Team:Freiburg/Notebook/22 August

From 2011.igem.org

(Difference between revisions)
(Sequencing)
(PCR)
Line 27: Line 27:
P 24:
P 24:
*tatgaattcgcggccgcttctag
*tatgaattcgcggccgcttctag
 +
 +
 +
PCR was loaded onto a gel.
==<span style="color:red;">red light receptor</span>==
==<span style="color:red;">red light receptor</span>==

Revision as of 14:09, 22 August 2011


This is the wiki page
of the Freiburger student
team competing for iGEM 2011.
Thank you for your interest!