Team:NTNU Trondheim/Characterization

From 2011.igem.org

Revision as of 15:19, 22 August 2011 by Adrinaas (Talk | contribs)



Characterization Results

Several experiments were performed to test our BioBricks and constructs. This page will try to give a short summary of the construction of the test-constructs, the experiments performed to test them, and the results from the experiments.


ppGpp's effect on rrnB P1 promoter

Abstract

To test the down-regulating effect of ppGpp on rrnB P1, which is the basis of our project, we decided to make a construct containing ppGpp Synthase (RelA) inducible by the pBAD/AraC promoter. The construct would also contain beta-galactosidase (lacZ) which would be expressed by the rrnB P1 promoter. Thus, induction of the pBAD/AraC promoter with arabinose should give lower lacZ production, as relA is overproduced giving high ppGpp concentration. This was shown to be the case, using ONPG as a substrate in a lacZ-assay.


In a previous study, the possible fuction of rrnB P1 in a biologicval containment system was investigated. ppGpp synthase (relA) was over-expressed to investigate the effect on the promoter. They showed that the expression was completely turned off, when high amounts of relA was produced (1). To use relA in our project, we had to amplify the gene from chromosomal DNA, as it was not found in the Partsregistry.

Primers were designed as shown below, giving the full gene plus the [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/Part_fabrication Openwetware prefix and suffix]; relA.fwd: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGATGGTTGCGGTAAGAAGTGCACA relA.rev: GTTTCTTCCTGCAGCGGCCGCTACTAGTACTAACTCCCGTGCAACCGACG



(1) Tedin, K., A. Witte, et al. (1995). "Evaluation of the E. coli ribosomal rrnB P1 promoter and phage-derived lysis genes for the use in a biological containment system: A concept study." Journal of Biotechnology 39(2): 137-148.