Team:Tokyo-NoKoGen/photocontrol

Metallothioneins (metal-binding proteins) and metal transporters

1. Background

Heavy metals such as Cd(II) and As(III) used in industry and urban are deposited into the land and ocean. They are taken into our body through drinking water, fish and crops, which are causing serious problem against human health. To get rid of them from contaminated soil and water is a serious issue we need to solve and think about.

Today, proteins called metallothionein that can bind to metal ions are reported. By using such property of metallothionein, we have decided to make a metal ion cleaning device. Our metal cleaning system will work like this – we will make an E.coli that can produce metallothionein inside the cell. It will also synthesize transporters to take in metal ions from its surrounding, to make the metal cleaning faster and more effective. The absorbed metal ions will bind specifically to the metallothionein, which will then be collected inside the BMC (bacterial microcompartment).

What are metallothioneines?

We will focus on two metallothioneins, each paired up with transporters. Team Groningen in iGEM2009 has introduced fMT (an arsenic binding metallothionein) and Glpf (arsenic transporter). We will further use and characterize their parts in our metal cleaning E.coli to collect arsenite. A new metallothionein that we will introduce this year in iGEM, will be SmtA (Cadmium binding metallothionein) and MntH (Cadmium transporter).

SmtA is found in Synechococcus sp. PCC7942 and has been reported that the cyanobacterial strain expressing SmtA reaches a higher OD550 in a cadmium containing medium.

The E.coli K-12 derived MntH (yfep) are transporters that are highly homologous to the Nramp protein family (metal ion transporters), and are known to be able to transport a variety of metal ions including Cd2+ [2]. A study has shown that MntH facilitates transport of Mn2+ in a time-, temperature-, proton-dependent manner.

To make metallothionein be taken into the BMC, we will fuse SmtA and fMT with PduP1-18 - a protein that is recognized and is taken into pdu BMC (propanediol-utilizing BMC).

We will integrate SmtA, MntH, fMT and Glpf into our metal ion collecting E.coli to collect cadmium and arsenic ions.

2. Method

Our aim is to construct a vector with transporter under a constitutive promoter, and the metallothionein under a metal-sensitive promoter as shown on the diagram.

2-1. Cloning SmtA from Synechococcus sp. PCC7942

SmtA sequence shown in red, Restriction sites shown in pink

Primers to clone and add restriction sites EcoRI, XbaI and SpeI.

Fw primer: AGAATTCGCGGCCGCATCTAGATGACCTCAACAACGTTGGTC

Rv primer: GCTACTAGTATTAGCCGTGGCAGTTACAG

2-2. Cloning MntH

MntH sequence shown in green

Restriction sites shown in pink

Primers to clone and add restriction sites EcoRI, XbaI and SpeI.

Fw primer: AGAATTCGCGGCCGCATCTAGAGAATTTTTTTGC

Rv primer: GCTACTAGTAGGAGCACAAT

The cloned products were cut at EcoRI and SpeI and ligated to PSB1C3 vector which was also cut at EcoRI and SpeI.

2-3. Construct PduP1-18 fused to SmtA and fMT

We originally had PduP1-18 fused with GFP, so we carried out inverse PCR to amplify the part without GFP. We then cut the product at EcoRI and SpeI to add them to the vector containing metallothionein which were cut at EcoRI and XbaI.

2-4. Characterize the effect of expressing SmtA and GlpF in E.coli cultured in Cd(II) containing medium.

LB medium with different cadmium concentrations (0, 100, 120, 150, 180, 210, 240, 270, 300, 400 µM) was prepared in a microtiter plate as shown in the diagram below, and observed the change in OD595 and compared the differences between WT E.coli, E.coli expressing PduP1~18-SmtA, and E.coli expressing PduP1~18-fMT.

We will prepare a LB medium with different cadmium concentrations in a microtiter plate as shown in the diagram below, and see the change in OD660 and compare the differences between WT E.coli, E.coli expressing metallothionein, and E.coli expressing transporter.

3. Result

As Cd(II) concentration goes up, growth of E. coli starts to slow down. At 270 mM , 300 mM and 400 mM Cd(II) concentration, there is no difference in the OD595 between E. coli. However, at 240 mM Cd(II) medium, E. coli expressing PduP1~18-fMT showed a rise in its OD595 at around 6 hours. The difference becomes more significant as the Cd(II) concentration decreases, until it reaches a concentration of 120 mM where the growth between metallothionein expressing E. coli and the wild type becomes very similar. Unfortunately we could not see SmtA to function as a metallothionein, as it showed a similar growth curve to the wild type E. coli. However, looking at the graphs showing growth curves at Cd(II) concentrations 150 mM, 180 mM and 210 mM, cells expressing fMT shows a significant growth when compared to the growth of wild type. This result suggests that fMT bound to Cd(II) taken up by the cell, and allowed them to resist Cd(II) better than the cells without metallothionein. Our PduP1~18 fused fMT showed to maintain its function inside the E. coli.

4. Summary

TBD- As Cd(II) concentration goes up, growth of E. coli starts to slow down. At 270 mM , 300 mM and 400 mM Cd(II) concentration, there is no difference in the OD595 between E. coli. However, at 240 mM Cd(II) medium, E. coli expressing PduP1~18-fMT showed a rise in its OD595 at around 6 hours. The difference becomes more significant as the Cd(II) concentration decreases, until it reaches a concentration of 120 mM where the growth between metallothionein expressing E. coli and the wild type becomes very similar. Unfortunately we could not see SmtA to function as a metallothionein, as it showed a similar growth curve to the wild type E. coli. However, looking at the graphs showing growth curves at Cd(II) concentrations 150 mM, 180 mM and 210 mM, cells expressing fMT shows a significant growth when compared to the growth of wild type. This result suggests that fMT bound to Cd(II) taken up by the cell, and allowed them to resist Cd(II) better than the cells without metallothionein. Our PduP1~18 fused fMT showed to maintain its function inside the E. coli.

5. Reference

[1] Sode et al. (1998) Construction of a marine cyanobacterial strain with increased heavy metal ion tolerance by introducing exogenic metallothionein gene. J Mar Biotechnol

[2] Makui et al. (2000) Identification of Escherichia coli K-12 Nramp orthologue (MntH) as a selective divalent metal ion transporter. Molecular Microbiology