Primers: (1) f_TEV_ACCAGC , r_TEV_iGEM_BahmHI (2) r_TEV_ACCAGC , f_TEV_AraFusion_NgoMIV

Used method:

PCR

  • Template: 1µl = 3,6 ng
  • Nucleotides: 1µl of 10mM ready to use dNTP mix
  • 5µl 10x Amplification buffer S
  • 5µl 25mM MgCl2
  • 2,5µl primers = 25pmol absolute (2,5µl of each primer = 5µl per tube)
  • 32,5µl of pure water
  • 0,5µl TaqPol

Program: iGEM001

  • Denat: 3min 94°C
  • 5x:

Denat: 45sec 94°C

Anneal:45sec 53°C

Extend:45sec 72°C

  • 25x:

Denat: 45sec 94°C

Anneal:45sec 60°C

Extend:45sec 72°C

  • Final Extend: 10min 72°C

Result:

Resolving of PCR products (50µl) on 2% preparative agarose gel

Expected Fragments:

TEV:

  • TEV_mut_fragI: 360bp
  • TEV_mut_fragII: 400bp

Further going:

  • gel extraction with NucleoSpin Extract II
  • Assembly PCR of purificated products to produce NgoMIV_iGEM_TEV-Protease_iGEM_BamHI


2nd Annealing of TEV_mut_fragI and TEV_mut_fragII

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul

Materials:

TEV:

  • TEV_mut_fragI: 360bp (40µl)
  • TEV_mut_fragII: 400bp (40µl)

Primers for PCR:

  • f_TEV_AraFusion_NgoMIV
  • r_TEV_iGEM_BamHI

Used method:

1. 50µl of EACH fragment were purificated using a preparative agarose gel followed by extraction with "NucleoSpin ExtractII"-KIT.

2. Annealing of purificated primers using PCR (program iGEMMED):

  • Template: 5µl TEV_mut_fragI and 10µl TEV_mut_fragII = 1 reaction batch.
  • Nucleotides: 1 µl of 10mM ready to use dNTP mix
  • 5µl 10x Amplification buffer S
  • 5µl 25mM MgCl2
  • 2,5µl primers = 25pmol absolute (2,5µl of each primer = 5µl per tube)
  • 18,5µl of pure water
  • 0,5µl TaqPol

Program: iGEMMED

  • Denat: 3min 94°C
  • 3x:

Denat: 60sec 94°C

Anneal:60sec 53°C

Extend:60sec 72°C

  • 28x:

Denat: 60sec 94°C

Anneal:60sec 65°C

Extend:60sec 72°C

  • Final Extend: 10min 72°C

Result:

Resolving of PCR products (50µl) on 1,5% preparative agarose gel

Expected Fragments

for TEV:

NgoMIV_iGEM_TEV-Protease_iGEM_BamHI - 760bp

GelDoc documentation was not possible. 3 bands were visible:

1 band (1) at 700 - 800 bp (NgoMIV_iGEM_TEV-Protease_iGEM_BamHI),

1 band (2) at 500 - 600 bp (unexpected,)

1 band (3) at 300 - 400 bp (TEV_mut_fragI and TEV_mut_fragII)

Summary:

Ligation of TEV_mut_fragI and TEV_mut_fragII did work.

Unexpected band at 500 - 600 bp.

Further tasks:

Digestion of NgoMIV_iGEM_TEV-Protease_iGEM_BamHI fragment and of the unexpected band with NgoMIV and BamHI.


Digestion of NgoMIV_iGEM_TEV-Protease_iGEM_BamHI and of the unexpected band from the 2nd annealing TEV PCR

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators:Sascha

Materials:

NgoMIV_iGEM_TEV-Protease_iGEM_BamHI - 760bp

unexpected band - 500-600 bp

Digestion protocol:

  • 30µl NgoMIV_iGEM_TEV-Protease_iGEM_BamHI / 30µl unexpected band
  • 1µl NgoMIV
  • 1µl BamHI
  • 5µl 10x buffer = NEB 4
  • 0.5µl 100x BSA
  • 12.5µl pure water
  • =50µl
  • 5µl vector

-->The reaction was allowed to proceed for 2h and was resolving (50µl) on 1,5% preparative agarose gel.

Result:

No visible bands on 1.5% preparative agarose gels.

Further tasks:

New PCR for to produce new TEV-mut_fragI and TEV_mut_fragII fragments!!


Repeated PCR of mdnA and gene III for phage display (strategy 2)

Investigator: Sabine, Sandrina

Time: 2011-08-06,12:00-14:00

Aim:

  • amplification of mdnA with NarI and AgeI restriction sites (strategy 2)
  • amplificate GeneIII with NgoMIV and AatII restriction sites (strategy 2)

Primer:

  • primer: pf_mdnA_iGEM_EheI and pr_mdnA_iGEM_AatII (mdnaA, strategy 2)
  • primer: pf_geneIII_NgoMIV and pr_geneIII_iGEM_AatII (geneIII, strategy 2)

Reaction Components:

  • 5 µl Vector pARW089/Vector 100blaKDIR
  • 0,25 µl Taq Polymerase S (BioScience)
  • 1 µl dNTPs
  • 1 µl per primer
  • 5 µl 10x PCR Buffer S
  • 37,75 µl DNase free water

Further tasks:

  • purification
  • digestion


digestion of PCR products (strategy 2)

Investigator: Sabine, Sandrina

Aim:

digestion of mdnA and gene III for getting an mdnA-geneIII fusion gene with rfc25 restrition sites after ligation


Time: 2011-08-06,14:00-15:30

digestion enzymes:

  • digestion of mdnA (strategy 2) with NarI and AgeI
  • digestion of geneIII (strategy 2) with NgoMIV and AatII

reaction components:

  • 4 µl NEB 10x buffer
  • 1 µl per restriction enzyme
  • 30 µl PCR product
  • 4 µl H²O

reaction conditions:

  • 1 h for PCR fragments
  • 37°C NarI, AgeI, NgoMIV and AatII digestion

Further Tasks:

  • gel electrophoresis for purification of the digested fragments and vectors


gel electrophoresis of digested fragments and digested pARW089

Investigator: Sandrina

Aim:

  • control and purification of digested PCR fragments
  • control and purification of digested pARW089 (2011-08-05)

Time: 2011-08-06,14:00-18:00

Results:

  • mdnA (NarI and AgeI, stategy 2): ca 200 bp, but estimation difficult, because no GelDoc available (weekend)
  • geneIII (NgoMIV and AatII): no band
  • pARW089 : ca 10 kb, but estimation difficult, because no GelDoc available (weekend)

Further Tasks:

  • repeat PCR of geneIII
  • ligation


prepare samples for sequencing (pARW089 + mutated mdnA)

Investigators: Niels

Aim: mdnA_1 sequencing by eurofins mwg|operon

guidelines (eurofins mwg|operon)

Primer :2 pmol/µl (10 µl each sample)

  • 2,4 µl (100 µM) sf_mdnA_1
  • 117,6 µl water

Sample: 70 ng/µl (15 µl total)

  • sample (cDNA ng/µl) - DNA µl ( ad water 15 µl)
    • 1A-2a (435,9) - 2,4
    • 2A-2a (480,1) - 2,2
    • 3A-2a (464,3) - 2,3
    • 4A-2a (362,7) - 2,9
    • 5A-2a (433,9) - 2,4
    • 1A-3a (528,3) - 1,99
    • 2A-3a (489,5) - 2,15
    • 3A-3a (487,3) - 2,15
    • 4A-3a (422,7) - 2,48
    • 5A-3a (537,3) - 1,95

Legend:

  • example: 1A-2a
  • 1A-2a
    • sample 1-5 : different Mn-concentration (error-pone PCR)
  • 1A-2a
    • sample A-C : different error-pone PCR- appendage
  • 1A-2a
    • sample 2 or 3: 2h(or 3h) digest of pARW089 with AatII / NarI
  • 1A-2a
    • sample a or b : 1. clone(a) or 2. clone(b) from the same plate with: E. coli XL1 blue transformed with ligation of vector pARW089 and insert (error pone - PCR )

Further tasks: sequencing


56th Labday 2011-08-07

PCR purification of TEV_mut_fragI und II

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx


Investigators: Stefan

Aim:

  • PCR purification

Materials:

  • Promega PCR clean-Up System
  • TEV_mut_fragI (360bp), TEV_mut_fragII (400bp)

Used method:

Further going:


gel electrophoresisTEV_mut_fragI and II

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx


Investigators: Stefan

Aim:

  • TEV_mut_fragI (360bp), TEV_mut_fragII (400bp)

Materials:

  • use small raq at 80V

Used method:

  • no picture could be taken due to the weak UV signal

Further going:


Annealing PCR TEV_mut_fragI and II


For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Stefan

Aim:

  • TEV_mut_fragI (360bp), TEV_mut_fragII (400bp)

Materials:

1. 50µl of EACH fragment were purificated using a preparative agarose gel followed by extraction with "NucleoSpin ExtractII"-KIT.

2. Annealing of purificated primers using PCR (program iGEMMED):

  • Template: 5µl TEV_mut_fragI and 10µl TEV_mut_fragII = 1 reaction batch.
  • Nucleotides: 1 µl of 10mM ready to use dNTP mix
  • 5µl 10x Amplification buffer S
  • 5µl 25mM MgCl2
  • 2,5µl primers = 25pmol absolute (2,5µl of each primer = 5µl per tube)
  • 18,5µl of pure water
  • 0,5µl TaqPol

Program: iGEMMED

  • Denat: 3min 94°C
  • 3x:

Denat: 60sec 94°C

Anneal:60sec 53°C

Extend:60sec 72°C

  • 28x:

Denat: 60sec 94°C

Anneal:60sec 65°C

Extend:60sec 72°C

  • Final Extend: 10min 72°C

Used method:

Further going:


Ligation of NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI, HindIII_iGEM_AraC_NgoMIV and pJC354-NheI-143C-Xho_blaFL_GGH5 vector

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx


Investigators: Stefan

Aim:Triple-ligation of

NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI (573bp), HindIII_iGEM_AraC_NgoMIV (1273bp) and pJC354-NheI-143C-Xho_blaFL_GGH5 vector


Materials:

  • 3 µL PreScission fragment
  • 3 µL AraC fragment
  • 1 µL pJC354
  • 2 µL T4 liagtion buffer (Fermentas)
  • 1 µL T4 ligase (Fermentas)
  • 10 µL H20

Used method:

ligation at room temperatur for 3h

Results:

band was very blurry on the gel, probably of contaminated running buffer

Further going:


Transformation of Ligation of pJC AraC and PreScission in E. coli XL1 blue

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx


Investigators: Stefan

Aim:transform the ligation into E. coli XL1 blue

Materials:

protocol:

addition of 10 µl ligation reaction to cells (XL1-blue, tet-resistance) in 1.5 ml Eppi,

incubation 25 min on ice,

heat shock 45 sec at 42°C,

incubation 2 min on ice,

addition of 750 µl LB medium,

incubation at 37 °C for 60 min in Eppendorf thermomixer at 750 rpm,

plating on LB medium with 1,5 % agar, 100 µg/ml chloramphenicol,

storage over night at 37°C

Result:

no colonies

Further going:


Repeated PCR gene III for phage display (strategy 2)

Investigator: Sabine

Time: 2011-08-07,11:00-13:00

Aim:

  • amplificate GeneIII with NgoMIV and AatII restriction sites (strategy 2)

Primer:

  • primer: pf_geneIII_NgoMIV and pr_geneIII_iGEM_AatII (geneIII, strategy 2)

Reaction Components:

  • 5 µl Vector pARW089 / pak100blaKDIR
  • 0,25 µl Taq Polymerase S (BioScience)
  • 1 µl dNTPs
  • 1 µl per primer
  • 5 µl 10x PCR Buffer S
  • 37,75 µl DNase free water


  • purification of PCR fragments with QIAquick Gel Extraction Kit (250)

Further tasks: digestion


digestion of PCR products and vector (strategy 2)

Investigator: Sabine

Aim:

  • digestion of mdnA and gene III for getting an mdnA-geneIII fusion gene with rfc25 restrition sites after ligation
  • digestion of pARW089 for ligation of mdnA/geneIII fusion gene into it (strategy 2)

Time: 2011-08-06,12:30-15:00

digestion enzymes:

  • digestion of mdnA (strategy 2) with NarI and AgeI
  • digestion of geneIII (strategy 2) with NgoMIV and AatII
  • digestion of pARW089 (strategy 2) with NarI and AatII

reaction components:

  • 5 µl NEB 10x buffer
  • 1 µl per restriction enzyme
  • 40 µl PCR product / 5 µl vector
  • ad 50 µl water

reaction conditions:

  • 1 h for PCR fragments
  • 3 h for plasmids
  • 37°C

Further Tasks:

  • gel electrophoresis for purification of the digested fragments and vectors


prepare samples for sequencing (pSB1A3, pSB1K3)

Investigators: Niels

Aim: sequencing by eurofins mwg|operon

guidelines (eurofins mwg|operon)

Primer :2 pmol/µl (10 µl each sample)

Sample: 70 ng/µl (15 µl total)

  • sample (cDNA ng/µl) - DNA µl ( ad water 15 µl)
    • 1A3 CFP (204,5) - 5,13
    • 1K3 CFP (216,2) - 4,86
    • 1A3 YFP (235,7) - 4,45
    • 1K3 YFP (213,6) - 4,92

Further tasks: sequencing


57th Labday 2011-08-08

test digest of pSB1K3

Time: 2011-08-08,11:00-16:00

Investigators: Vanessa, Steffi, Katharina, Nadine

Aim: prove of Insert (CFP or YFP)

Materials:

  • pSB1K3 (clone 1 and 4 from last week ???)
  • EcoRI, PstI, XbaI, HindIII, AatII
  • Buffer 4
  • Agarose broad range (Roth)
  • 1x TAE buffer
  • Gel Red
  • DNA Ladder Mix (Fermentas)
  • 6x Loading Dye (Fermentas)

Digestion protocol (XbaI, EcoRI)

  • 5 µl DNA - pSB1K3 YFP or CFP (clone 4 or 1, respectively)
  • 0.5 µl XbaI
  • 0.5 µl EcoRI
  • 2 µl 10x buffer = NEB 4
  • 12.5 µl pure water

Digestion protocol (PstI, EcoRI)

  • 5 µl DNA - pSB1K3+YFP or CFP (clone 4 or 1, respectively)
  • 0.5 µl EcoRI
  • 0.5 µl PstI
  • 2 µl 10x buffer = NEB 4
  • 12.5 µl pure water

Digestion protocol (AatII, HindIII)

  • 5 µl DNA - pSB1K3 YFP or CFP (clone 4 or 1, respectively)
  • 0.5 µl AatII
  • 0.5 µl HindIII
  • 2 µl 10x buffer = NEB 4
  • 12.5 µl pure water
  • total: 20µl

37°C for 3h

Production of one 1 %

  • 1 % gel: 0.5 g agarose in 50 ml 1x TAE buffer
  • Adding 2 µl gel red to each gel

Loading gels and running

  • Add 4 µl Loading dye to each 20 µl sample
  • 15 µl DNA Ladder Mix
  • Running conditions: 100 V, approx. 45 min

Loading of gels

lane Sample Volume in µl Expected size in bp
1 marker
2 pSB1K3+CFP (clone1), EcoRI, PstI 24 812, 2163
3 pSB1K3+CFP (clone1), XbaI, EcoRI 24 7, 2968
4 pSB1K3+CFP (clone1), AatII, HindIII 24 721, 2254
2 pSB1K3+YFP (clone4), EcoRI, PstI 24 789, 2163
3 pSB1K3+YFP (clone4), XbaI, EcoRI 24 7, 2945
4 pSB1K3+YFP (clone4), AatII, HindIII 24 721, 2231

Result:

300px

Further tasks: repeat the test digest tomorrow


sequencing pARW089 + mutated mdnA

Investigators: Niels,Steffi

Aim: sequencing by eurofins mwg|operon

samples prepared at 06.08.2011

Primer :2 pmol/µl 120 µl

sf_mdnA_1

pARW089 + mutated mdnA (15 µl total)

  • sample ID : 2h
    • 1A-2a - AKM001W020
    • 2A-2a - AKM001W021
    • 3A-2a - AKM001W022
    • 4A-2a - AKM001W023
    • 5A-2a - AKM001W024
  • sample ID : 3h
    • 1A-3a - AKM001W025
    • 2A-3a - AKM001W026
    • 3A-3a - AKM001W027
    • 4A-3a - AKM001W028
    • 5A-3a - AKM001W029

Results (arrived on 2011-08-11):

  • no mutations could be found in mdnA


Assembly PCR of TEV_frag_I and TEV_frag_II

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx


Investigators: Sebastian, Stefan

Aim: Assembly PCR to mutate the EcoRI site


Materials:

  • Primer:
  • 2,5 µLf_TEV_AraFusion_NgoMIV (0.5 µmol stock)
  • 2,5 µLr_TEV_iGEM_BamHI (0.5 µmol stock)
  • 1 µL Fragment TEV I (approx. 2.5 ng)
  • 1 µL Fragment TEV II (approx. 2.5 ng)
  • 5 µL 10x polymerase buffer
  • 5 µL 25 mM MgCl2
  • 1 µL dNTP
  • 0.5 µL T4 polymerase(Fermentas)
  • 18.5 µL H20

Used method:

Program: iGEMMED

  • Denat: 3min 94°C
  • 3x:

Denat: 60sec 94°C

Anneal:60sec 53°C

Extend:60sec 72°C

  • 28x:

Denat: 60sec 94°C

Anneal:60sec 65°C

Extend:60sec 72°C

  • Final Extend: 10min 72°C

Further going:

analytical gel electrophoresis to confirm the correct size of bands


design primer for biobrick - mdnABC,mdnB,mdnC,mdnDE,mdnD,mdnE

Investigators: Katharina, Niels

Aim: design and order primer

Primer sequence

  • pf_mdnABC_EcoRI_NotI_XbaI

GAATTCGCGGCCGCTTCTAGATGGCATATCCCAACGATC

  • pf_mdnB_EcoRI_NotI_XbaI

GAATTCGCGGCCGCTTCTAGATGAAAGAATCGCCTAAAGTTG

  • pf_mdnC_EcoRI_NotI_XbaI

GAATTCGCGGCCGCTTCTAGATGACCGTTTTAATTGTTAC

  • pf_mdnE_EcoRI_NotI_XbaI

CAATCATCATATAACTCCGTAGATCTTCGCCGGCGCTTAAG

  • pf_mdnD_EcoRI_NotI_XbaI

GTCAAAAAGGTCACGAAAGTAGATCTTCGCCGGCGCTTAAG

  • pr_mdnABC_SpeI_NotI_PstI

GAAATCCTAGTTAACTCATAATACTAGTAGCGGCCGCTGCAG

  • pr_mdnE_SpeI_NotI_PstI

CTGCAGCGGCCGCTACTAGTAGATATAAGAGTGGGTAAAATTC

  • pr_mdnDE_SpeI_NotI_PstI

CTGCAGCGGCCGCTACTAGTATCAGCAAACCCTACTTAATTTC

  • pr_mdnB_SpeI_NotI_PstI

GCGATCGCTGATTTTTTAGTTACTAGTAGCGGCCGCTGCAG

ordered my sigma


Ligation of mdnA/GeneIII-fusion gene into pARW089 for phage display and transformation of competent cells(strategy 2)

Investigators: Sandrina, Sabine

Aim:

  • ligation of mdnA-geneIII fusiongene into pARW089 with digested fragments (see 2011-08-07)
  • amplification of generated plasmids by transformation

Time: 10:00-18:00

Method:

  • ligation-samples from 2011-08-07;

Protocol:

  • 5 µl (ca 11 ng) digested vector pARW089 (NarI, AatII)
  • 1 µl (ca 270 ng) fusion gene mdnA/geneIII
  • 2 µl 10x T4 Ligase Buffer
  • 1 µl T4 Ligase
  • 10 µl water

5 h at 16°C and 1 h at room temperature

  • two bands were observed after mdnA-geneIII ligation (red boxes)--> ligation with pARW089 was tried with both bands

transformation:

protocol:

addition of 10 µl ligation reaction to cells (XL1-blue, tet-resistance) in 1.5 ml Eppi,

incubation 25 min on ice,

heat shock 45 sec at 42°C,

incubation 2 min on ice,

addition of 750 µl LB medium,

incubation at 37 °C for 60 min in Eppendorf thermomixer at 750 rpm,

plating on LB medium with 1,5 % agar, 100 µg/ml ampicillin, 100 µg/µl tetracyclin

storage over night at 37°C

Further tasks:
test digestion


58th Labday 2011-08-09

test digest of pSB1K3+YFP or CFP and pSB1A3+YFP or CFP

Time: 2011-08-09,9:00-15:00

Investigators: Nadine, Vanessa, Steffi, Laura

Aim: prove of Insert (CFP or YFP)

Materials:

  • pSB1K3 (clone 1 and 4 from last week ???), pSB1AK (clone 11 and 12 from last week ???)
  • EcoRI, XbaI, HindIII, AatII, HaeII, BglI
  • Buffer 4
  • Buffer 2
  • 100x BSA
  • Agarose broad range (Roth)
  • 1x TAE buffer
  • Gel Red
  • DNA Ladder Mix (Fermentas)
  • 6x Loading Dye (Fermentas)

Digestion protocol (XbaI, EcoRI) (4x)

  • 5 µl DNA - pSB1K3+YFP or CFP (clone 4 or 1, respectively) or pSB1A3+YFP or CFP (clone 12 or 11, respectively)
  • 0.5 µl XbaI
  • 0.5 µl EcoRI
  • 2 µl 10x buffer = NEB 4
  • 12.5 µl pure water

Digestion protocol (AatII, HindIII)

  • 5 µl DNA - pSB1K3 YFP or CFP (clone 4 or 1, respectively) (2x)
  • 0.5 µl AatII
  • 0.5 µl HindIII
  • 2 µl 10x buffer = NEB 4
  • 12.5 µl pure water
  • total: 20µl

Digestion protocol (HaeII, BglI) (4x)

  • 5 µl DNA pSB1A3+YFP or CFP (clone 12 or 11, respectively)
  • 0.5 µl HaeII
  • 0.5 µl BglI
  • 2 µl 10x buffer = NEB 2
  • 0.2 µl 100xBSA
  • 12.3 µl pure water

37°C for 2h

Production of one 1 % agarose gel

  • 1 % gel: 0.5 g agarose in 50 ml 1x TAE buffer
  • Adding 2 µl gel red to each gel

Loading gels and running

  • Add 4 µl Loading dye to each 20 µl sample
  • 15 µl DNA Ladder Mix
  • Running conditions: 100 V, approx. 45 min

Loading of gels

lane Sample Volume in µl Expected size in bp
1 marker
2 pSB1K3+CFP (clone1), not digested 24
3 pSB1K3+CFP (clone1), XbaI, EcoRI 24 7, 2968
4 pSB1K3+CFP (clone1), AatII, HindIII 24 721, 2254
5 pSB1K3+YFP (clone4), XbaI, EcoRI 24 7, 2945
6 pSB1K3+YFP (clone4), AatII, HindIII 24 721, 2231
7 pSB1K3+YFP (clone4), not digested 24
8 pSB1A3+CFP (clone11), not digested 24
9 pSB1A3+CFP (clone11), XbaI, EcoRI 24 15, 2911
10 pSB1A3+CFP (clone11), HaeII, BglI 24 1359, 1567
11 pSB1A3+YFP (clone12), XbaI, EcoRI 24 15, 2888
12 pSB1A3+YFP (clone12), HaeII, BglI 24 765, 924, 1188

Result:

UP AG digest pSB1K3 YFP CFP pSB1A3 YFP CFP 2011-08-09.jpg

Further tasks: repeat from beginning: w/ linearized backbones pSB1K3, pSB1A3 and pSB1T3


Gel purification of amplificated TEV protease

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx


Investigators: Sebastian

Aim: Clean up a pure fraction of TEV protease without iGEM-RS in the nucleotide sequence


Materials:

PCR and gel purification kit purchased by Promega (Wizard SV GEL and PCR Clean-Up System)


Used method:

Done as described in the manual

Results:

NgoMIV_TEV_iGEM_BamHI with a concentration of 6,9 ng/µl

Further going:

Amplification of TEV protease via PCR and digest with BamHI and NgoMIV


Ampilifcation of NgoMIV_TEV_iGEM_BamHI protease via PCR

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx


Investigators: Sebastian, Niels

Aim: Amplification of the TEV protease for digest with BamHI and NgoMIV

Materials:

1 µl Template - NgoMIV_TEV_iGEM_BamHI (6,9 ng/µl)

2,5 µl Primer 1 - f_TEV_AraFusion_NgoMIV (0,5 µM)

2,5 µl Primer 2 - r_TEV_iGEM_BamHI (0,5 µM)

5 µl 10x Reaction Buffer (Fermentas)

1 µl 10 mM dNTP's (Fermentas)

5 µl 25 µM MgCl2

0,5 µl DNA-Polymerase (Fermentas)

32,5 µl water

Used method:

Program: iGEM004

  • Denat: 3min 94°C
  • 30x:

Denat: 60sec 94°C

Anneal:60sec 65°C

Extend:60sec 72°C

  • Final Extend: 10min 72°C

Further going:

PCR-Purification of the amplified DNA-Fragments and digest for ligation


PCR -Purification of amplified NgoMIV_TEV_iGEM_BamHI DNA-Fragements

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx


Investigators: Sebastian

Aim: Clean UP of the amplified fragments

Materials:

PCR-Clean up kit purchased by Promega(Wizard SV Gel and PCR-Up System)

Used method:

As described in the Manual of the kit

Results:

25 µl NgoMIV_TEV_iGEM_BamHI with 68,5 ng/µl

Further going: digest of the fragments and ligation for transformation


Ampilifcation of NgoMIV_TEV_iGEM_BamHI protease via PCR

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx


Investigators: Sebastian

Aim: 2nd amplification of the NgoMIV_TEV_iGEM_BamHI protease for digest with BamHI and NgoMIV

Materials:

1 µl Template - NgoMIV_TEV_iGEM_BamHI (6,9 ng/µl)

2,5 µl Primer 1 - f_TEV_AraFusion_NgoMIV (0,5 µM)

2,5 µl Primer 2 - r_TEV_iGEM_BamHI (0,5 µM)

5 µl 10x Reaction Buffer (Fermentas)

1 µl 10 mM dNTP's (Fermentas)

5 µl 25 µM MgCl2

0,5 µl DNA-Polymerase (Fermentas)

32,5 µl water

Used method:

Program: iGEM005

  • Denat: 3min 94°C
  • 30x:

Denat: 60sec 94°C

Anneal:60sec 63°C

Extend:60sec 72°C

  • Final Extend: 10min 72°C

Further going:

PCR-Purification of the amplified DNA-Fragments and digest for ligation


ELISA to test the anti myc-tag antibodies 9E10


Investigators: Sebastian

Aim: Testing the reactivity of the 9E10 antibody fractions

Method:

Coating of an ELISA (96-well microtiter plate) with 50 µl/well 5 mg/ml FITC-BSA and incubation over night

Blocking of the free binding sites with 50 µl/well PBS-5% NKS 0,0025% phenolred for 1 hour

Incubation with different ScFv tagged with myc (unkown concentration)for 1 hour

  • A1-H4 - anti FITC ScFv
  • A5-H8 - Z6.1 (anti-FITC ScFV)
  • A9-H12 - GST-tagged protein

Incubation with the tracer antibody 9E10 (different fractions in different lines (A-H) for 1 hour

Incubation with goat anti mice antibody labeled with HRP for 1 hour

Addition of the HRP-substrate (1 mg/ml OPD, 0,01 % H2O2, in 0,1 M Na-Citrate Buffer pH 5) for 30 min

Stopping of the reaction with 100 µl/well 1 M H2SO4 and 50 mM Na2SO3

measurement of the wavelength at 490 nm and 690 nm af reference

Materials:

1 µg/ml 9E10 antibody (from different fractions)

0,5 µg/ml 9E10 antibody (from different fractions)

several stock solutions (Blocking Solution, Substrate, PBS-NKS-Phenolred)

Results:

2 active fractions of 9E10 for coulping to column NHS-activated sepharose material

Further Tasks:

Coupling of active antibodies to NHS-activated sepharose for purification of myc-tagged proteins

Preparing linearized backbones pSB1K3, pSB1A3 and pSB1T3 for ligation w/ YFP and CFP

Time: 2011-08-09,15:00-20:00

Investigators: Vanessa, Jessica, Nadine

Motivation: first step of expression backbone creation: digest linearized backbones with EcoRI and PstI

UP Expression backbones idea 2011 08 09.jpg

Materials:

  • pSB1K3, pSB1A3 and pSB1T3
  • EcoRI, PstI
  • Buffer 4
  • 100x BSA
  • DpnI

Protocol:

Digestion protocol (following iGEM distribution protocol for linearized backbones):

  • Mastermix
    • 4 µl NEB Buffer 4
    • 0.4 µl BSA
    • 0.4 µl EcoRI
    • 0.4 µl PstI
    • 0.4 µl DpnI
    • 14.4 µl pure water
      • total: 20 µl
  • reaction mix:
    • 4 µl mastermix + 4 µl linearized backbone (pSB1K3, pSB1A3 or pSB1T3) from distribution
  • Incubation:
    • 37°C for 30 min
  • Heat deactivation:
    • 80°C for 20 min
  • stored in fridge 4°C

Further Task:

  • Digestion of YFP from pGA14mVenusGeneart and CFP from pGA14-Cerulean
  • Ligation of digested linearized backbones from today with digested YFP and CFP (results: pSB1K3+YFP, pSB1T3+YFP, pSB1A2+YFP, pSB1K3+CFP, pSB1T3+CFP, pSB1A2+CFP)
  • Transformation w/ ligation products, NOTE: !!! Don´t use XL1-Blue for pSB1T3+YFP and pSB1T3+CFP!!! Cells contain Tet-R already!!!
  • Picking of colonies
  • over-night cultures for mini-prep
  • mini-prep of over-night cultures
  • test-digest
    • pSB1A3+YFP/CFP:
      • HaeII and BglI (protocol see 2011-8-9), expected: 3 fragments
    • pSB1K3+YFP/CFP
      • HaeII (develop protocol, calculate exact expected bp) expected: 2 fragments
    • pSB1T3+YFP/CFP
      • ClaI and ApaLI (develop protocol, calculate exact expected bp) expected: 3 fragments
    • also: digested, not ligated linearized backbones (pSB1K3, pSB1A3 and pSB1T3)
    • also: undigested pSB1K3+YFP, pSB1T3+YFP, pSB1A2+YFP, pSB1K3+CFP, pSB1T3+CFP, pSB1A2+CFP
  • if test-digest positive: digestion w/ EcoRI and XbaI
  • digestion of PCR products form ??? (Ara, Lac and constitutive promotor)
  • ligation of digested vectors w/digested PCR products from ???? (Ara, Lac and constitutive promotor)(results: pSB1K3+YFP+Ara, pSB1T3+YFP+Ara, pSB1A2+YFP+Ara, pSB1K3+CFP+Ara, pSB1T3+CFP+Ara, pSB1A2+CFP+Ara, pSB1K3+YFP+Lac, pSB1T3+YFP+Lac, pSB1A2+YFP+LAc, pSB1K3+CFP+Lac, pSB1T3+CFP+Lac, pSB1A2+CFP+Lac, pSB1K3+YFP+const, pSB1T3+YFP+const, pSB1A2+YFP+const, pSB1K3+CFP+const, pSB1T3+CFP+const, pSB1A2+CFP+const)
  • test digestion, sequencing


Digestion of YFP from pGA14mVenusGeneart and CFP from pGA14-Cerulean

Time: 2011-08-09,15:00-20:00

Investigators: Jessica, Nadine, Vanessa

Materials:

Preparation for ligation of YFP/CFP (insert) into pSB1A3, pSB1K3 or pSB1T3 (vectors)

Materials:

  • pGA14mVenusGeneart and pGA14-Cerulean
  • EcoRI, PstI
  • Buffer 4
  • 100x BSA

Protocol:

Digestion protocol (following iGEM distribution protocol for linearized backbones):

  • Mastermix
    • 2 µl NEB Buffer 4
    • 0.2 µl BSA
    • 0.2 µl EcoRI
    • 0.2 µl PstI
    • 7.4 µl pure water
      • total: 10 µl
  • reaction mix:
    • 4 µl mastermix + 4 µl 1:2 diluted DNA
  • Incubation:
    • 37°C for 30 min
  • Heat deactivation:
    • 80°C for 20 min
  • YFP dig., 9.8.11, Nad & Jes stored in fridge 4°C
  • CFP dig., 9.8.11, Nad & Jes stored in fridge 4°C


over night culture from PDV089

Investigators: Sandrina

Aim:
control plasmid ligation (pARW089, mdnA, geneIII --> PDV089, strategy 2)


Time: 2011-08-09,16.00-17:00

Materials/Methods:

  • LB-medium with tet and amp
  • cell clones from over night plate
  • incubate over night at 37°C and 750 rpm

Further tasks:

  • plasmid preparation and analytic digestion


Repeated PCR of mdnA for phage display (strategy 1) repeated with new ordered reversed primer and of mdnA with rfc25 restriction sites (strategy 2), gel electrophoresis and purification of PCR products

Investigators: Sandrina

Time: 2011-06-30,11:00-15:00

Aim:

  • amplification of mdnA with SfiI restriction sites (vector pARW089) to clone it into pAk100 bla KDIR
  • amplification of mdnA with rfc25 restriction sites to fuse it with geneIII and clone it into pARW089

Materials/Methods:

see 2011-06-10

changes:

  • program: 123, Thermo Hybrid, PX2

Results:

expected bands (ca. 260 bp for strategy 1 and ca. 230 bp for strategy 2) were observed after gel electrophoresis


further tasks:

digestion of mdnA fragment with sfiI (strategy 1) and NarI and AgeI (strategy 2)


Digestion of mdnA with sfiI over night

Investigators: Sandrina

Time: 2011-08-09,16:30-17:00

Aim:

digestion of apmlificated mdnA to clone it into PAK100 bla KDIR

Materials/Methods:

50 µl sample:

  • 0,2 µl BSA
  • 5 µl 10x Puffer 4
  • 0,5 µl sfiI
  • 40 µl PCR product
  • 4,3 µl H2O

incubation over night at 50°C

further tasks:

ligation with digested PAK100 bla KDIR


design primer for biobrick - redesign of pf_mdnE, pf_mdnD

Investigators: Niels, Nadine

Aim: design and order primer

Primer sequence

  • pf_mdnE_EcoRI_NotI_XbaI

CAATCATCATATAACTCCGTAGATCTTCGCCGGCGCTTAAG

  • pf_mdnD_EcoRI_NotI_XbaI

GTCAAAAAGGTCACGAAAGTAGATCTTCGCCGGCGCTTAAG

ordered my sigma


59th Labday 2011-08-10

Digestion of NgoMIV_iGEM_TEV-Protease_iGEM_BamHI fragments (produced on 09.08.2011) and pJC354-NheI-TEV-Xho_blaFL_GGH5 vector

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Paul

Materials:

NgoMIV_iGEM_TEV_iGEM_BamHI:

  • three samples: one sample produced on 09.08.2011 and already PCR purificated; two samples produced on 09.08.2011 not PCR purificated --> PCR purification of the two unpurificated samples using "NucleoSpin ExtractII"-KIT!

TEVI:67,9ng/µl (2ml eppi in long screening reck)

TEVII:56ng/µl (2ml eppi in long screening reck)

TEVIII:68,5ng/µl (1,5 ml eppi in logn screening reck, eppi named: 2. TEV muta PCR...)

pJC354-NheI-TEV-Xho_blaFL_GGH5 vector (contains TEV cleavage site): 470ng/µl

Digestion protocol:

1: NgoMIV_iGEM_TEV-Protease_iGEM_BamHI (3x, each sample 1x):

  • 20µl NgoMIV_iGEM_TEV-Protease_iGEM_BamHI
  • 1µl NgoMIV
  • 1µl BamHI-HF
  • 5µl 10x buffer = NEB 4
  • 0.5µl 100x BSA
  • 22.5µl pure water
  • =50µl

2: pJC354-NheI-TEV-Xho_blaFL_GGH5 vector (470ng/µl)

  • 3µl pJC354-NheI-TEV-Xho_blaFL_GGH5 vector (contains TEV cleavage site)
  • 1µl HindIII
  • 1µl BamHI-HF
  • 5µl 10x buffer = NEB4
  • 0.5µl 100x BSA
  • 39.5µl pure water
  • =50µl

-->The reaction was allowed to proceed for 2h at 37°C!

Result:

pJC354-NheI-TEV-Xho_blaFL_GGH5 vector:

Expected band: 4700bp --> Excission of band and pruification unsing "NucleoSpin ExtractII"-KIT

UP AG 1% digest pJC354 NheI TEV-Xho blaFL GGH5 vector 20110805.jpg

NgoMIV_iGEM_TEV-Protease_iGEM_BamHI:

Expected bands: 760bp --> Excission of red marked areas and pruification unsing "NucleoSpin ExtractII"-KIT

UP AG 1,5% digest NgoMIV iGEM TEV Protease iGEM BamHI 20110810.jpg

Further tasks:

Triple ligation of digested fragments and HindIII_iGEM_AraC_NgoMIV


Transformation of E. coli XL1-Blue with pGA14mVenusGeneart resp. pGA14-Cerulean

Investigators: Nadine

Aim:Transformation of E. coli XL1-Blue cells with pGA14mVenusGeneart resp. pGA14-Cerulean to produce glycerol stocks for further use if necessary

Time: 2011-08-10, 9:20-?

Materials:

  • pGA14mVenusGeneart resp. pGA14-Cerulean
  • E. coli XL1-Blue cells
  • LB medium

Method:

  • addition of 1 µl plasmid to XL1-blue cells
  • incubation 30 min on ice,
  • heat shock 45 sec at 42°C,
  • incubation 2 min on ice,
  • addition of 750 µl LB medium,
  • incubation 60 min at 37 °C and 750 rpm

  • plating on agar plates containing 100 µg/µl ampicillin
  • storage over night at 37°C

Further tasks:

  • Picking clones for overnight culture
  • Producing glycerol stocks


Agarose Gel of digested pSB1K3, pSB1A3 and pSB1T3 and digested CFP and YFP fragments

Investigators: Jessica, Vanessa, Nadine

Aim:Purification of insert and vector for the first ligation of the expression backbone

Time: 2011-08-10, 9:20-16:00

Materials:

  • digested pSB1K3, pSB1A3 and pSB1T3 from 2011-09-08
  • digested CFP and YFP from 2011-09-08 (YFP dig. and CFP dig., 9.8.11, Nad & Jes)
  • Agarose broad range (Roth)
  • 1x TAE buffer
  • Gel Red
  • DNA Ladder Mix (Fermentas)
  • 6x Loading Dye (Fermentas)

Production of one 1 % agarose gel

  • 2 x 1 % gel: 0.5 g agarose in 50 ml 1x TAE buffer
  • Adding 2 µl gel red to each gel

Loading gels and running

  • Add 1.2 µl Loading dye to each 8 µl sample
  • 12 µl DNA Ladder Mix
  • Running conditions: 110 V, approx. 45 min

Loading of gel 1

  • gel 1: pSB1K3, pSB1A3 and pSB1T3
lane Sample Volume in µl Expected size in bp
M marker 15
1 pSB1A3, EcoRI, PstI 9.2 2114, 41
2 - - -
3 pSB1K3, EcoRI, PstI 9.2 2163, 41
4 - - -
5 pSB1T3, EcoRI, PstI - 2422, 41

Result gel 1:

UP AG digest pSB1X3 2011-08-10 NB.jpg

  • bigger bands appear as expected
  • 41 bp band is to small to appear in the gel
  • gel extraction with Wizard SV Gel and PCR Clean-Up System (Promega):
    • pSB1A3 dig. pur. 10.08.11 Nad & Jes : 9.8 ng/µl
    • pSB1K3 dig. pur. 10.08.11 Nad & Jes : 10.7 ng/µl
    • pSB1T3 dig. pur. 10.08.11 Nad & Jes : 11.3 ng/µl
    • stored in freezer (-20°C), red box: expression backbones

Loading of gel 2

  • gel 2: CFP and YFP
lane Sample Volume in µl Expected size in bp
1 marker
2 from Screening (TEV Vector) 42
3 - --
4 CFP 9.2 771, 2873
5 - - -
6 YFP 9.2 763, 2881

Result gel 2:

UP Ag digest TEV Vector GFP YFP EcoRI PstI 2011-10-08.jpg

  • in lane 4 and 6 are too many bands
  • troubleshooting: it seems that the mastermixes were mixed up! In one mastermix was DpnI. DpnI digests methylated DNA. The vectors are from E. coli and therfore methylated. This could be an explanation for these band patterns.

Further tasks:

  • repeat digest of YFP from pGA14mVenusGeneart and CFP from pGA14-Cerulean


Digestion of YFP from pGA14mVenusGeneart and CFP from pGA14-Cerulean

Time: 2011-08-10,15:00-17:00

Investigators: Vanessa, Jessica, Nadine

Materials:

  • pGA14mVenusGeneart and pGA14-Cerulean
  • EcoRI, PstI
  • Buffer 4
  • 100x BSA

Protocol:

Digestion protocol (following iGEM distribution protocol for linearized backbones):

  • Mastermix
    • 2 µl NEB Buffer 4
    • 0.2 µl BSA
    • 0.2 µl EcoRI
    • 0.2 µl PstI
    • 7.4 µl pure water
      • total: 10 µl
  • reaction mix:
    • 4 µl mastermix + 4 µl DNA (not diluted!!!)
  • Incubation:
    • 37°C for 30 min
  • Heat deactivation:
    • 80°C for 20 min
  • YFP dig., 10.8.11, Van & Jes stored in fridge 4°C
  • CFP dig., 10.8.11, Van & Jes stored in fridge 4°C


Miniprep of E. coli overnight culture containing pPDV089

Investigators: Sandrina, Sabine

Aim: purification of pPDV089 for test digestion and sequencing (15 clones)

Time: 10:00-13:00

Method/Materials: see protocol 5.1 of the NucleoSpin Plasmid Kit

Further tasks: test digestion

Test digestion of ligations for strategy 2 after Plasmid preperation

Investigators: Sabine, Sandrina

Aim:control if liagation of geneIII and mdnA into pARW089 (strategy 2) worked

Time: 14:00-16:00

Materials/Methods:

Strategy 2:

  • 0,5 µl XbaI
  • 0,5 µl SpeI
  • 2 µl 10x buffer 4 (NEB)
  • 0,2 µl BSA
  • 10 µl vector DNA
  • 12,8 µl H2O

incubate for 1 h at 37°C


Results:

  • expected size for all samples: strategy 2: ca. 5000 bp, 4000 bp, 600 bp and 200
  • three different pARW089 vectors (1,2,3) were used for ligation, they were digested with the same enzymes but this was done from three different persons
  • after digestion of geneIII PCR product with AatII and NgoMIV two bands were seen after gel electrophoresis, ligations were done with both samples (called here: "upper band" and "lower band")

Loading of gels

lane Sample Volume in µl Expected size in bp
M marker, DNA ladder mix Fermentas
1 free
2 vector 1, upper band, clone 1 20 ca. 5000, 4000, 600, 200
3 vector 1, upper band, clone 2 20 ca. 5000, 4000, 600, 200
4 vector 1, upper band, clone 3 20 ca. 5000, 4000, 600, 200
5 vector 1, lower band, clone 1 20 ca. 5000, 4000, 600, 200
6 vector 1, lower band, clone 2 20 ca. 5000, 4000, 600, 200
7 vector 1, lower band, clone 3 20 ca. 5000, 4000, 600, 200
8 free
9 vector 2, upper band, clone 1 20 ca. 5000, 4000, 600, 200
10 vector 2, upper band, clone 2 20 ca. 5000, 4000, 600, 200
11 vector 2, upper band, clone 3 20 ca. 5000, 4000, 600, 200
12 vector 2, lower band, clone 1 20 ca. 5000, 4000, 600, 200
13 vector 2, lower band, clone 2 20 ca. 5000, 4000, 600, 200
14 vector 2, lower band, clone 3 20 ca. 5000, 4000, 600, 200
15 free
16 vector 3, upper band, clone 1 20 ca. 5000, 4000, 600, 200
17 vector 3, upper band, clone 2 20 ca. 5000, 4000, 600, 200
18 vector 3, upper band, clone 3 20 ca. 5000, 4000, 600, 200

350px

Further tasks:

  • sequence clones 12, 13 and 17


cultivation of cells containing pAK100 bla KDIR from E. coli glycerol stocks

Investigators: Sabine, Sandrina

Aim: cultivate cells conatining pAK100 bla KDIR (vector) to purify it and use it for phage display.


Time: 2011-06-14,16:00-17.30

Materials/Methods:

  • glycerol stock nr. 15, pAK100 bla KDIR, XL1-blu, 2003-07-31
  • LB-medium with chloramphenicol (1:1000)

Further tasks:
plasmid preperation und digestion with SfiI


60th Labday 2011-08-11

Agarose Gel digested CFP and YFP fragments (from 2011-08-10)

Investigators: Jessica, Nadine, Vanessa

Aim:Purification of YFP and CFP fragment

Time: 2011-08-11, 8:00-11:00

Materials:

  • digested CFP and YFP from 2011-09-08 (YFP dig. and CFP dig., 10.8.11, Van & Jes)
  • Agarose broad range (Roth)
  • 1x TAE buffer
  • Gel Red
  • DNA Ladder Mix (Fermentas)
  • 6x Loading Dye (Fermentas)

Production of one 1 % agarose gel

  • 1 % gel: 0.5 g agarose in 50 ml 1x TAE buffer
  • Adding 2 µl gel red to each gel

Loading gels and running

  • Add 1.2 µl Loading dye to each 8 µl sample
  • 12 µl DNA Ladder Mix
  • Running conditions: 100 V, approx. 45 min

Loading of gel

  • gel: CFP and YFP
lane Sample Volume in µl Expected size in bp
1 marker 10
2 - - -
3 CFP 9.2 771, 2873
4 - --
5 YFP 9.2 763, 2881
6 - - -

Result:

UP AG digest pGA14 2011-08-11 VB.jpg

  • bands appear as expected
  • lower bands (red box) in lane 3 and 4 were excised and DNA was extracted w/ Wizard SV Gel and PCR Clean-Up System (Promega):
    • CFP dig. pur. Jes & VB 11.8.2011, 5.7 ng/µl
    • YFP dig. pur. Jes & VB 11.8.2011, 5.4 ng/µl
    • stored in freezer (-20°C), red box: expression backbones

Further tasks:

  • ligation of digested and purified YFP and CFP with digested and purified pSB1A3, pSB1K3 and pSB1T3


Ligation of digested and purified CFP and YFP fragments (from 2011-08-11) w/ digested and purified pSB1A3, pSB1K3, pSB1T3 (from 2011-08-10)

Investigators: Nadine, Vanessa, Jessica

Aim:Ligation

Time: 2011-08-11, 11:00-14:30

Materials:

  • T4 Ligase
  • 10x T4 Ligase buffer
  • inserts
    • CFP dig. pur. Jes & VB 11.8.2011, 5.7 ng/µl
    • YFP dig. pur. Jes & VB 11.8.2011, 5.4 ng/µl
  • vectors:
    • pSB1A3 dig. pur. 10.08.11 Nad & Jes : 9.8 ng/µl,
    • pSB1K3 dig. pur. 10.08.11 Nad & Jes : 10.7 ng/µl
    • pSB1T3 dig. pur. 10.08.11 Nad & Jes : 11.3 ng/µl
    • pure sterile water

Protocols

  • to calculate the volumes http://old.gibthon.org/ was used

pSB1K3 (Volumes in µl)


lane CFP YFP Control
10x T4 ligase buffer 1 11
T4 ligase 1 1 1
vector 2.7 2.6 2.6
insert 5.3 5.4-
water - - 5.4

pSB1A3 (Volumes in µl)


lane CFP YFP Control
10x T4 ligase buffer 1 11
T4 ligase 1 1 1
vector 2.8 2.8 2.8
insert 5.2 5.2-
water - - 5.2

pSB1T3 (Volumes in µl)


lane CFP YFP Control
10x T4 ligase buffer 1 11
T4 ligase 1 1 1
vector 2.6 2.5 2.5
insert 5.4 5.5-
water - - 5.5
  • Incubation: 2 hrs at room temperature

Result:

  • pSB1A3+YFP, lig, VB, 11.8.2011
  • pSB1A3+CFP, lig, VB, 11.8.2011
  • pSB1A3+control, lig, VB, 11.8.2011
  • pSB1K3+YFP, lig, VB, 11.8.2011
  • pSB1K3+CFP, lig, VB, 11.8.2011
  • pSB1K3+control, lig, VB, 11.8.2011
  • pSB1A3+YFP, lig, VB, 11.8.2011
  • pSB1A3+CFP, lig, VB, 11.8.2011
  • pSB1A3+control, lig, VB, 11.8.2011
  • pSB1T3+YFP, lig, VB, 11.8.2011
  • pSB1T3+CFP, lig, VB, 11.8.2011
  • pSB1T3+control, lig, VB, 11.8.2011
    • all stored in freezer (-20°V in red box: expression backbone)

Further tasks:

  • Transformation in XL1-blue, except for pSB1T3+YFP/CFP: here use RV308


Ligation of NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI or NgoMIV_iGEM_TEV-Protease_iGEM_BamHI, HindIII_iGEM_AraC_NgoMIV into pJC354-NheI-143C-Xho_blaFL_GGH5 or pJC354-NheI-TEV-Xho_blaFL_GGH5 vector

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Paul, Sebastian

Aim:

  • 1. Triple-ligation of NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI (573bp), HindIII_iGEM_AraC_NgoMIV (1273bp) and pJC354-NheI-143C-Xho_blaFL_GGH5 vector (~4700bp) to create pUP_SG2_TorA_CS-PreSiccion_bla_AraC-PreSiccion
  • 2.Triple-ligation of NgoMIV_iGEM_TEV_iGEM_BamHI (760bp), HindIII_iGEM_AraC_NgoMIV (1273bp) and pJC354-NheI-TEV-Xho_blaFL_GGH5 vector (~4700bp)to create pUP_SG1_TorA_CS-TEV_bla_AraC-TEV

Calculation of volumes to be used with: [http://www.gibthon.org/ligate.html ligation calculator] with 1:1 molar ratio


Materials:

PreSciccion: 2 reaction batches (we have two digested pJC354-NheI-143C-Xho_blaFL_GGH5 vector fractions)

1:

  • 2 µL NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI fragment (573bp, 3.2ng/µl)
  • 1,5 µL AraC fragment
  • 4,5 µL pJC354-NheI-143C-Xho_blaFL_GGH5 vector (8.3ng/µl)
  • 1 µL T4 liagtion buffer (Fermentas)
  • 1 µL T4 ligase (Fermentas)
  • =10µl

2:

  • 1,2 µL NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI (573bp, 3.2ng/µl) fragment
  • 0,8 µL AraC fragment
  • 6 µL pJC354-NheI-143C-Xho_blaFL_GGH5 vector (6.7ng/µl)
  • 1 µL T4 liagtion buffer (Fermentas)
  • 1 µL T4 ligase (Fermentas)
  • =10µl
  • 2 controls: As 1 and 2 but with water instead of fragment

TEV: 3 reaction batches (we have three digested NgoMIV_iGEM_TEV-Protease_iGEM_BamHI fragment fractions)

1:

  • 0.8 µL NgoMIV_iGEM_TEV-Protease_iGEM_BamHI fragment (760bp, 18.5ng/µl) (TEVI, see 10.08.2011)
  • 2,6 µL AraC fragment
  • 4,6 µL pJC354-NheI-TEV-Xho_blaFL_GGH5 vector (19.4ng/µl)
  • 1 µL T4 liagtion buffer (Fermentas)
  • 1 µL T4 ligase (Fermentas)
  • =10µl

2:

  • 1.1 µL NgoMIV_iGEM_TEV-Protease_iGEM_BamHI fragment (760bp, 12.5ng/µl) (TEVII, see 10.08.2011)
  • 2,5 µL AraC fragment
  • 4,4 µL pJC354-NheI-TEV-Xho_blaFL_GGH5 vector (19.4ng/µl)
  • 1 µL T4 liagtion buffer (Fermentas)
  • 1 µL T4 ligase (Fermentas)
  • =10µl

3:

  • 0.7 µL NgoMIV_iGEM_TEV-Protease_iGEM_BamHI fragment (760bp, 20.4ng/µl) (TEVIII, see 10.08.2011)
  • 2,6 µL AraC fragment
  • 4,7 µL pJC354-NheI-TEV-Xho_blaFL_GGH5 vector (19.4ng/µl)
  • 1 µL T4 liagtion buffer (Fermentas)
  • 1 µL T4 ligase (Fermentas)
  • =10µl
  • 1 control: As 2 but with water instead of fragment

Used method:

ligation at room temperatur for 1h

Further going:Transformation of XL1blue cells with ligation products


Transformation of E. Coli XL1 Blue Cells with ligation products (NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI or NgoMIV_iGEM_TEV-Protease_iGEM_BamHI, HindIII_iGEM_AraC_NgoMIV into pJC354-NheI-143C-Xho_blaFL_GGH5 or pJC354-NheI-TEV-Xho_blaFL_GGH5 vectors)

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx


Investigators:Paul, Sascha

Aim:transform the ligation into E. coli XL1 blue

Materials:

8x XL1 blue cells from -80 stock, 2x PreSciccion-ligations + 2x controls ; 3x TEV-ligations + 1x control

protocol:

  • Taw cells on ice
  • addition of 10 µl ligation reaction to cells (XL1-blue, tet-resistance, 60µl) in 2 ml Eppi,
  • incubation 25 min on ice,
  • heat shock 45 sec at 42°C,
  • incubation 2 min on ice,
  • addition of 750 µl LB medium,
  • incubation at 37 °C for 60 min in Eppendorf thermomixer at 600 rpm
  • plating on LB medium with 1,5 % agar, 100 µg/ml chloramphenicol,
  • storage over night at 37°C

Results

No colonies in case of PreSciccion Protease, no colonies in controls of PreSciccion

Tev: three colonies on each plate, including control plate

UP 2011-08-12 pJC354 bla-TEVCS-torA AraC TEV XL1 Blue sascha.jpg

UP 2011-08-12 pJC354 bla-TEVCS-torA AraC TEV XL1 Blue sascha2.jpg

Further tasks

Picking colonies, making precultures and colony-PCRs and isolation/sequencing of pUP_SG1_TorA_CS-TEV_bla_AraC-TEV


Transformation

Time: 2011-8-11, 14:30 - 17:30

Investigators: Vanessa, Jessica, Nadine, Niels

Material:

  • pSB1A3+YFP, lig, VB, 11.8.2011
  • pSB1A3+CFP, lig, VB, 11.8.2011
  • pSB1A3+control, lig, VB, 11.8.2011
  • pSB1K3+YFP, lig, VB, 11.8.2011
  • pSB1K3+CFP, lig, VB, 11.8.2011
  • pSB1K3+control, lig, VB, 11.8.2011
  • pSB1A3+YFP, lig, VB, 11.8.2011
  • pSB1A3+CFP, lig, VB, 11.8.2011
  • pSB1A3+control, lig, VB, 11.8.2011
  • pSB1T3+YFP, lig, VB, 11.8.2011
  • pSB1T3+CFP, lig, VB, 11.8.2011
  • pSB1T3+control, lig, VB, 11.8.2011
  • 6 x XL1-blue cells (competent) for pSB1A3 and pSB1K3 variants
  • 3 x RV380 cells (competent) for pSB1T3 variants

Method:

  • addition of 2 µl ligation reaction to XL1-blue cells or RV380 cells
  • incubation 25 min on ice,
  • heat shock 45 sec at 42°C,
  • incubation 2 min on ice,
  • addition of 750 µl LB medium,
  • incubation 60 min at 37 °C and 750 rpm
  • plating on agar plates containing 100 µg/ml tetracyclin
  • plating on agar plates containing 100 µg/ml kanamycin
  • plating on agar plates containing 100 µg/µl ampicillin
  • incubation over night at 37°C

NOTE:

  • pSB1T3+YFP/CFP have the same label; we have to check the insert with test digestion

Further tasks:
control cell clones tomorrow morning


Repeated PCR gene III for phage display (strategy 2)

Investigator: Sabine

Time: 2011-08-11,1:00-12:30

Aim:

  • amplificate GeneIII with NgoMIV and AatII restriction sites (strategy 2)

Primer:

  • primer: pf_geneIII_NgoMIV_XbaI_myc and pr_geneIII_iGEM_AatII (geneIII, strategy 2)

Reaction Components:

  • 5 µl pak100blaKDIR
  • 0,25 µl Taq Polymerase S (BioScience)
  • 1 µl dNTPs
  • 1 µl per primer
  • 5 µl 10x PCR Buffer S
  • 37,75 µl DNase free water

Purification:

  • NucleoSpin Extract II

Further tasks:

  • digestion


Miniprep of E. coli overnight culture containing pakblaKDIR

Investigators: Sabine

Aim: purification of pakblaKDIR

Time: 10:00-11:00

Method/Materials: see protocol 5.1 of the NucleoSpin Plasmid Kit

Further tasks:

  • digestion with Sfi (strategy I)
  • PCR of geneIII (strategy II)


digestion of pak blaKDIR (strategy 1)

Investigator: Sandrina, Sabine

Aim: ligation of digested mdnA into pak blaKDIR to get phage display vector pPDV100 (strategy I)


Time: 2011-08-11, 11:00-14:00

reaction components:

  • 15 µl pak blaKDIR (ca 1 µg)
  • 2 µl NEB 10x buffer
  • 0,2 µl 100x BSA
  • 1 µl restriction enzyme SfiI
  • 1,8 µl water

reaction conditions:

  • 3 h, 37°C


sending clone 12, 13 and 17 from ligation strategy 2 (see 2011-08-10) to MWG for sequencing

Investigators: Sandrina, Sabine

Time: 2011-8-11, 12:00 - 15:00

Aim: get sequence of generated phage display vector pPDV089 (strategy 2) to control the ligation of digested pARW089 with digested mdnA and gene III

Method/Materials:

  • 50-100 ng DNA in 15 µl sample
  • used primer: sf_mdna_1 (nr. 6)

Further tasks:

perform alignment


Gel electrophoresis of digested PAK100 bla KDIR vector(strategy 1) and PCR of geneIII

Investigators: Sandrina

Aim:Purification of PAK100 bla KDIR (strategy 1) and analysis if PCR worked

Time: 2011-08-11,15:00-16:30

Materials/Methods:

  • Agarose broad range (Roth)
  • 1x TAE buffer
  • Gel Red
  • digested vector PAK100 bla KDIR
  • DNA Ladder Mix(Fermentas)
  • 6x Loading Dye (Fermentas)

Method:

1. Production of a 1 % agarose gel

  • adding 2 µl gel red

2. Run

  • 100 V
  • time: 00:45 h

Results:

lane Sample Volume in µl Expected size in bp
M marker
1 geneIII PCR 5 ca. 400
2 digested PAK100 bla KDIR vector 30 ca. 5500, 800

250 px

one band was cutted out of the gel for purifacation


Further tasks:

ligation of mdnA with pAK100 bla KDIR


ligation of mdnA into pak100blaKDIR (stategy 1)

Investigator: Niels, Sandrina

Aim: generate phage display vector pPDV100 (strategy 1)

Time: 2011-07-20,16:30-18:00

Method/Materials:

  • 3 µl (ca 90 ng) Sfi-digested vector pak100
  • 1 µl (ca 1000 ng) Sfi-digested PCR fragment mdnA from over night digested sample (2011-08-09)
  • 2 µl 10x T4 Ligase Buffer
  • 1 µl T4 Ligase
  • 13 µl water
  • incubate over night at 14°C

Further Tasks: transformation of competent cells


61th Labday 2011-08-12

Ligation of NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI or NgoMIV_iGEM_TEV-Protease_iGEM_BamHI with HindIII_iGEM_AraC_NgoMIV

Investigators: Sebastian, Paul

Aim:

1. Ligation of NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI (573bp) and HindIII_iGEM_AraC_NgoMIV (1273bp)

2. Ligation of NgoMIV_iGEM_TEV_iGEM_BamHI (760bp) and HindIII_iGEM_AraC_NgoMIV (1273bp)

3. Amplification of ligated fragments via PCR

Calculation of volumes to be used with: [http://www.gibthon.org/ligate.html ligation calculator] with 1:1 molar ratio

Materials:

1:

  • 4.3 µL NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI fragment (573bp, 3.2ng/µl)
  • 3.7 µL AraC fragment
  • 1 µL T4 liagtion buffer (Fermentas)
  • 1 µL T4 ligase (Fermentas)
  • =10µl

2:

  • 1.1 µL NgoMIV_iGEM_TEV-Protease_iGEM_BamHI fragment (760bp, 18.5ng/µl) (TEVI, see 10.08.2011)
  • 4 µL AraC fragment
  • 2.9 µL pure water
  • 1 µL T4 liagtion buffer (Fermentas)
  • 1 µL T4 ligase (Fermentas)
  • =10µl

Used method:

ligation at room temperatur for 1h

3:

  • 10µl of ligation reaction batch
  • 1µl dNTP
  • 2.5µl of primer1
  • 2.5µl of primer2
  • 5µl 25mM MgCl2
  • 5µl Amplification Buffer 10x (genaxxon)
  • 0.5µl Taq-Polymerase (genaxxon)

Primer:

TEV+AraC:

r_Tev_iGEM_BamHI

f_AraC_HindIII_iGEM

Pre+AraC:

r_PreSciccion_iGE´M_BamHI

f_AraC_HindIII_iGEM

Used method:

  • Initial Denat: 3min 94°C
  • 25x
  • Denat: 2.02min 94°C
  • Anneal: 2.02min 70°C
  • Extension: 2.02min 72°C
  • final extension: 10min 72°C

Results:

No results, no expected bands were visible

Further Tasks:

resolving of PCR products on preparative 1% agarose gel and exciccion of correspoinding bands (1:~1800bp, 2:~2000bp)

File:UP AG 1% 2011-08-12 prep-TEV AraC.jpg

Colony PCR of TEV clones obtained from transformation

Stefan, Sebastian

Aim:

get a positive clone


Materials:

  • Primer:
    • f_AraC_HindIII_iGEM
    • r_TEV_iGEM_BamHI


  • 2.5 µL forward Primer (25 pmol)
  • 2.5 µL reverse Primer (25 pmol)
  • 5 µL 10x Polymerase buffer (Genaxxiom)
  • 5 µL MgCL2
  • 1 µL dNTPs
  • 0.5 µL Taq Polymerase (Genaxxiom)
  • 33.5 µL H20

10 colonies were picked

Used method:

  • Initial Denat: 3 min 94°C
  • 25x
  • Denat: 2.02 min 94°C
  • Anneal: 2.02 min 70°C
  • Extension: 2.02 min 72°C
  • final extension: 10min 72°C

Further Tasks:

gel electrophoresis of PCR products 1% agarose gel of corresponding bands (1:~1800bp, 2:~2000bp)


Results of Transformation from 2011-8-11 and Overnight Cultures of marked colonies

Time: 2011-8-12, 9:00-9:30

Investigators : Jessica, Nadine, Katharina

Aim: check Transformation

Results:

UP Trafo plates pSB1X3 YFP CFP 2011-08-12.png

Preparing Overnight Cultures of marked colonies

Time: 2011-8-12, 18:00-18:30

Investigators : Jessica

Materials/Method:

  • 5 ml LB-Medium with 5 µl antibiotic (either Tet, Amp or Kan)
  • cultures:
    • pSB1T3+YFP I clone I 12.08.11 Jes, pSB1T3+YFP I clone II 12.08.11 Jes, pSB1T3+YFP I clone III 12.08.11 Jes
    • pSB1K3+YFP clone I 12.08.11 Jes, pSB1T3+YFP clone II 12.08.11 Jes, pSB1T3+YFP clone III 12.08.11 Jes
    • pSB1K3+CFP clone I 12.08.11 Jes, pSB1T3+CFP clone II 12.08.11 Jes, pSB1T3+CFP clone III 12.08.11 Jes
    • pSB1A3+CFP clone I 12.08.11 Jes, pSB1A3+CFP clone II 12.08.11 Jes

Further Task:

  • repeat Transformation of pSB1T3+YFPII and pSB1A3+YFP
  • do miniprep of overnight cultures and confirm insert by digest (see 2011-08-09)

Transformation of generated pPDV100 from over night ligation (strategy 1)

Investigators: Sabine, Sandrina

Aim:amplification of pPDV100

Time: 10:00-12:00

Method:

  • addition of 10 µl ligation reaction to XL1-blue cells
  • incubation 25 min on ice,
  • heat shock 45 sec at 42°C,
  • incubation 2 min on ice,
  • addition of 750 µl LB medium,
  • incubation 60 min at 37 °C and 750 rpm
  • plating on agar plates containing 100 µg/ml tetracyclin and 100 µg/µl ampicillin
  • storage over night at 37°C

Further tasks:
control cell clones through test digestion with sfiI


Repeated PCR gene III for phage display (strategy 2)

Investigator: Sandrina, Sabine

Time: 2011-08-12,12:30-17:00

Aim:

  • amplificate GeneIII with NgoMIV and AatII restriction sites (strategy 2)

Primer:

  • primer: pf_geneIII_NgoMIV_XbaI_myc and pr_geneIII_iGEM_AatII (geneIII, strategy 2)

Reaction Components:

  • 5 µl pak100blaKDIR
  • 0,25 µl Taq Polymerase S (BioScience)
  • 1 µl dNTPs
  • 1 µl per primer
  • 5 µl 10x PCR Buffer S
  • 37,75 µl DNase free water

Purification:

  • NucleoSpin Extract II

Further tasks:

  • digestion with AatII and NgoMIV


Miniprep of overnight cultures of Cerulean and mVenus Geneart

Investigators: Katharina

Time: 2011-08-12, 9:00-10:00

Aim:

1. Miniprep:

  • 2 overnight cultures
  • NucleoSpin® Plasmid (NoLid) (Macherey-Nagel)
    • Protocol for high-copy plasmids
    • elution with 30 µl H2O
  • measuring concentration with NanoDrop:
Sample concentration in ng/µl
Cerulean 530.1
mVenus Geneart 573.6
  • stored in -20°C (red box, expression backbones)

2. Preparation of glycerol stocks:

  • adding 300 µl glycerol to 700 µl culture

gel electrophoresis of colony PCR(TEV)

Investigators: Sascha, Paul, Sebastian

Aim:
screen for positiv clone

Result:

Gel electrophoresis of PCR products (5µl) on 1.5% and agarose gels, respectively.

Expected band (AraC + TEV): ~ 2000 bp.

One positive clone TEV 3 III.

600px


Set up a pre-culter of clon TEV 3 III.

Further tasks:

Stock culture, plasmid preparation

Transformation of pSB1A3+YFP in XL1-Blue and pSB1T3+YFPII in RV308

Investigators: Katharina

Aim: Transformation of Ligations

Time: 2011-08-12, 10:00-13:00

Materials:

  • competent E. coli cells (XL1-Blue and RV308, respectively)
  • ligation products: pSB1A3+YFP, lig, VB, 11.8.2011 and pSB1T3+YFP II, lig, VB, 11.8.2011


Method:

  • addition of 2 µl ligation reaction to cells (XL1-blue, RV) in 1.5 ml Eppi,
  • incubation 25 min on ice,
  • heat shock 45 sec at 42°C,
  • incubation 5 min on ice,
  • addition of 750 µl LB medium,
  • incubation at 37 °C shaking for 80 min,
  • plating on LB medium with appropriate antibiotic (Amp and Tet,respectively
  • storage over night at 37°C


  • 2 plates: pSB1T3+YFP II Jes and pSB1A3+YFP Jes

Further tasks:

  • Picking clones for overnight culture
  • Producing glycerol stocks


Design and ordering of primers to produce BioBricks of the mdn genes

Investigators: Jessica, Nadine, Katharina

Time: 2011-08-12, 11:00-14:00

Materials:

  • Geneious

Results:

  • pf_mdnABC_EcoRI_NotI_XbaI 12.08. : TTAATGAATTCGCGGCCGCTTCTAGATGGCATATCCCAACGATC
  • pf_mdnB_EcoRI_NotI_XbaI 12.08.: ATTATGAATTCGCGGCCGCTTCTAGATGAAAGAATCGCCTAAAGTTG
  • pf_mdnC_EcoRI_NotI_XbaI 12.08.: TATTTGAATTCGCGGCCGCTTCTAGATGACCGTTTTAATTGTTAC
  • pf_mdnD_EcoRI_NotI_XbaI 12.08.: TATATGAATTCGCGGCCGCTTCTAGATGAAAGCACTGGAAAAACTG
  • pf_mdnE_EcoRI_NotI_XbaI 12.08.: TAAATGAATTCGCGGCCGCTTCTAGATGCCTCAATATACTACTAAAC
  • pr_mdnABC_SpeI_NotI_PstI 12.08.: ATTTCTGCAGCGGCCGCTACTAGTATTATGAGTTAACTAGGATTTC
  • pr_mdnB_SpeI_NotI_PstI 12.08.: TAATCTGCAGCGGCCGCTACTAGTAACTAAAAAATCAGCGATCGC
  • pr_mdnD_SpeI_NotI_PstI 12.08.: ATTTCTGCAGCGGCCGCTACTAGTATCAGCAAACCCTACTTAATTTC
  • pr_mdnE_SpeI_NotI_PstI 12.08.: ATTTCTGCAGCGGCCGCTACTAGTACTATATTCTCACCCATTTTAAG

Further tasks:

  • develop PCR program
  • PCR


62th Labday 2011-08-13

Mini-Prep of pUP_SG1_ssTorA_CS-TEV_bla_AraC-TEV and creation of glycerol stock culture

Investigator: Sebastian

Aim:

  • Isolation of created plasmid pUP_SG1_ssTorA_CS-TEV_bla_AraC-TEV and establishing of an E. coli Xl1 blue glycerol stock culture for later use

Materials:

  • Overnight culture of E. coli XL1 Blue transformed with pUP_SG1_ssTorA_CS-TEV_bla_AraC-TEV plasmid
  • NucleoSpin Plasmid (NoLid) Kit purchased by Macherey-Nagel

Method:

preparing the stock culture

  • 350 µl sterile glycerol where mixed with 350 µl form the overnight culture of E. coli XL1 blue transformed with plasmid

pUP_SG1_ssTorA_CS-TEV_bla_AraC-TEV, vortexed and stored at -80°C (stock number: G1)

Mini-prep of pUP_SG1_ssTorA_CS-TEV_bla_AraC-TEV


  • preparation was performed as described in the manual of the used Kit

Results:

  • glycerol stock culture G1: E. coli (XL1 blue) transformed with pUP_SG1_ssTorA_CS-TEV_bla_AraC-TEV
  • isolated plasmid pUP_SG1_ssTorA_CS-TEV_bla_AraC-TEV

Further Tasks:

  • sequencing of the plasmid pUP_SG1_ssTorA_CS-TEV_bla_AraC-TEV
  • growth test for the stock culture at different conditions (with induction by IPTG and arabinose at increasing ampicillin concentrations) --> "survival test"
  • preparing of competent cells, which are transformed with pUP_SG1_ssTorA_CS-TEV_bla_AraC-TEV

Miniprep of pSB1X3 + Y (X - A/T/K ; Y - YFP/CFP)

Investigators: Niels

Aim: isolate plasmid of pSB1X3 + Y (X - A/T/K ; Y - YFP/CFP)

Material: 5 ml / over night culture

  • pSB1T3+YFP I clone I 12.08.11 Jes
  • pSB1T3+YFP I clone II 12.08.11 Jes
  • pSB1T3+YFP I clone III 12.08.11 Jes
  • pSB1K3+YFP clone I 12.08.11 Jes
  • pSB1T3+YFP clone II 12.08.11 Jes
  • pSB1T3+YFP clone III 12.08.11 Jes
  • pSB1K3+CFP clone I 12.08.11 Jes
  • pSB1T3+CFP clone II 12.08.11 Jes
  • pSB1T3+CFP clone III 12.08.11 Jes
  • pSB1A3+CFP clone I 12.08.11 Jes
  • pSB1A3+CFP clone II 12.08.11 Jes

<b>Method:

  • NucleoSpin® Plasmid (NoLid) (Macherey-Nagel)
    • Protocol for high-copy plasmids
    • elution with 50 µl elution buffer2O

Check concentration with NanoDrop

  • pSB1T3+YFP I clone I 12.08.11 Jes 10,3 ng/µl
  • pSB1T3+YFP I clone II 12.08.11 Jes 16,6 ng/µl
  • pSB1T3+YFP I clone III 12.08.11 Jes 24,2 ng/µl
  • pSB1K3+YFP clone I 12.08.11 Jes 29,7 ng/µl
  • pSB1K3+YFP clone II 12.08.11 Jes 22,9 ng/µl
  • pSB1K3+YFP clone III 12.08.11 Jes 25,7 ng/µl
  • pSB1K3+CFP clone I 12.08.11 Jes 23,4 ng/µl
  • pSB1K3+CFP clone II 12.08.11 Jes 37,6 ng/µl
  • pSB1K3+CFP clone III 12.08.11 Jes 27,8 ng/µl
  • pSB1A3+CFP clone I 12.08.11 Jes 5,8 ng/µl
  • pSB1A3+CFP clone II 12.08.11 Jes 21,7 ng/µl

<b>NOTE:

  • pSB1T3+YFP/CFP have the same label; we have to check the insert with test digestion

Further tasks:

  • digest


63th Labday 2011-08-14

Repeated PCR of mdnA and gene III for phage display (strategy 1+2)

Investigator: Sandrina, Sabine

Time: 2011-08-14,11:00-14:00

Aim:

  • amplification of mdnA with SfiI restriction sites (strategy 1)
  • amplification of mdnA with NarI and AgeI restriction sites (strategy 2)
  • amplification of GeneIII with NgoMIV and AatII restriction sites (strategy 2)
  • 5 PCRs of every gene for testing different digestion and ligation conditions

Primer:

  • primer 31 and 56: pf_sfi-mdnA_2 and pr_sfi_mdnA_myc-2 (mdnA, strategy 1)
  • primer 19 and 32: pf_mdnA_iGEM_EheI and pr_mdnA_iGEM_AatII (mdnaA, strategy 2)
  • primer 54 and 55: pf_geneIII_NgoMIV_XbaI_myc and pr_geneIII_iGEM_AatII (geneIII, strategy 2)

Reaction Components:

  • 2 µl (ca 16 ng) Vector pARW089 (mdnA) or pakblaKDIR (geneIII)
  • 0,25 µl Taq Polymerase S (BioScience)
  • 1 µl dNTPs
  • 1 µl per primer
  • 5 µl 10x PCR Buffer S
  • 39,75 µl water

PCR condition changes for geneIII:

  • higher annealing temperature: 60°C
  • Stage 1: only 10 cycles (instead of 15)


  • purification of PCR fragments with QIAquick Gel Extraction Kit (250)

Further tasks:

  • digestion

Results:

PCRs of mdnA and mdnA were ok, PCR of geneIII: only oligo band


digestion of pak blaKDIR (strategy 1)

Investigator: Sandrina, Sabine

Aim: cut geneIII out of pak100 blaKDIR to use it as template for PCR of geneIII


Time: 2011-08-14, 12:00-15:00

reaction components:

  • 5 µl pak blaKDIR (ca 350 ng)
  • 2 µl NEB 10x buffer 2
  • 1 µl restriction enzyme AvaI
  • 1 µl restriction enzyme HindIII
  • 11 µl water

reaction conditions:

  • 3 h, 37°C


overnight culture of 10 picked clones of XL blue cells transformed with pPDV100

Investigators: Sandrina, Sabine

Aim: amplification and purification of generated phage display vector pPDV100 for test digestion and sequencing

Time: 16:00-16:30

Method/Materials:

5 ml LB medium per clone containining 100 µg/ml chloramphenicol

storage over night at 37°C and 800 rpm

Further tasks:

plasmid preparation, test digestion and sequencing

generate over night culture of

Investigators: Niels

Aim: generate a over night culture for isolating the plasmid

Material:

  • 5 ml LB Medium
  • 5 µl ampicilin (20 mg/ml)
  • plate pSB1A3+YFP
    • clone I 12.08.11 Jes
    • clone II 12.08.11 Jes
    • clone III 12.08.11 Jes

further tasks

  • isolation of plasmid
  • digest with


64th Labday 2011-08-15

Miniprep of pSB1A3 + YFP clone I, pSB1A3 + YFP clone II, pSB1A3 + YFP clone III

Investigators: Steffi

Time: 2011-08-15, 07:00-10:00

Aim: isolate plasmid of pSB1A3 + YFP clone I, pSB1A3 + YFP clone II, pSB1A3 + YFP clone III

Material: 5 ml over night culture

  • pSB1A3+YFP I clone I 12.08.11 Jes
  • pSB1A3+YFP I clone II 12.08.11 Jes
  • pSB1A3+YFP I clone III 12.08.11 Jes

Method:

  • NucleoSpin® Plasmid (NoLid) (Macherey-Nagel)
    • Protocol for high-copy plasmids
    • elution with 50 µl elution buffer2O

Check concentration with NanoDrop and Agarosegel

  • pSB1A3+YFP I clone I: 134.3 ng/µl
  • pSB1A3+YFP I clone II: 113.8 ng/µl
  • pSB1A3+YFP I clone III: 179.2 ng/µl
lane Sample Volume in µl Expected size in bp
M GeneRuler™ DNA Ladder Mix (diluted 1:10) 6
1 - -
2 pSB1A3+YFP I clone I 12.08.11 Jes 1
3 pSB1A3+YFP I clone II 12.08.11 Jes 1
4 pSB1A3+YFP I clone III 12.08.11 Jes 1

UP AG Miniprep pSB1A3+YFP 2011-08-15.jpg

Further tasks:

  • digest


Test digest of minipreps of pSB1X3+YFP/CPF from 2011-08-13 and 2011-08-15

Investigators: Jessica, Laura, Steffi, Vanessa

Time: 2011-08-15, 10:00-15:00

Aim: prove of Insert YFP/CPF

Materials:

pSB1T3+YFP I clone I 12.08.11 Jes pSB1T3+YFP I clone II 12.08.11 Jes pSB1T3+YFP I clone III 12.08.11 Jes pSB1K3+YFP clone I 12.08.11 Jes pSB1T3+YFP clone II 12.08.11 Jes pSB1T3+YFP clone III 12.08.11 Jes pSB1K3+CFP clone I 12.08.11 Jes pSB1T3+CFP clone II 12.08.11 Jes pSB1T3+CFP clone III 12.08.11 Jes pSB1A3+CFP clone I 12.08.11 Jes pSB1A3+CFP clone II 12.08.11 Jes

  • ApaLI, ClaI, HaeII, BglI
  • NEB Buffer 4
  • NEB Buffer 2
  • 100x BSA
  • Agarose broad range (Roth)
  • 1x TAE buffer
  • Gel Red
  • DNA Ladder Mix (Fermentas)
  • 6x Loading Dye (Fermentas)
  • 6x Loading Dye (Promega)

Digestion protocol for pSB1K3+YFP/CFP (with HaeII)

  • 2 µl DNA
  • 0.5 µl HaeII
  • 2 µl 10x buffer = NEB 4
  • 15.8 µl pure water
  • total: 20µl

Digestion protocol for pSB1A3+YFP/CFP (with HaeII, BglI)

  • 2 µl DNA
  • 0.5 µl HaeII
  • 0.5 µl BglI
  • 2 µl 10x buffer = NEB 2
  • 0.2 µl 100xBSA
  • 15.3 µl pure water

Digestion protocol for pSB1T3+YFPI (with ApaLI, ClaI)

  • 2 µl DNA
  • 0.5 µl ApaLI
  • 0.5 µl ClaI
  • 2 µl 10x buffer = NEB 4
  • 0.2 µl 100xBSA
  • 15.3 µl pure water

37°C for ~1h

Production of one 1 % agarose gel

  • 1 % gel: 0.5 g agarose in 50 ml 1x TAE buffer
  • Adding 2 µl gel red to each gel

Loading gels and running

  • Add 4 µl Loading dye to each 20 µl sample
  • 12 µl DNA Ladder Mix
  • Running conditions: 100 V, approx. 45 min

Loading of gels

Gel 1

lane Sample Volume in µl Expected size in bp
M GeneRuler™ DNA Ladder Mix (diluted 1:10) 12
1 pSB1A3+YFP clone I 24 765, 924, 1188
2 -
3 pSB1A3+YFP clone II 24 765, 924, 1188
4 pSB1A3+YFP clone III 24 765, 924, 1188
5 pSB1A3+CFP clone I 24 765, 924, 1188
6 pSB1A3+CFP clone II 24 765, 924, 1188

250px

Gel 2

lane Sample Volume in µl Expected size in bp
M GeneRuler™ DNA Ladder Mix (diluted 1:10) 12
1 pSB1K3+YFP clone I 24 924, 2010
2 pSB1K3+YFP clone II 24 924, 2010
3 pSB1K3+CFP clone I 24 924, 2010
4 pSB1K3+CFP clone II 24 924, 2010
5 pSB1K3+CFP clone III 24 924, 2010
6 pSB1K3+YFP clone III 24 924, 2010
7 -
8 pSB1T3+YFP I clone I 24 536, 869, 1788
9 pSB1T3+YFP I clone II 24 536, 869, 1788
10 pSB1T3+YFP I clone III 24 536, 869, 1788

Example.jpg

Result:

  • Inserts couldn't be confirmed
  • possible explanation: concentration of insert to low before ligation

Further tasks:

  • repeat digest of pGA14mVenusGeneart and pGA14-Cerulean to get YFP and CFP
  • repeat ligation


Transformation of E. coli RV308 with pSB1T3+YFPII

Investigators: Niels, Jessica, Steffi

Aim:Transformation of E. coli RV - cells with

Materials:

  • ligation of pSB1T3+YFPII from 2011-08-11
  • E. coli RV308
  • LB medium

Method:

  • addition of 2 µl plasmid to RV - cells
  • incubation 30 min on ice,
  • heat shock 90 sec at 42°C,
  • incubation 2 min on ice,
  • addition of 750 µl LB medium,
  • incubation 75 min at 37 °C and 700 rpm

  • plating on agar plates containing 100 µg/µl tetracycline
  • storage over night at 37°C

Further tasks:

  • Picking clones for overnight culture


mini prep and test digestion of phage display vector pPDV100 from over night cultures (strategy 1)

Investigators: Laura, Sabine

Aim: test digestion of pPDV100 to control mdnA cloning into pak blaKDIR

Time: 2011-08-15,12:00-14:15 and 16.00-18.00

Digestion of vector pPDV100 with Sfi (10 clones)

  • 10 µl sample
  • 2 µl NEB 10x buffer 4
  • 1 µ restriction enzyme SfiI
  • 7 µl water
  • over night at 50°C

Digestion of vector pPDV100 with PvuII (10 clones)

  • 10 µl sample
  • 2 µl NEB 10x buffer 4
  • 1 µ restriction enzyme PvuII
  • 7 µl water
  • over night at 37°C


digestion of vector pARW089 (strategy 2)

Investigators: Laura, Sabine

Aim: cloning od mdnA/geneIII fusion gene into pARW089

Time: 2011-08-15,17:30-18:00

Reaction components:

  • 5 µl pARW089
  • 2 µl NEB 10x buffer 4
  • 1 µ restriction enzyme NarI
  • 1 µ restriction enzyme AatII
  • 11 µl water

Reaction conditions:

  • over night at 37°C

Results:

  • no of the expected bands (10,2 kb and 160 bp)


Survival test for E. coli XL1 blue transformed with pUP_SG1_ssTorA_CS-TEV_bla_AraC-TEV

Investigator: Sebastian, Stefan, Sascha

Aim:

  • testing the influence of the induction with IPTG and arabinose (different concentrations)
  • capacity of resistence vs. ampicillin after induction of TorA_CS-TEV_bla with IPTG

Materials:

  • LB-Agar
  • deluted overnight culture of E. coli XL1-blue transformed with pUP_SG1_TorA_CS-TEV_bla_AraC-TEV
  • LB-Media
  • Stock solutions of 1M IPTG, 1M arabinose (ara), 100mg/ml ampicillin (amp) and 25 mg/ml chloramphenicol (cm)

Methode:

100µl of deluted overnight culture of E. coli XL1-blue transformed with pUP_SG1_TorA_CS-TEV_bla_AraC-TEV (OD (600 nm)=0.002) were plated on different perpared agar plates and incubated over night at 30°C.

  • used plates:
    • total plates: 15
    • 1 plate with cm (25µg/ml)
    • 1 plate with cm (25µg/ml), 1 mM IPTG
    • 1 plate with cm (25µg/ml), 1 mM IPTG, amp (50 µg/ml)
    • 1 plate with cm (25µg/ml), 1 mM IPTG, amp (100 µg/ml)
    • 1 plate with cm (25µg/ml), 1 mM IPTG, amp (200 µg/ml)
    • 1 plate with cm (25µg/ml), 1 mM IPTG, amp (400 µg/ml)
    • 1 plate with cm (25µg/ml), 1 mM IPTG, amp (800 µg/ml)
    • 1 plate with cm (25µg/ml), 1 mM ara
    • 1 plate with cm (25µg/ml), 5 mM ara
    • 1 plate with cm (25µg/ml), 10 mM ara
    • 1 plate with cm (25µg/ml), 20 mM ara
    • 1 plate with cm (25µg/ml), 1 mM IPTG, 1 mM ara
    • 1 plate with cm (25µg/ml), 1 mM IPTG, 5 mM ara
    • 1 plate with cm (25µg/ml), 1 mM IPTG, 10 mM ara
    • 1 plate with cm (25µg/ml), 1 mM IPTG, 20 mM ara

Results:

Further tasks:

65th Labday 2011-08-16

Digestion of YFP from pGA14mVenusGeneart and CFP from pGA14-Cerulean

Time: 2011-08-16,08:00-14:00

Investigators: Steffi

Materials:

Preparation for ligation of YFP/CFP (insert) into pSB1A3, pSB1K3 or pSB1T3 (vectors)

Materials:

  • pGA14mVenusGeneart and pGA14-Cerulean
  • EcoRI-HF, PstI-HF
  • Buffer 4
  • 100x BSA

Protocol:

Digestion protocol (following iGEM distribution protocol for linearized backbones):

  • Mastermix
    • 2 µl NEB Buffer 4
    • 0.2 µl BSA
    • 1 µl EcoRI-HF
    • 1 µl PstI-HF
    • 10,8 µl pure water
      • total: 15 µl
  • reaction mix:
    • 15 µl mastermix + 5 µl DNA
  • Incubation:
    • 37°C for 1 h
  • Heat deactivation:
    • 80°C for 20 min

Further Task:

  • gel electrophoresis
  • gel extraction and purification


Agarose Gel digested CFP and YFP fragments

Investigators: Steffi, Jessica, Nicole

Aim:Purification of YFP and CFP fragment

Time: 2011-08-16, 11:00-12:00

Materials:

  • digested CFP and YFP
  • Agarose broad range (Roth)
  • 1x TAE buffer
  • Gel Red
  • DNA Ladder Mix (Fermentas)
  • 6x Loading Dye (Fermentas)

Production of one 1 % agarose gel

  • 1 % gel: 0.5 g agarose in 50 ml 1x TAE buffer
  • Adding 2 µl gel red gel

Loading gel and running

  • Add 5 µl Loading dye to each 20 µl sample
  • 6 µl DNA Ladder Mix
  • Running conditions: 85 V, approx. 1 h

Loading of gel

  • gel: CFP and YFP
lane Sample Volume in µl Expected size in bp
1 marker 6
2 - - -
3 CFP 20 771, 2873
4 - --
5 YFP 20 763, 2881
6 - - -

Result:

100px?

  • bands appear as expected
  • lower bands (red box) in lane 3 and 4 were excised and DNA was extracted w/ Wizard SV Gel and PCR Clean-Up System (Promega):
    • CFP dig. pur. Jes & VB 11.8.2011, ???? ng/µl
    • YFP dig. pur. Jes & VB 11.8.2011, ???? ng/µl

Further tasks:

  • ligation of digested and purified YFP and CFP with digested and purified pSB1A3, pSB1K3 and pSB1T3


Sequencing of pSB1A3 and pSB1K3 carrying Cerulean resp. mVenus

Investigators:Nicole

Time: 2011-08-16, 13:00-14:00

Aim: Confirmation of ligation of linearized backbones pSB1A3 and pSB1K3 with mVenus and Cerulean as dummies

Materials:

  • pSB1A3 carrying Cerulean, miniprep done by Nadja/Nicole, cDNA = 164,1 ng/ µl
  • pSb1A3 carrying mVenus, miniprep done by Steffi, cDNA = 179,2 ng/ µl
  • pSB1K3 carrying Cerulean, miniprep done by Nadja/Nicole, cDNA = 216,2 ng/ µl
  • pSb1K3 carrying mVenus, miniprep done by Nadja/Nicole, cDNA = 178,9 ng/ µl
  • Sequencing primer: VF2
  • Freelabels for Value Read Tube (MWG Eurofins)

Method:

File:UP 2011-08-16 pSB1A3 pSB1K3 CFP YFP VF2.jpg

  • DNA concentration (for sequencing): 70 ng/ µl
  • Total volume: 15 µl
  • Primer concentration: 2 pmol/ µl
  • Total volume: 50 µl
  • sent to MWG Eurofins

Results:

  • expected 2011-08-18, afternoon

Further tasks:

  • Analyzing sequencing results


Planning and accomplishing the control PCRs of pSB1A3 and pSB1K3 carrying mVenus resp. Cerulean

Investigators: Jessica, Nicole

Time: 2011-08-16, 14:00-16:00

Aim: Confirmation of ligation of linearized backbones pSB1A3 and pSB1K3 with mVenus and Cerulean as dummies; therefore perfoming PCRs using VF2 and VR2 primers, which bind in the backbone and lead to amplification of insert


Materials:

1. Plasmids

  • pSB1A3 carrying Cerulean, miniprep done by Nadja/Nicole, cDNA = 164,1 ng/ µl
  • pSb1A3 carrying mVenus, miniprep done by Steffi, cDNA = 179,2 ng/ µl
  • pSB1K3 carrying Cerulean, miniprep done by Nadja/Nicole, cDNA = 216,2 ng/ µl
  • pSb1K3 carrying mVenus, miniprep done by Nadja/Nicole, cDNA = 178,9 ng/ µl

2. Primer

  • VF2
  • VR2
  • bind in the backbone and lead to amplification of insert

3. Other materials

  • Polymerase S and corresponding buffer

Method:

1. Reaction mix (volumes in µl)

Ingredient pSB1A3+CFP pSB1A3+YFP pSB1K3+CFP pSB1K3+YFP
DNA (1:100) 6.0 5.6 4.6 5.6
Buffer (15 mM MgCl2) 5.0 5.0 5.0 5.0
dNTPs (10 mM each) 1.0 1.0 1.0 1.0
MgCl2 (25 mM) 2.0 2.0 2.0 2.0
VF2 (10 mM) 1.0 1.0 1.0 1.0
VR2 (10 mM) 1.0 1.0 1.0 1.0
Genaxxon Polymerase S 0.3 0.3 0.3 0.3
H2O 33.7 34.1 35.1 34.1

2. PCR program (IGCONT1)

Step Temperature Time
Hot Start 94°C Hold
Initial denaturation 94°C 3 min
Denaturation 94°C 45 s
Annealing 50°C 45 s
Extension 72°C 70 s
Final extension 72°C 10 min
  • 30 cycles of denaturation, annealing and extension

Agarose gel electrophoresis

lane Sample Volume in µl Expected size in bp
M GeneRuler™ DNA Ladder Mix (diluted 1:10) 12
1 -
2 PCR of pSB1A3+CFP 6 ~1000
3 PCR of pSB1A3+YFP 6 ~1000
4 PCR of pSB1K3+CFP 6 ~1000
5 PCR of pSB1K3+YFP 6 ~1000

UP AG PCR pSB1A3-K3+CFP-YFP 2011-08-17 JE.jpg

Results:

  • according to PCR all 4 plasmids carry the insert


DNA extraction of mVenus and Cerulean

Investigators: Nicole

Time: 2011-08-16, 15:00-16:00

Aim: DNA of reporter genes mVenus and Cerulean

Materials

  • Agarose gel electrophoresis of mVenus and Cerulean, done by Steffi previously
  • Machery-Nagel NucleoSpin Extract II, protocol for DNA extraction from agarose gels

Method:

  • extraction done based on manufacturer's protocol

Results:

DNA concentrations measured by Nanodrop

  • cmVenus = 6.9 ng/ µl
  • cCerulean = 10.6 ng/ µl


Agarose gel electrophoresis test digested pPDV100 (strategy 1)

Investigators: Sabine

Aim: control of created pPDV100

Time: 2011-08-16,10:00-12:00

Materials and Method:

  • 0,75 % agarose gel</b>
  • 100 V
  • 1 h

expected bands:

  • SfiI digestion pak bla KDIR with mdnA insert: 200 bp and 4,3 kb
  • SfiI digetion pak bla KDIR without mdnA insert: 800 bp and 4,3 kb
  • PvuII digestion pak bla KDIR with mdnA insert: 100 bp, 1860 bp and 2550 bp
  • PvuII digestion pak bla KDIR with mdnA insert: 100 bp, 2480 bp and 2550 bp

Results:

  • clone 2 may be a positive clone

Further tasks:

  • send pPDV of clone 2 to Eurofins for sequencing


Sequencing of pPDV100 of clone 2 (strategy 1)

Investigators: Sabine

Aim: Control of created pPDV100

Time: 2011-08-16,13:00-14:00

Material/Method:

  • Miniprep of clone 2
  • Sequencing Primer: sf_mdna_1
  • Freelabels for Value ReadTube (MWG Eurofins)
  • DNA concentration 70 ng/ µl in a total volume of 15 µl
  • Primer concentration: 15 pmol/µl in the total volume of 15 µl (mix)

Further tasks:

  • Analyzing sequencing results


Digestion of pSB1A3/pSB1K3 with CFP/YFP and PCR fragments of the promoters (Ara, Lac, constitutive)

Time: 2011-08-16

Investigators: Nicole, Niels, Jessica

Aim:

Preparation for ligation of promoters into pSB1A3, pSB1K3 carrying CFP/YFP

Materials:

  • minipreps of:
    • pSB1A3+YFP I clone III: 179.2 ng/µl(from 2011-08-15)
    • pSB1A3+CFP, pSB1K3+CFP, pSB1K3+YFP from 2011-08-05
  • purified PCR fragments (Ara, Lac, constitutive) from 2011-08-02
  • EcoRI-HF, XbaI
  • Buffer 4
  • 100x BSA

Method:

Digestion protocol (following iGEM distribution protocol for linearized backbones):

  • Mastermix
    • 2 µl NEB Buffer 4
    • 0.2 µl BSA
    • 1 µl EcoRI-HF
    • 1 µl PstI-HF
    • 10,8 µl pure water
      • total: 15 µl
  • reaction mix:
    • 15 µl mastermix + 5 µl DNA
  • Incubation:
    • 37°C for 1 h
  • Heat deactivation:
    • 80°C for 20 min

Further Task:

  • gel electrophoresis
  • gel extraction and purification