"
Team:Freiburg/Notebook/22 August
From 2011.igem.org
(Difference between revisions)
(→NAME OF YOUR EXPERIMENT) |
(→Sequencing) |
||
| Line 12: | Line 12: | ||
===Sequencing=== | ===Sequencing=== | ||
| + | |||
| + | '''Investigators: Sandra''' | ||
The sequencing showed that the 3A-assembly did not work. | The sequencing showed that the 3A-assembly did not work. | ||
We will send the LovTap PCR product to get sequenced. May be the PCR did not work. | We will send the LovTap PCR product to get sequenced. May be the PCR did not work. | ||
| + | |||
| + | ===PCR=== | ||
| + | |||
| + | PCR of Not-Gate. | ||
| + | |||
| + | P 74: | ||
| + | *actgcagcggccgctgctagca | ||
| + | |||
| + | P 24: | ||
| + | *tatgaattcgcggccgcttctag | ||
==<span style="color:red;">red light receptor</span>== | ==<span style="color:red;">red light receptor</span>== | ||
Revision as of 14:09, 22 August 2011
Contact 
This is the wiki page of the Freiburger student team competing for iGEM 2011. Thank you for your interest!
