Team:Potsdam Bioware/Labjournal/June

From 2011.igem.org

Revision as of 09:30, 18 September 2011 by KatharinaB (Talk | contribs)

Contents

10th Labday 2011-06-01

Primer design for Phage Display

Investigators: Jessica, Sabine, Sandrina, Nadja

Aim: Design primers for PCR of mdnA (from pARW089) to clone into pAK100 with SfiI restriction sites

Time: 2011-06-01,15:30-21:00

Materials:

  • Geneious Pro 5.1.7
  • Oligo Calc: Oligonucleotide Properties Calculator (http://www.basic.northwestern.edu/biotools/oligocalc.html)


Method:

Primer design

  • melting temperature based on 4+2 method (for mdnA-overlapping part)
  • adding sequences for restriction sites (considering reading frame)
  • Check self-complementarity and melting temperature using Oligo Calc


Results:

Primer sequences

  • pf_sfi_mdna_1 TCTAGATGGCGGCCCAGCCGGCCATGGCGATGGCATATCCCAAC
  • pr_sfi_mdna_1 CCCTTCTGACTGGGAAGATTATGGCCTCGGGGGCCACTAATACTAGTAGCGGCCGCTGCAGGCT


Further tasks:

  • do PCR of mdnA

11th Labday 2011-06-07

Design of PCR conditions for amplifying the complete mdn cluster

Investigators: Jessica, Nicole, Nadja


Aim: PCR amplification of the mdn cluster


Time: 2011-06-07,18:00-19:30


Materials:

  • Sequence of vector pARW071, concentration 857.3 ng/ µl
  • Forward primer: sf_bb_4_1
  • Reverse primer: r_bb_1
  • Geneious Pro 5.1.7


Method:

  • Design of a temperature profile based on the manual
  • Definition of a mastermix based on the manual


Results:

1. Temperature profil

Temperature in °C Time in s
94 Hold
94 180 Initial denaturation
94 15 Denaturation
46 30 Annealing
68 300 Elongation
--> 10 cycles
94 15 Denaturation
46 30 Annealing
68 300 + 2 per each cycle Elongation
--> 20 cycles
68 600 Final extension


2. Mastermix

Component Volume in µl Final concentration
Buffer Fermentas Long Enzyme Mix (+MgCl2) 5
dNTPs 1 0.2 mM
Primer (each) 3 0.6 µM
DNA (diluted 1:100) 4.08 µl 0.7 ng
Polymerase 0.3 µl 1.5 U
H2O 33.62 µl (up to 50 µl)


Further tasks:

  • PCR of the complete mdn cluster
  • verification using agarose gel electrophoresis


Design of PCR conditions for amplifying mdnA

Investigators: Jessica, Nicole, Nadja


Aim: PCR amplification of mdnA


Time: 2011-06-07,18:00-19:30


Materials:

  • Sequence of vector pARW089, concentration 626.7 ng/ µl
  • Forward primer: sf_mdna_1
  • Reverse primer: r_mdna_1
  • Geneious Pro 5.1.7


Method:

  • Design of a temperature profile based on the manual
  • Definition of a mastermix based on the manual


Results:

1. Temperature profil

Temperature in °C Time in s
94 Hold
94 30 Initial denaturation
94 15 Denaturation
45 35 Annealing
68 20 Elongation
--> 30 cycles
68 300 Final extension
6 Hold


2. Mastermix

Component Volume in µl Final concentration
Buffer NEB OneTaq 10
dNTPs 1 0.2 mM
Primer (each, diluted 1:10) 1 0.2 µM
DNA (diluted 1:100) 5.58 0.7 ng
Polymerase 0.25
H2O 31.17 (up to 50 µl)


Further tasks:

  • PCR of mdnA
  • verification using agarose gel electrophoresis

12th Labday 2011-06-08

PCR of the complete mdn cluster

Investigators: Jessica, Nicole


Aim: Testing the possibility of a PCR of the whole mdn cluster and the chosen conditions


Time: 2011-06-08, 9:30-14:00


Materials:

  • DNA polymerases: Long PCR Enzyme Mix (Fermentas)
  • Template DNA: pARW071 (vector)
  • Forward primer: sf_bb_4_1
  • Reverse Primer: r_bb_1

--> mastermix composition, see 11th labday 'Design of PCR conditions for amplifying the complete mdn cluster'

  • Eppendorf Mastercycler gradient
  • used temperature profil
Temperature in °C Time in s
94 Hold
94 120 Initial denaturation
94 20 Denaturation
56 20 Annealing
68 300 Elongation
--> 10 cycles
94 20 Denaturation
56 20 Annealing
68 300 + 2 per each cycle Elongation
--> 20 cycles
68 600 Final elongation
6 Hold


Method:

  • pipetting the mastermix on ice
  • preheating of the thermocycler: starting the program IGMDN1 (Eppendorf Mastercycler gradient)
  • finally adding polymerase
  • start the PCR program (press enter)


Results:

  • PCR product


Further tasks:

  • Verification of the PCR product using agarose gel electrophoresis


PCR of mdnA

Investigators: Jessica, Nicole


Aim: Testing the possibility of amplifying mdnA using PCR and the chosen conditions


Time: 2011-06-08,9:30-14:00


Materials:

  • DNA polymerases: NEB OneTaq DNA Polymerase
  • Template DNA: pARW089 (vector)
  • Forward primer: sf_mdna_1
  • Reverse Primer: r_mdna_1

--> mastermix composition, see 11th labday 'Design of PCR conditions for amplifying mdnA'

  • Eppendorf Mastercycler personal
  • used temperature profil
Temperature in °C Time in s
94 Hold
94 60 Initial denaturation
94 20 Denaturation
56 20 Annealing
68 20 Elongation
--> 30 cycles
68 300 Final elongation
6 Hold


Method:

  • pipetting the mastermix on ice
  • preheating of the thermocycler: starting the program IGMDNA1 (Eppendorf Mastercycler personal)
  • finally adding polymerase
  • start the PCR program (press enter)


Results:

  • PCR product


Further tasks:

  • Verification of the PCR product using agarose gel electrophoresis

Production of agarose gel

Investigators: Jessica, Nicole


Aim: Verification of PCR product, mdnA and whole mdn cluster, by agarose gel electrophoresis


Time: 2011-06-08,9:30-14:00


Materials:

  • Agarose, type VII, low gelling temperature (Sigma)
  • 1x TAE Buffer (produced by AG Biotechnology)
  • GelRed


Method:

1. mdn cluster (approx. 6712 bp) --> 0.8 %

  • 0.75 g agarose in 50 ml 1xTAE buffer
  • dissolving/ boiling up using microwave
  • after cooling, adding of 2 µl GelRed


2. mdnA (approx. 276 bp) --> 1.5 %

  • 0.4 g agarose in 50 ml 1xTAE buffer
  • dissolving/ boiling up using microwave
  • after cooling, adding of 2 µl Gelred


Results

  • 1.5 % agarose gel
  • 0.8 % agarose gel


Further tasks:

  • Loading gel and performing electrophoresis


Agarose gel electrophoresis of mdnA

Investigators: Jessica, Nicole, Nadja


Aim: Verification of PCR product, mdnA, by agarose gel electrophoresis


Time: 2011-06-08,15:45-18:00


Materials:

  • 1.5 % agarose gel, produced previously
  • PCR product of mdnA amplification
  • DNA Ladder Gene Ruler, 100bp plus, DNA Ladder (Fermentas)
  • 6x Loading Dye (Fermentas)


Method:

1. Loading samples

  • dilution of PCR product: 1 µl DNA and 4 µl water
  • Adding 1 µl 6x loading dye to diluted PCR product


Positions of samples/ marker

lane Sample Sample/[µl] Expected size (bp) approx. size
1 marker 2
2 PCR product mdnA 6 276 280
4 PCR product mdnA (dilution) 6 276 280
5 marker (dilution 1:5) 2


2. Run

  • 100 V
  • time: 1 h


Results:

UP AG PCR mdnA 2011-06-08 JE 001.jpg



approx. size: see methods


Design of PCR conditions for amplifying mdnA for Phage display

Investigators: Sandrina, Sabine


Aim: PCR reaction of mdnA with overlapping primers containing SfiI restriction sites for cloning into PAK100, which is needed for phage display


Time: 2011-06-8,12:00-14:00


Materials:

  • Sequence of vector pARW089
  • Manual: OneTaq Polymerase (NEB)
  • Forward primer: pf_mdnA_sfi_1
  • Reverse primer: pr_mdnA_sfi_1
  • Geneious


Method:

  • Design of a temperature profile based on the manual


Results:

1. Temperature profil

Temperature in °C Time in s
94 Hold
94 60 Initial denaturation
94 20 Denaturation
60 20 Annealing
72 20 Elongation
--> 15 cycles
94 60 Denaturation
70 40 Annealing
72 20 Elongation
--> 15 cycles
70 300 Final extension


Further tasks:
PCR

13th Labday 2011-06-09

Agarose gel electrophoresis of mdn cluster

Investigators: Jessica, Steffi, Nicole


Aim: Verification of amplification of the complete mdn cluster by PCR


Time: 2011-06-09,10:00-17:30


Materials:

  • 0.8 % agarose gel, produced previously
  • PCR product of mdn amplification
  • DNA Ladder Gene Ruler, 100bp plus, DNA Ladder (Fermentas)
  • 6x Loading Dye (Fermentas)


Method:

1. Loading samples

  • dilution of PCR product:
  • Adding 1 µl 6x loading dye to diluted PCR product


Positions of samples/ marker

lane Sample Sample/[µl] Expected size (bp) approx. size
1 marker
2 PCR product mdn cluster
4 PCR product mdn cluster (dilution)
5 PCR product mdn cluster (dilution)


2. Run

  • 100 V
  • time: 1 h


Results:

250px



approx. size: see methods


14th Labday 2011-06-10

Amplification of mdnA for phage display

Investigators: Sandrina, Sabine


Aim: amplificate mdnA of pARW089 with primers pf_mdnA_sfi_1 and pr_mdnA_sfi_1


Time: 2011-06-10,08:00-10:00, 14:00-20:00


Materials/Methods:

1. PCR (see 11th Labday 2011-06-08)

  • 0,75 ng Vector pARW089
  • Thermo Hybraid Px2
  • 0,25 µl OneTaq DNA Polymerase (NEB)
  • 1 µl dNTPs
  • 1 µl each forward and reverse primer
  • 32,15 µl DNase free water
  • 10 µl 5xOneTaq Standard Reaction Buffer

2. PCR product purification

  • QIAquick Gel Extraction Kit (250)

3. Digestion with SfiI

  • 50 µl sample
  • NEB 10x buffer 4
  • 100x BSA
  • 3 µl restriction enzyme SfiI
  • PCR product (mdnA with SfiI restriction sites)

Further tasks:
gel electrophoresis and gel extraction

15th Labday 2011-06-14

cultivation of cells containing pAK100 from E.coli glycerol stocks

Investigators: Sandrina


Aim: cultivate cells conatining pAK100 (vector) to purify it and use it for phage display.

1.amplificated mdnA should be cloned into pAK100

2. genIII should be amplified from it to clone into pARW089


Time: 2011-06-14,13:45-14:45


Materials/Methods:

  • glycerol stock nr. 15, pAK100 bla KDIR, XL1-blu, 2003-07-31
  • LB-medium with chloramphenicol (1:1000)

Further tasks:
plasmid preperation und digestion with SfiI

16th Labday 2011-06-15

gel electroporesis PCR product(mdnA, 2011-06-10), plasmid preperation und digestion with SfiI of pAK100 bla KDIR

Investigators: Sandrina, Sabine, Jessica


Aim: purification of mdnA and pak100 to use it for phage display.

1.amplificated mdnA should be cloned into pAK100

2.genIII should be amplified from it to clone into pARW089


Time: 2011-06-15,12:00-18:00


Materials/Methods:

1. plasmid preparation

GeneJET Plasmid Miniprep Kit (Fermentas, K0509)

2. Digestion with SfiI

  • 50 µl sample
  • NEB 10x buffer 4
  • 100x BSA
  • 3 µl restriction enzyme SfiI
  • PCR product (mdnA with SfiI restriction sites)

3. gel electrophoresis

sample preparation: 50 µl PCR product (digested) + 10 µl 6x loading dye solution

0,75 g Agarose, 50 ml TAE (1 x), 2 µl GELRED, at 100 Volt,running time: 45 minutes

marker: GeneRuler ladder 100 Bp plus ladder (Fermentas)

Results:

no results, PCR didn`t work

Further tasks:
repeat PCR, gel electrophoresis of digested pak100

17th Labday 2011-06-16

gel electrophoresis and gel extraction of digested pAK100 bla KDIR

Investigators: Sandrina, Sabine, Anna


Time: 2011-06-16,10:00-12:00


Aim: get a pAK100 plasmid digested with sfiI to clone mdnA into it (phage display, strategy 1)


Materials/Methods:

  • 1.gel electrophoresis sample preparation: 50 µl plasmid product (digested) + 10 µl 6x loading dye solution 0,5 g Agarose, 50 ml TAE (1 x), 2 µl GELRED, at 100 Volt,running time: 45 minutes marker: 1 kb DNA ladder (NEB)
  • 2. gel extraction

QIAquick Gel Extraction Kit (250)


Results:

digestion worked, plasmids were extracted from the gel and stored at -20 °C


Further tasks:

ligation of digested pAK100 with amplified mdnA containing sfiI restriction sites

PCR of mdnA for phage display repeated with modified conditions

Investigators: Sandrina, Sabine, Anna


Time: 2011-06-16,10:00-12:00


Aim: amplification of mdnA with SfiI restriction sites (vector pARW089)


Materials/Methods:

see 2011-06-10

changes:

  • annealing temperature 56°C (stage 1)
  • template 65 ng

gel electrophoresis of PCR product

Investigators: Sandrina, Anna, Sabine


Time: 2011-06-16,16:00-18:00


Material and Methods:

see 2011-06-15


Results:

no result

reason: reversed primer was ordered unreversed


Further tasks:

order a new primer

Over night culture of E. coli XL1-blue and RF308

Investigators: Sandrina, Anna, Sabine


Time: 2011-06-16,18:00-19:00


Aim: cultering cells to produce competent cells


Material and Methods:

  • XL1-blue: 15 ml LB medium with 100 µg/mL tetracycline out of tetracycline stock solution 50 mg/mL
  • RF308: 15 ml LB medium without streptomycin (not available)


Further tasks:
produce competent cells


18th Labday 2011-06-17

competent cells - E.coli XL1 blue & RF308

Investigator: Niels


Aim: produce competent cells


Time: 2011-06-15,09:00-16:30


Materials/Methods:

Work always sterile and cold and speedy!

  • All volumes deal with the common cellline!
  • Prepare 45 Eppis (1,5µl)
  • get liquid nitrogen
  • Use Milipore-filter for sterile CaCl2 , keep cool!
  • prepare 15ml LB-Medium (or DYT) with the specific antibiotic (XL1-blue ? Tet, BL21 ? none!), inoculate and incubate over night
  • prepare 100ml LB-Medium (or DYT) with the specific antibiotic, inoculate with 2ml of the over-night-culture. Nurture the culture until OD600 at 0,35 (0,2-0,5) (if the OD is too high, the cell won’t be competent)
  • keep cell suspension in sterile falcons (50ml) 20 min on ice, then centrifuge for 20min; 4°C; 2500g
  • discard supernatant, carefully resuspend on ice with 10ml cold CaCl2-solution (put a little of the 10ml solution in every falcon before!), pool every resuspended aliquot of one cell line and add 40ml CaCl2-solution (total volume 50ml). Keep 30 min on ice, then centrifuge for 20min; 4°C; 2500g
  • discard supernatant, carefully resuspend pellet in 5,5ml CaCl2(80mM)/Glycerol (4:1), use the pippete boy and a sterile glas pipette to dissolve the pellet
  • aliquot in Eppis á 150µl and store immediately at liquid nitrogen and afterwards at -80 °C

Results:

  • 22 tubes RF308 for expression(150µl competent cells at -80°C)
  • 22 tubes XL1 blue for transformation(150µl competent cells at -80°C)


Further tasks:
check by transformation

primer design for phage display

Investigators: Jessica, Sabine, Sandrina, Anna


Aim: Design primers for PCR of

  • genIII (from pak100)
  • mdnA (from pARW089)

to fuse genIII and mdnA in pARW089


Time: 2011-06-17,14:00-18:00


Materials:

  • Geneious Pro 5.1.7
  • Oligo Calc: Oligonucleotide Properties Calculator (http://www.basic.northwestern.edu/biotools/oligocalc.html)


Method:

Primer design

  • melting temperature based on 4+2 method (for mdnA-overlapping part)
  • adding sequences for restriction sites (considering reading frame)
  • Check self-complementarity and melting temperature using Oligo Calc


Results:

Primer sequences (strategy 2)

  • pf_iGEM_GenIII_NgoMIV TAAGCTGCCGGCGAGCAGAAGCTGATCTCTGAGGAAGACCTGGGTGGTGGCTCTGGTTCC (2nt-NgoMIV-myc-GenIII)
  • pr_GenIII_iGEM_AatII 5'->3' TGCTTAGACGTCTACTAGTATTAACCGGTAGACTCCTTATTACGCAGTA (GenIII-AgeI-SpeI-AatII-6nt)
  • pf_mdnA-iGEM_EheI TTCCATGGCGCCAGAGGAATCTAGATGGCATATCCCAACGATC (6nt-EheI-RBS-XbaI-mdnA)
  • pr_mdnA_iGEM_AAtII 5'->3' GACGTCCTGCAGCGGCCGCTACTAGTATTAACCGGTTATAATCTTCCCAGTCAGAAG (mdnA-AgeI-SpeI-NotI-PstI-AatII-nt)

new ordered primer for amplification of mdnA from pARW089 with sfiI restriction sites (strategy 1)

  • pr_sfi_mdna_1 5'->3' AGCCTGCAGCGGCCGCTACTAGTATTAGTGGCCCCCGAGGCCATAATCTTCCCAGTCAGAAGGG


Further tasks:

PCR

19th Labday 2011-06-20

Preparation of LB-Agarplates

Investigators: Nadine, Katharina, Steffi, Nicole, Jessica


Time: 2011-06-09,13:45-19:00


Aim: Preparation of LB-Agarplates


Recipe:

  • 10 g/l Yeast-Tryptone
  • 10 g/l NaCl
  • 5 g/l Yeast-Extract
  • 15 g Agar-Agar
  • fill up to 1000 ml with Millipore H2O and autoclave


Further tasks:
add antibiotics (Ampicillin, Kanamycin) to LB-Medium and prepare plates


Design of Primers for myc-tagging mdnA

Investigators: Nicole, Nadine, Katharina, Steffi


Aim: Design primers for mdnA (from pARW089) in order to tag it w/ myc (+ Factor XA Protease restriction site) to clone into vector from Sven (iGEM vector from 2010)


Time: 2011-06-01,16:00-19:00


Materials:

  • Geneious Pro 5.1.7
  • Oligo Calc: Oligonucleotide Properties Calculator (http://www.basic.northwestern.edu/biotools/oligocalc.html)


Method:

  • Primer design
    • melting temperature based on 4+2 method (for mdnA-overlapping part)
    • adding sequences for restriction sites (considering reading frame)
    • Check self-complementarity and melting temperature using Oligo Calc
  • Myc-tag
    • why?: purification by affinity chromatography (using antybodies against myc-tag)
  • Factor XA Protease
    • why?: to be able to cleave myc tag after mdnA expression and purification
    • restriction site: I E/D G R
    • used sequence (forward): ATT GAA GGC CGT


Results:

Primer sequences

UP Primer design myc mdnA 2011-06-20.png


Further tasks:

  • do PCR of mdnA

20st Labday 2011-06-21

Error prone PCR (varied MnCl2 and MgCl2 concentration) of mdnA

Investigators: Nadine, Steffi, Nicole


Time: 2011-06-21,9:00-14:00


Aim: Random mutation of mdnA gene based on increased MnCl2 and MgCl2 concentration


Materials:

  • Marcus Schicklberger's (trainee, August 2005) protocol performing several error prone PCRs
  • Manual Supplement of Cadwell and Joyce 2009 [[Media:


  • Genaxxon Bioscience taq Polymerase
  • 10x Genaxxon Bioscience taq Polymerase buffer containing 15 mM MgCl2
  • dNTPs (10 mM)
  • forward primer: sf_mdnA_1 (10 µM)
  • reverse primer: r_mdnA_1 (10 µM)
  • template DNA pARW089 (857,3 ng/ µl measured by nanotrop a second time)
  • Genaxxon Bioscience MgCl2 stock solution (50 mM)


  • Manganese(II) chloride (Merck)
  • MnCl2
  • sterile filter


  • Eppendorf Mastercycler personal, program IGMDNA1


Method:

Production of 50 mM Manganese(II) chloride stock solution

  • MMnCl2 = 161.81 g/ mol
  • 50 mM in 1 ml needed --> mMnCl2 = 8.1 mg
  • sterile filtration: pore size of filter: 0.2 µm



Error prone PCR of mdnA

  • increasing MnCl2 concentration beginning with 0 mM in 0.05 mM steps, ending with 0.15 mM (--> sample 1-4)
  • increasing MgCl2 concentration beginning with 1.5 mM, in 5 mM steps, ending with 15 mM (--> sample 5-8)


1. Mix for error prone PCR with increasing MnCl2 concentration

Component Stock concentration Volume in µl Final concentration
Genaxxon Bioscience Taq Polymerase buffer containing MgCl2) 15 mM (MgCl2) 5 1.5 mM MgCL2
MgCl2 50 mM 5.5 5.5 mM
dNTPs 10 mM 2.0 0.4 mM
Primer (each) 10 µM 2.5 0.5 µM
DNA (diluted 1:100) 8.57 ng/ µl 5.58 0.7 ng
Polymerase 1 5 U


in addition MnCl2 and H2O as shown following


Sample number MnCl2 in µl Final concentration MnCl2 H2O in µl
1 0 0 25.52
2 0.5 0.05 mM 23.02
3 1.0 0.1 mM 22.52
4 1.5 0.15 mM 22.02



2. Mix for error prone PCR with increasing MgCl2 concentration

Component Stock concentration Volume in µl Final concentration
Genaxxon Bioscience Taq Polymerase buffer containing MgCl2) 15 mM (MgCl2) 5 1.5 mM MgCL2
dNTPs 10 mM 2.0 0.4 mM
Primer (each) 10 µM 2.5 0.5 µM
DNA (diluted 1:100) 8.57 ng/ µl 8.0 5 ng
Polymerase 1 5 U


in addition MgCl2 and H2O as shown following


Sample number MnCl2 in µl Final concentration MnCl2 H2O in µl
5 0 1.5 mM 29.0 µl
6 3.5 5 mM 17.5 µl
7 7.0 10 mM 14.0 µl
8 10.0 15 mM 10.5 µl



3. Complete pipet scheme

Component in µl 1 2 3 4 5 6 7 8
Template DNA 8 8 8 8 8 8 8 8
dNTPs 2 2 2 2 2 2 2 2
10x Genaxxon polymerase buffer (with MgCl2) 5 5 5 5 5 5 5 5
MgCl2 (50 mM) 5.5 5.5 5.5 5.5 0 3.5 7.0 10.5
MnCl2 (5 mM) 0 0.5 1 1.5 0 0 0 0
Forward primer (sf_mdnA_1) 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5
Reverse primer (r_mdnA_1) 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5
H2O 23.5 23.0 22.5 22.0 29.0 25.5 22.0 18.5



4. Temperature profile

  • see 12th labday
  • Eppendorf Mastercycler personal, program IGMDNA1



Results:

  • 8 PCR products containing mutated mdnA


Further tasks:

  • Verification of these PCR products by agarose gel electrophoresis
  • Purification and cloning of positive samples
  • Sequencing


Agarose gel electrophoresis of mutated mdnA

Investigators: Nadine, Jessica, Steffi, Nicole


Time: 2011-06-21,14:00-17:00


Aim: Verification of random mutated mdnA (mutations are based on increased MnCl2 and MgCl2 concentration)


Materials:

  • Agarose broad range (Roth)
  • 1x TAE buffer
  • Gel Red


  • 8 PCR products of mutated mdnA, see
  • DNA Ladder Gene Ruler, 100bp plus, DNA Ladder (Fermentas)
  • 6x Loading Dye (Fermentas)



Method:

1. Production of two 1 % agarose gel

For each gel:

  • mAgarose = 0.5 g in 50 ml 1x TAE
  • adding 2 µl gel red


2. Loading samples

  • 30 µl PCR product and 6x loading dye
  • 2 µl DNA ladder gene ruler



Positions of marker and sample

Gel 1

lane Sample Volume in µl Expected size in bp
1 marker 2
2 mdnA 1 36 276
3 mdnA 2 36 276
4 mdnA 3 36 276
5 mdnA 4 36 276


Gel 2

lane Sample Volume in µl Expected size in bp
1 marker 2
2 mdnA 5 36 276
3 mdnA 6 36 276
4 mdnA 7 36 276
5 mdnA 8 36 276


3. Run

  • 100 V
  • time: 1 h


Results:

UP AG EPPCR mdnA sample1to4 labeled 2011-06-21 16- 11.jpg

UP AG EPPCR mdnA sample5to8 labeled 2011-06-21 16- 11.jpg


  • Gel Extraction DNA excision: lane 1-4, 5,7: ~ 276 bp band
  • stored at -20°C in orange box (iGEM 2011 UP DNA)



Further tasks:

  • DNA extraction
  • Cloning
  • Sequencing


Over night culture of E.coli BL21 containing BBa_K404304_pSB1C3 (biobrick iGEM Freiburg 2010) from Sven

Investigators: Jessica, Nadine, Stefan, Steffi


Aim: Culturing E. coli containing BBa_K404304_pSB1C3 biobrick for midi-prep and using for cloning afterwards


Time: 2011-06-21,16:50-17:00


Materials:

  • cells: E.coli BL21 containing BBa_K404304_pSB1C3 (biobrick iGEM Freiburg 2010) from Sven (amount?)
  • 50 ml LB media
  • 50 µl Chloramphenicol (100 mg/ml)


Method:

  • add antibiotic to LB
  • inoculation of cells
  • 37 °C, 250 rpm, 17 hours


Results:


Further tasks:

  • remove cells from shaker at 10:00 (Nici :D)
  • do midi-prep


Transformation of E.coli XL 1 blu and RV 308 + puK

Investigators: Niels


Aim: Check the quality of competent cells


Time: 2011-06-21,10:00-12:30


Materials:

  • cells: E.coli XL 1 blu and RV 308
  • 50 ml LB media
  • 50 µl ampicillin (100 mg/ml)


Method:

protocol: addition of 1 µl plasmid (puK) to cells in 1.5 ml Eppi,

  • incubation 30 min on ice,
  • heat shock 90 sec at 42°C,
  • addition of 750 µl LB medium,
  • incubation at 37 °C for 60 min in Eppendorf thermomixer at 450 rpm,
  • centrifugation at 2000xg; for 5 min,
  • decandation of supernatant,
  • resuspension of pellet in approx. 100 µl,
  • plating on LB medium with 1,5 % agar and LB medium with 1,5 % agar, 100 µg/ml ampicillin,
  • storage over night at 37°C


Results:

  • negative


Further tasks:

  • repeat


21th Labday 2011-06-22

Gel extraction of mutated mdnA

Investigators: Katharina, Nicole


Aim: Extraction of mdnA, which was amplified and mutated (using error prone PCR)


Time: 2011-06-22,12:15-13:30


Materials:

  • Qiagen QIAquick Gel extraction Kit
  • PCR products 1-5 and 7 containing mutated mdnA


Method:

  • elute in 30 µl buffer EB


Results:

  • purified PCR products of mutated mdnA (1-5, 7)


Further tasks:

  • restriction enzyme digestion with purified mdnA and pARW089 using AatII/ NarI
  • Verification by agarose gel electrophoresis
  • Ligation

Midiprep of pSB1C3 carrying cells

Investigators: Nadine, Vanessa


Aim:

  • Midiprep of pSB1C3
  • vector for biobricks (RFC25)


Time: 2011-06-22, 14:00-16:00


Materials:

  • Qiagen Plasmid Plus Midi Kit
  • over night cultures: E.coli BL21 containing BBa_K404304_pSB1C3 (biobrick iGEM Freiburg 2010) from Sven
  • NanoDrop

Method:

Midiprep


Output: 4 x DNA Eppi Tubes: pSB1C3, 22.06.2011, storage: orange box (iGEM DNA, -20°C)

Results:

  • concentration:
    • tube 1: 284.6 ng/µl, 260/280 = 1.90, 260/230 = 2.32
    • tube 2: 252.6 ng/µl, 260/280 = 1.91, 260/230 = 2.34
    • tube 3: 235.0 ng/µl, 260/280 = 1.89, 260/230 = 2.01
    • tube 4: 238.4 ng/µl, 260/280 = 1.9, 260/230 = 2.32

Further tasks:


Restriction enzyme digestion and agarose gel electrophoresis of mutated mdnA

Investigators: Katharina, Nicole


Time: 2011-06-22,14:00-18:00


Aim: Restriction enzyme digestion of random mutated mdnA and pARW089 (vector) and verification using gel electrophoresis


Materials:

  • Restriction enzymes: AatII, NarI
  • NEB Buffer 4
  • PCR products of random mutated mdnA(1-5, 7), purified from gel
  • vector pARW089
  • Agarose broad range (Roth)
  • 1x TAE buffer
  • Gel Red


  • DNA Ladder Gene Ruler, 100bp plus, DNA Ladder (Fermentas)
  • 6x Loading Dye (Fermentas)
  • 1kb DNA ladder (NEB)



Method:

1. Restriction enzyme digestion

components volume of PCR products /µlvolume of pARW089 /µl
DNA 30 6
NEB Buffer 4(10x) 4 1
Enzyme AatII 1 1
Enzyme NarI 1 1
H2O 4 1
Total volume 40 10

2. Production of two 1 % agarose gels

  • mAgarose = 1.0 g in 100 ml 1x TAE
  • adding 4 µl gel red


3. Loading samples

a. restriction enzyme digestion products of random mutated mdnA

  • 30 µl PCR product and 6 µl 6x loading dye


b. restriction enzyme digestion product of vector pARW089

  • 10 µl PCR product and 6x loading dye


  • 2 µl DNA ladder gene ruler, 100bp plus (Fermentas)
  • 2 µl 1 kb DNA ladder (NEB)



Positions of marker and sample

Gel 1

lane Sample Volume in µl Expected size in bp
1 marker 2
2 mdnA 1 36
3 mdnA 2 36
4 mdnA 3 36
5 mdnA 4 36
6 mdnA 5 36


Gel 2

lane Sample Volume in µl Expected size in bp
1 marker 2
2 mdnA 7 36
5 pARW089
6 marker, 1kb DNA ladder (NEB) 2


4. Run

  • 100 V
  • time: 1 - 1.5 h


Results:

300px

300px


  • stored in freezer



Further tasks:

  • DNA extraction
  • Cloning
  • Sequencing


Over night culture of E.coli ?? containing pEX respectively pBAD from Tobias

Investigators: Jessica, Nadine, Nicole


Aim: Culturing E. coli containing PEX respectively pBAD for midi-prep


Time: 2011-06-22,16:50-17:00


Materials:

  • cells: E.coli ?? containing pEX respectively pBAD from Tobias (amount?)
  • 50 ml LB media
  • 50 µl Ampicillin (100? mg/ml)


Method:

  • add antibiotic to LB
  • inoculation of cells
  • 37 °C, 250 rpm, 17 hours


Results:


Further tasks:

  • remove cells from shaker at 10:00
  • do midi-prep


22th Labday 2011-06-23

Midiprep of pEX respectively pBAD carrying cells

Investigators: Jessica


Aim:

  • Midiprep of pEX respectively pBAD
  • expression vectors


Time: 2011-06-23, 10:30-12:30


Materials:

  • Qiagen Plasmid Plus Midi Kit
  • over night cultures: E.coli ?? containing pEX respectively pBAD
  • NanoDrop

Method:

Midiprep


Results:

  • concentration:
    • pEX tube 1: 36.4 ng/µl
    • pEX tube 2: 62.4 ng/µl
    • pBAD tube 1: 71.6 ng/µl
    • pBAD tube 2: 94.6 ng/µl

Output:

  • 2 x DNA Eppi Tubes: pBAD, 23.06.2011, storage: orange box (iGEM DNA, -20°C)
    • concentration may be okay as pBAD is a low-copy plasmid
  • pEX tubes thrown away because of low concentration


Further tasks:

  • redo culturing and midiprep for pEX


Over night culture of E.coli XL1-Blue and RF308 for competent cells

Investigators: Stefan


Aim: Culturing cells to produce competent cells


Time: 2011-06-23,15:30-16:00


Materials:

  • XL1-Blue: 15 ml LB medium with 100 µg/mL tetracycline out of tetracycline stock solution 50 mg/mL
  • RF308: 15 ml LB medium without streptomycin (not available)


Method:

  • add antibiotic to LB
  • inoculation of cells
  • 30 °C, 250 rpm, 18 hours
  • 37 °C, 250 rpm, 5 hours
  • inoculate 200 mL fresh culture with 2 mL from starter culture


Results:


Further tasks:

  • produce competent cells


Over night culture of E.coli containing vector pBAD resp. pEX for midiprep resp. glycerol stocks

Investigators: Nicole

Aim: Culturing cells to do midiprep and to produce glycerol stocks

Time: 2011-06-23,17:30-18:00

Materials:

  • E. coli containing expression vector pBAD: 5 ml LB medium with 5 µl ampicilin
  • E. coli containing expression vector pEX: 50 ml LB medium with 50 µl ampicilin

Method:

  • add antibiotic to LB
  • inoculation of cells
  • 37 °C, over night

Results:

Over night culture of

  • E. coli containing expression vector pBAD
  • E. coli containing expression vector pEX

Further tasks:

  • Midiprep for E. coli containg vector pEX
  • glycerol stocks of E. coli containg vector pEX as well as fpr E. coli containg vector pBAD


Amplification of mdnA and GeneIII for phage display

Investigators: Sandrina, Sabine


Aim:

amplificate mdnA of pARW089 with primers pf_mdnA_sfi_1 and pr_mdnA_sfi_1 (phage display strategy 1)

amplificate mdnA of pARW089 with primers pf_mdnA_iGEM_EheI and pr_mdnA_iGEM_AatII (phage display strategy 2)

amplificate GeneIII of pak100 with primers pf_iGEM_GenIII_NgoMIV and pr_GenIII_iGEM_AatII (phage display strategy 2)


Time: 2011-06-23, 10:00-12:00, 15:00-17:00


Materials/Methods:

1. PCR

  • 0,8 ng Vector pARW089
  • Thermo Hybraid Px2 (conditions see 2011-06-08, changes: extension time 40 s)
  • 0,25 µl OneTaq DNA Polymerase (NEB)
  • 1 µl dNTPs
  • 1 µl per primer
  • 31,75 µl DNase free water
  • 10 µl 5xOneTaq Standard Reaction Buffer

2. gel electrophoresis (analytic)

  • 5 µl PCR product, agarose gel: 1%)
  • DNA Ladder Gene Ruler, 100bp plus, DNA Ladder (Fermentas)

Positions of marker and sample

Gel

lane Sample Volume in µl Expected size in bp
M marker 2
1 mdnA with sfiI 7 224
2 mdnA iGEM 7 ca. 230
3 geneIII iGEM 7 ca. 520


Results:

File:UP PCR sfi mdna,mdna rfc25,genIII.png

PCR for strategy 1 (lane number 1) probably did not work because the annealing temperature of the forward primer is located at 42°C (not 60 °C)


Furter tasks:

  • purification of pcr products
  • order new forward primer for strategy 1 with higher annealing temperature


Design of primers and planing of further experiments

Investigators: Nadine, Nicole


Time: 2011-06-23, 15:00-18:00


Aim: Design of primers and detailed planing of further experiment


Materials:

1. Primer design

  • Geneious Pro 5.1.7
  • Oligo Calc: Oligonucleotide Properties Calculator (http://www.basic.northwestern.edu/biotools/oligocalc.html)


Method:

1. Primer Design

  • add an start codon (ATG) to the previously designed primer pf_mdnA_mycN_xbal


2. Detailed planing of further experiments

A. Control experiment of error prone PCR of mdnA and subsequent restriction enzyme digestion using NarI and AatII

Aim: Analysis of three lines after agarose gel electrophoresis after restriction enzyme digestion of mdnA using NarI and AatII; see

Idea: DNA is not completly single stranded; would be avoid by heating mixture after restriction enzyme digestion for 10-20 min at 65°C


B. Random mutagenesis of mdnA and determination of mutation rate

Idea: using an increased MnCl2 concentration to mutate mdnA and finally sequencing of mdnA to determine the mutation rate


C. mdnA as iGEM expression part in vector pEX or pBAD


D. mdnA as biobrick

Idea: Cloning of mdnA in iGEM cloning vector to submit as biobrick


E. Repetition of Elke's experiments as control for further experiments

Idea: Further, purify mdnA with the use of antibodies (anti myc-tag) and without HPLC. To compare which strategy is more efficient (myc-tag or HPLC) HPLC experiment as control is necessary.


F. mdnA with myc-tag (N- and C-terminal) in iGEM expression vector pEX or pBAD

Idea: myc-tagging of mdnA to purify it with antibodies (without use of HPLC)


G. Expression and purification of mdnA (with myc-tag)

Idea: Determine the efficiency of myc-tag/ antibody to purify mdnA.


To do Experimental tasks
A. Control experiment for error prone PCR (increased MnCl2 concentration) of mdnA (vector pARW089)
Preparative agarose gel electrophoresis
DNA extraction and purification of (positive) samples
Restriction enzyme digestion of mdnA using NarI and AatII; Splitting the samples fifty-fifty, heat one half of each sample 10-20 min at 65°C
Analytic agarose gel electrophoresis of each sample (heated and non-heated)
B. Random mutagenesis of mdnA and determination of mutation rate
Error prone PCR of mdnA (in vector pARW089) using increased MnCl2 concentration
Preparative agarose gel electrophoresis
DNA extraction and purification of the positive samples
Restriction enzyme digestion of mdnA and pARW089 using NarI and AatII
Preparative agarose gel electrophoresis of each sample
DNA extraction and purification of the positive samples
Ligation
Transformation
DNA isolation of one clone using midiprep/ miniprep
Sequencing
C. mdnA as expression part
PCR of mdnA in pARW089 using pf_mdnA_iGEM_EheI and pr_mdnA_iGEM_AatII (primer designed by phage display group)
Preparative agarose gel electrophoresis
DNA extraction and purification of the positive sample
Restriction enzyme digestion of mdnA and iGEM expression vector pEX or pBAD
Preparative agarose gel electrophoresis
DNA extraction and purification of the samples
Ligation
Transformation
DNA isolation of one clone using midiprep/ miniprep
Sequencing
D. mdnA in cloning vector
PCR of mdnA in pARW089 using pf_mdnA_iGEM_EheI and pr_mdnA_iGEM_AatII (primer designed by phage display group)
Preparative agarose gel electrophoresis
DNA extraction and purification of the positive sample
Restriction enzyme digestion of mdnA and iGEM expression vector pEX or pBAD
Preparative agarose gel electrophoresis
DNA extraction and purification of the samples
Ligation
Transformation
DNA isolation of one clone using midiprep/ miniprep
Sequencing
E. Repetition of Elke's experiments as control for further experiments
Expression and purification (HPLC; without myc-tag) of mdnA
x mdnA in pARW089
x mdnA in iGEM expression vector pEX or pBAD
F. mdnA with myc-tag (N- and C-terminal) in iGEM expression vector pEX or pBAD
PCR of mdnA in pARW089 using
x C-terminal: pf_mdnA_mycC_Xbal (forward) and pr_mdnA_mycC_PstI_NotI_SpeI (reverse)
x N-terminal: pf_mdnA_mycN_Xbal_1 (forward) and pr_mdnA_mycN_PstI_NotI_SpeI (reverse)
Preparative agarose gel electrophoresis
DNA extraction and purification of the positive samples
Restriction enzyme digestion of mdnA and iGEM expression vector pEX or pBAD
Preparative agarose gel electrophoresis
DNA extraction and purification of the samples
Ligation
G. Expression and purification of mdnA (with myc-tag)
x N-terminal myc-tag
x C-terminal myc-tag
Transformation of E. coli with pEX/ pBAD containing mdnA with myc-tag and with pARW089

23th Labday 2011-06-24

purification of pcr products 2011-06-23

Investigators: Sandrina


Aim:

  • purification of pcr products mdnA iGEM and geneIII iGEM (lanes number 2 + 3) for phage display (strategy 2)


Time: 2011-06-24, 14:30-15:30


Materials/Methods:

  • QIAquick Gel Extraction Kit (250)


Further tasks:

  • digestion of the two fragments with EheI and AgeI (mdnA iGem) and AatII and NgoMIV (geneIII iGEM)
  • digestion of vector pARW089 with EheI and AatII

preparation of competent E.coli XL1 and RV 308

Investigators: Stefan


Aim:

  • get competent cells of E. coli XL 1 blue and RV 308


Time: 2011-06-24, 14:00-19:30


Materials:

  • over night cultures: E.coli XL 1 blu and RV 308

Method:

Work always sterile and cold and speedy!

  • All volumes deal with the common cellline!
  • The cooling-centrifuge is in the tool shed (Geräteraum), cool down to 4°C early enough (Schalter hinten rechts), close the lid correctly!
  • Prepare early enough min. 100 Eppis (1,5µl) (per cellline) and cool down to -80°C before using
  • Use Milipore-filter for sterile CaCl2 , keep cool!
  • prepare 15ml LB-Medium (or DYT) with the specific antibiotic (XL1-blue ? Tet, BL21 ? none!), inoculate and incubate over night
  • prepare 200ml LB-Medium (or DYT) with the specific antibiotic, inoculate with 2ml of the over-night-culture. Nurture the culture until OD600 at 0,35 (0,2-0,5) (if the OD is too high, the cell won’t be competent)
  • keep cell suspension in sterile falcons (50ml) 20 min on ice, then centrifuge for 20min; 4°C; 2500g
  • discard supernatant, carefully resuspend on ice with 10ml cold CaCl2-solution (put a little of the 10ml solution in every falcon before!), pool every resuspended aliquot of one cell line and add 40ml CaCl2-solution (total volume 50ml). Keep 30 min on ice, then centrifuge for 20min; 4°C; 2500g
  • discard supernatant, carefully resuspend pellet in 5,5ml CaCl2(80mM)/Glycerol (4:1), use the pippete boy and a sterile glas pipette to dissolve the pellet
  • aliquot in Eppis á 60µl and store immediately at - 80 °C

Results:

  • 91 aliquots a 60 µL of XL1 and RF

Output:


Further tasks:

test the cells



Eppis in - 80°C in Boxen geräumt, aber noch nicht umbeschriftet

Midiprep of pEX carrying cells

Investigators: Nadine


Aim:

  • Midiprep of pEX


Time: 2011-06-24, 10:00-12:00


Materials:

  • Qiagen Plasmid Plus Midi Kit
  • over night cultures: 50 ml E.coli containing pEX from Tobi
  • NanoDrop

Method:

Midiprep


Output: 1x DNA Eppi Tubes: #5 pEX, 24.06.2011, storage: orange box (iGEM DNA, -20°C)

Results:

  • concentration:
    • tube 1: 248.4 ng/µl

Further tasks:


Glycerol stocks of E.coli cells carrying pEX and pBAD plasmids

Investigators: Nadine


Aim: Generating stocks for further research


Time: 2011-06-24,10:00-10:15


Materials:

  • Glycerol
  • 5 ml over-night culter of E.coli pBAD
  • 50 ml over-night culter of E.coli pEX (also for midi-prep)


Method:

  • 700 µl of cell suspension
  • 300 µl glycerol
  • mixed gently and frozen by -80°C


24th Labday 2011-06-27

Control experiment fpr error prone PCR and enzyme digestion of mdnA

Investigators: Nadine, Steffi, Katharina, Nicole


Time: 2011-06-27, 14:30-16:30


Aim: control experiment to verify error prone PCR and enzyme digestion of mdnA, which experiment was done previously

--> error prone PCR using increased MnCl2 concentration


Materials:

  • protocol of experiment, which was done previously; see2011-06-22


  • Genaxxon Bioscience taq Polymerase
  • 10x Genaxxon Bioscience taq Polymerase buffer containing 15 mM MgCl2
  • dNTPs (10 mM)
  • forward primer: sf_mdnA_1 (10 µM)
  • reverse primer: r_mdnA_1 (10 µM)
  • template DNA pARW089 (857,3 ng/ µl)
  • Genaxxon Bioscience MgCl2 stock solution (50 mM)
  • MnCl2
  • MnCl2 stock solution (50 mM)


Method:

1. Mix for error prone PCR with increasing MnCl2 concentration

Component Stock concentration Volume in µl Final concentration
Genaxxon Bioscience Taq Polymerase buffer containing MgCl2) 15 mM (MgCl2) 5 1.5 mM MgCL2
MgCl2 50 mM 5.5 5.5 mM
dNTPs 10 mM 2.0 0.4 mM
Primer (sf_mdnA_1) 10 µM 2.5 0.5 µM
Primer (r_mdnA_1) 10 µM 2.5 0.5 µM
DNA (diluted 1:100) 8.57 ng/ µl 8.0 0.7 ng
Polymerase 1 5 U


in addition MnCl2 and H2O as shown following

Sample number MnCl2 in µl Final concentration MnCl2 H2O in µl
1 0 0 23.5
2 0.5 0.05 mM 23.0
3 1.0 0.1 mM 22.5


2. Temperature profile

  • see 12th labday
  • Eppendorf Mastercycler personal, program IGMDNA1


Results:

  • 3 PCR products containing random mutated mdnA


Further tasks:

  • Verification of these PCR products by agarose gel electrophoresis
  • Extraction and purification these (positive) samples
  • Enzyme digestion using NarI and AatII
  • Heating the half of each samples 10-20 min by 65°C and the other half not
  • Verification using agrose gel electrophoresis


Midiprep of pJC354_WZA2 (TorA-bla vector) carrying cells

Investigators: Sebastian, Paul


Aim:

  • Midiprep of pJC354_WZA2 carrying cells using Quiagen Plasmid Plus Midi Kit


Materials:

  • Qiagen Plasmid Plus Midi Kit
  • over night cultures ###

Output: DNA Eppi Tube label (-20°C), Concentration: ~1mg/ml

Further tasks:

  • Annealing of oligos for cleavage sites
  • Digest of vector with XhoI and NheI
  • Ligation of annealed oligos into the vector


25th Labday 2011-06-28

Agarose gel electrophoresis of mutated mdnA

Investigators: Katharina


Aim: Verification of random mutated mdnA

Time: 2011-06-26,12:45-13:30


Materials:

  • Agarose broad range (Roth)
  • 1x TAE buffer
  • Gel Red


  • 3 PCR products of mutated mdnA
  • DNA Ladder Gene Ruler, 100bp plus, DNA Ladder (Fermentas)
  • 6x Loading Dye (Fermentas)


Method:

1. Production of a 1 % agarose gel

  • mAgarose = 0.5 g in 50 ml 1x TAE
  • adding 2 µl gel red


2. Loading samples

  • 30 µl PCR product and 6x loading dye
  • 2 µl DNA ladder gene ruler


3. Run

  • 100 V
  • time: 1 h


Results:

300px

lane Sample Volume in µl Expected size in bp
1 marker 2
2 PCR sample 1 50
3 PCR sample 2 50
4 PCR sample 3 50

Gel extraction of mutated mdnA

Investigators: Katharina


Aim: Extraction of mdnA, which was amplified and mutated (using error prone PCR)


Time: 2011-06-26,13:00-14:00


Materials:

  • NucleoSpin Extract II (Macherey-Nagel) extraction Kit
  • PCR products 1 and 2 containing mutated mdnA


Method:

  • performing gel extraction based on manufacturer's protocol
  • elute in 30 µl buffer NE


Results:

  • purified PCR products of mutated mdnA (1 and 2)


Further tasks:

  • restriction enzyme digestion with purified mdnA using AatII/ NarI
  • Verification by agarose gel electrophoresis

Restriction enzyme digestion and agarose gel electrophoresis of mutated mdnA

Investigators: Katharina


Time: 2011-06-28,14:00-17:00


Aim: Restriction enzyme digestion of random mutated mdnA and verification using gel electrophoresis


Materials:

  • Restriction enzymes: AatII, NarI
  • NEB Buffer 4
  • PCR products of random mutated mdnA(1 and 2), purified from gel
  • Agarose broad range (Roth)
  • 1x TAE buffer
  • Gel Red


  • DNA Ladder Gene Ruler, 100bp plus, DNA Ladder (Fermentas)
  • 6x Loading Dye (Fermentas)




Method:

1. Restriction enzyme digestion

  • 5 µl of purified PCR product were left undigested
components volume of PCR products /µl|
DNA 25
NEB Buffer 4(10x) 4
Enzyme AatII 1
Enzyme NarI 1
H2O 9
Total volume 40
  • digestion for 1 h
  • after digestion 17.5 µl of digested PCR product were taken for heat inactivation of the restriction enzyme (60°C for 20 min)

2. Production of 1 % agarose gels

  • mAgarose = 0.5 g in 50 ml 1x TAE
  • adding 2 µl gel red


3. Loading samples

a. restriction enzyme digestion products of random mutated mdnA

  • 35 µl PCR product and 5 µl 6x loading dye
  • 2 µl DNA ladder gene ruler, 100bp plus (Fermentas)


4. Run

  • 120 V
  • time: 45 min


Results:

File:UP Digestion Error Prone 2010-28-06.png

lane Sample Volume in µl Expected size in bp
1 marker 2
2 undigested mutated mdnA sample 1 5
3 digested mutated mdnA sample 1 17.5
4 digested and heat inactivated enzyme after digestion of mutaded mdnA sample 1 17.5
5 undigested mutated mdnA sample 2 5
6 digested mutated mdnA sample 2 17.5
7 digested and heat inactivated enzyme after digestion of mutaded mdnA sample 2 17.5

Error prone PCR (varied MnCl2 concentration) of mdnA

Investigators: Steffi


Time: 2011-06-28,15:00-15:50


Aim: Random mutation of mdnA gene based on increased MnCl2 concentration


Materials:

  • Genaxxon Bioscience Taq Polymerase
  • 10x Genaxxon Bioscience Taq Polymerase buffer containing 15 mM MgCl2
  • dNTPs (10 mM)
  • forward primer: sf_mdnA_1 (10 µM)
  • reverse primer: r_mdnA_1 (10 µM)
  • template DNA pARW089 (857,3 ng/ µl measured by Nanodrop a second time)
  • Genaxxon Bioscience MgCl2 stock solution (50 mM)
  • MnCl2
  • Eppendorf Mastercycler personal, program IGMDNA1


Error prone PCR of mdnA

  • increasing MnCl2 concentration

1. Mix for error prone PCR with increasing MnCl2 concentration

Component Stock concentration Volume in µl Final concentration
Genaxxon Bioscience Taq Polymerase buffer containing MgCl2) 15 mM (MgCl2) 5 1.5 mM MgCL2
MgCl2 50 mM 5.5 5.5 mM
dNTPs 10 mM 2.0 0.4 mM
Primer (each) 10 µM 2.5 0.5 µM
DNA (diluted 1:100) 8.57 ng/ µl 5.58 0.7 ng
Polymerase 1 5 U


2. Complete pipet scheme

Component in µl 1 2 3 4 5 6
Template DNA 8 8 8 8 8 8
dNTPs 2 2 2 2 2 2
10x Genaxxon polymerase buffer (with MgCl2) 5 5 5 5 5 5
MgCl2 (50 mM) 5.5 5.5 5.5 5.5 5.5 5.5
MnCl2 (5 mM) 0 0.5 1 1.25 1.5 2
Forward primer (sf_mdnA_1) 2.5 2.5 2.5 2.5 2.5 2.5
Reverse primer (r_mdnA_1) 2.5 2.5 2.5 2.5 2.5 2.5
H2O 23.5 23.0 22.5 22.25 22.0 21.5



3. Temperature profile

  • see 12th labday
  • Eppendorf Mastercycler personal, program IGMDNA1



Results:

  • 6 PCR products containing mutated mdnA


Further tasks:

  • Verification of these PCR products by agarose gel electrophoresis
  • Purification and cloning of positive samples
  • Sequencing


26th Labday 2011-06-29

5l LB Media (liquid)

Investigators: Sebastian, Niels


Aim: Generating media for further research


Materials:

  • Yeast (5 g/l)
  • Tryptone (10 g/l)
  • NaCl (10 g/l)
  • autoclaved


oligo hybridization for TEV and Precission protease cleavage sites

Investigators: Sebastian, Paul

Materials:

2 reaction batches: of_NheI_CS-TEV_XhoI (Cleavage site for TEV) and of_NheI_143C-cleavage_XhoI (Cleavage site for Precission)

  • 1 µl Oligo 1(of_NheI_CS-TEV_XhoI or of_NheI_143C-cleavage_XhoI forward)
  • 1 µl Oligo 2(of_NheI_CS-TEV_XhoI or of_NheI_143C-cleavage_XhoI reverse)
  • 4 µl 100mM TrisHCl pH 8
  • 8 µl 5 mM MgCl2
  • 26 µl H2O
  • Eppendorf Mastercycler personal, program ORIGAMI:

1 96°C 7 min

2 96°C 1 min

-1°C R=0,3°/s

goto 2 rep 70

hold 4°C

Restriction of pJC354_WZA2-vector

Investigators: Sebastian, Paul, Sascha

Materials:

  • XhoI (NEB), NheI (NEB)
  • 100x BSA (NEB), 10x buffer 4 (NEB)
  • pJC354_WZA2-vector

Protocol:

  • 1µl XhoI
  • 1µl NheI
  • 5µl 10x buffer 4
  • 0,5 µl vector [~500ng]
  • 0,5 µl 100x BSA
  • 42 µl pure H2O
  • Reaction for 2h at 37°C

Further tasks:

  • preparative agarose electrophoresis
  • Ligation of digested vector with annealed oligos (over night, 18°C)

preparative agarose electrophoresis

Investigators: Sebastian, Paul, Sascha

Method:

Samples digested with NheI and XhoI

vector: digested pJC354_WZA2 source: Janina; prep-type: midi-prep ; prep-date:24.06.11 ; clone-no: 6

  • control undigested pJC354_WZA2 source: Janina; prep-type: midi-prep ; prep-date:24.06.11 ; clone-no: 6

Electrophoresis

sample preparation: 50 µl pJC354_WZA2 (digested) + 10 µl 6x loading dye solution, 1 µl pJC354_WZA2 (undigested) + 1 µl 6x loading dye + 4 µl dest. water

0,5 g Agarose, 50 ml TAE (1%), 2 µl GELRED, at 115 Volt,running time:_?___ minutes

marker: GeneRuler ladder mix (Fermentas)


lane Sample Sample/µl Expected size (bp) approx. size
1
 marker
 6 µl

2
 pJC354_WZA2 (digested)
 ~40 µl 130, 4700 130, 8000, 2400
3
 pJC354_WZA2 (digested)
 ~20 µl 130, 4700 130, 8000, 2400
5
 pJC354_WZA2 (undigested)
 6 µl 4000 for supercoiled, 4700 for not supercoiled plasmid
 2400,2400-3000, 7500


            

300px

Gel Extraction

DNA excision: lane 2 and 3: 8000 bp band;

DNA purification: with QIAquick Gel Extraction Kit according to Qiagen manual (incl. isopropanol step)(done by Tobias)


Result: size estimation by eye;

lanes 2+3: plasmid was digested, small band has the expected size, two upper bands with unexpected size;

lanes 5: plasmid was undigested; 7500 bp unexpected; 3000 bp band might be undigested supercoiled plasmid

Conclusions:

  • exact vector fragment unknown, therefore 8000 bp band was
  • because of unexpected sizes marker should be compared with another marker, plasmids should be digested to yield several fragments for size control, maybe heat inactivation might help to resolve higher bands

Output: one plasmid fragments with 8000 bp in 1,5 ml eppis,

stored at -20 °C, box with fragments

PCR for amplification of mdnA with C-terminal myc-tag

Investigators: Jessica


Aim: amplificate mdnA of pARW089 and add C-terminal myc-tag with primers pf_mdnA_mycC_XbaI and pr_mdnA_mycC_PstI_NotI_SpeI


Time: 2011-06-29, 14:00-18:00


Materials:

  • NEB OneTaq DNA Polymerase
  • 5x Buffer NEB OneTaq
  • dNTPs (10 mM)
  • forward primer: pf_mdnA_mycC_XbaI (10 µM)
  • reverse primer: pr_mdnA_mycC_PstI_NotI_SpeI (10 µM)
  • template DNA pARW089
  • Eppendorf Mastercycler gradient, program SABRINA

50 µl reaction

Component Stock concentration Volume in µl Final concentration
5x Buffer NEB OneTaq 5x 10 1x
dNTPs 10 mM 1 0.2 mM
Primer (each) 10 µM 1 0.2 µM
DNA (diluted 1:100) 8.57 ng/ µl 5 ~0.7 ng
NEB OneTaq DNA Polymerase 0.25 1.5 U
H2O 31.75


Temperature profil

Temperature in °C Time in s
94 Hold
94 60 Initial denaturation
94 20 Denaturation
60 20 Annealing
72 20 Elongation
--> 15 cycles
94 60 Denaturation
70 40 Annealing
72 20 Elongation
--> 15 cycles
70 300 Final extension
6 Hold


Further tasks:
do gel electrophoresis

PCR of mdnA for phage display (strategy 1) repeated with new ordered forward primer

Investigators: Sandrina


Time: 2011-06-29,14:00-18:00


Aim: amplification of mdnA with SfiI restriction sites (vector pARW089) to clone it into pAk100 bla KDIR


Materials/Methods:

see 2011-06-10

changes:

  • elongation time 40 s
  • template 5 µl
  • program: Sabrina, eppendorf master cycler gradient


further tasks:

gel electrophoresis with pcr product

Error prone PCR (varied MnCl2 concentration) of mdnA

Investigators: Katharina


Time: 2011-06-29,12:00-13:00


Aim: Random mutation of mdnA gene based on increased MnCl2 concentration


Materials:

  • Genaxxon Bioscience Taq Polymerase
  • 10x Genaxxon Bioscience Taq Polymerase buffer containing 15 mM MgCl2
  • dNTPs (10 mM)
  • forward primer: sf_mdnA_1 (10 µM)
  • reverse primer: r_mdnA_1 (10 µM)
  • template DNA pARW089 (857,3 ng/ µl measured by Nanodrop a second time)
  • Genaxxon Bioscience MgCl2 stock solution (50 mM)
  • MnCl2
  • Eppendorf Mastercycler personal, program IGMDNA1


Error prone PCR of mdnA

  • increasing MnCl2 concentration

1. Mix for error prone PCR with increasing MnCl2 concentration

Component Stock concentration Volume in µl Final concentration
Genaxxon Bioscience Taq Polymerase buffer containing MgCl2) 15 mM (MgCl2) 5 1.5 mM MgCL2
MgCl2 50 mM 5.5 5.5 mM
dNTPs 10 mM 2.0 0.4 mM
Primer (each) 10 µM 2.5 0.5 µM
DNA (diluted 1:100) 8.57 ng/ µl 5.58 0.7 ng
Polymerase 1 5 U


2. Complete pipet scheme

Component in µl 1 2 3 4 5 6
Template DNA 8 8 8 8 8 8
dNTPs 2 2 2 2 2 2
10x Genaxxon polymerase buffer (with MgCl2) 5 5 5 5 5 5
MgCl2 (50 mM) 5.5 5.5 5.5 5.5 5.5 5.5
MnCl2 (5 mM) 0 0.5 1 1.25 1.5 2
Forward primer (sf_mdnA_1) 2.5 2.5 2.5 2.5 2.5 2.5
Reverse primer (r_mdnA_1) 2.5 2.5 2.5 2.5 2.5 2.5
H2O 23.5 23.0 22.5 22.25 22.0 21.5



3. Temperature profile

  • see 12th labday
  • Eppendorf Mastercycler personal, program IGMDNA1



Results:

  • 12 PCR products (each sample was prepared twice) containing mutated mdnA


Further tasks:

  • Verification of these PCR products by agarose gel electrophoresis
  • Purification, digestion and cloning of positive samples
  • Sequencing


27th Labday 2011-06-30

Agarose gel electrophoresis of myc-tagged mdnA and mdnA for phage display

Investigators: Nadja, Jessica, Sandrina


Aim: Verification of myc-tagged mdnA and mdnA for phage display (strategy 1)


Time: 2011-06-30,10:00-12:00

Materials:

  • Agarose broad range (Roth)
  • 1x TAE buffer
  • Gel Red
  • PCR products: myc-tagged mdnA, mdnA for phage display (strategy 1) from 2011-06-29
  • DNA Ladder Gene Ruler, 100bp plus (Fermentas)
  • 6x Loading Dye (Fermentas)


Method:

1. Production of a 1 % agarose gel

  • mAgarose = 0.5 g in 50 ml 1x TAE
  • adding 2 µl gel red

2. Loading samples

  • 5 µl PCR product and 6x loading dye
  • 2 µl DNA ladder gene ruler (1:10)

3. Run

  • 115 V
  • time: 1 h


Results:

lane Sample Volume in µl Expected size in bp
M marker 2
1 myc-tagged mdnA 6 233
2 mdnA with SfiI 6


UP AG PCR mdna 2011-06-30 JE 001.jpg

Agarose gel electrophoresis of error prone PCR of mdnA from 2011-06-29 and gel extraction

Investigators: Nadja, Jessica

Aim: Verification of random mutated mdnA

Time: 2011-06-30, 12:00-17:00

Materials:

  • Agarose broad range (Roth)
  • 1x TAE buffer
  • Gel Red
  • 12 PCR products: sample 1a to 6b from 2011-06-29
  • DNA Ladder Gene Ruler, 100bp plus (Fermentas)
  • 6x Loading Dye (Fermentas)

Method:

1. Production of a 1 % agarose gel

  • mAgarose = 0.5 g in 50 ml 1x TAE
  • adding 2 µl gel red
    2. Loading samples
  • 30 µl PCR product and 6x loading dye
  • 2 µl DNA ladder gene ruler (1:10)

3. Run

  • 115 V
  • time: 1 h

Results:

gel 1 gel 2
lane Sample Volume in µl Expected size in bp Sample Volume in µl Expected size in bp
M marker 2 marker 2
1 PCR sample 1a 36 276 PCR sample 4a 36 276
2 PCR sample 1b 36 276 PCR sample 4b 36 276
3 PCR sample 2a 36 276 PCR sample 5a 36 276
4 PCR sample 2b 36 276 PCR sample 5b 36 276
5 PCR sample 3a 36 276 PCR sample 6a 36 276
6 PCR sample 3b 36 276 PCR sample 6b 36 276


UP AG EPPCR mdnA 2011-06-30 JE 001.jpg UP AG EPPCR mdnA 2011-06-30 JE 002.jpg


Gel Extraction

  • DNA excision: PCR products 1a to 6b
  • DNA purification: with Qiagen Gel Extraction Kit according to Qiagen manual (incl. isopropanol step, elute in 30 µl H2O)

Results:

  • DNA concentrations measured with Nanodrop were lower than 10 ng/µl


Further tasks:

  • repeat with remaining PCR samples?

Repeated PCR of mdnA for phage display (strategy 1) repeated with new ordered forward primer

Investigators: Sandrina, Sabine


Time: 2011-06-30,15:00-18:00


Aim: amplification of mdnA with SfiI restriction sites (vector pARW089) to clone it into pAk100 bla KDIR


Materials/Methods:

see 2011-06-10

changes:

  • elongation time 40 s
  • template 5 µl
  • program: Sabrina, eppendorf master cycler gradient


further tasks:

gel electrophoresis with pcr product

Retrieved from "http://2011.igem.org/Team:Potsdam_Bioware/Labjournal/June"