"
Team:Kyoto/Material
From 2011.igem.org
(Difference between revisions)
(→Strains(E.Coli)) |
(→Strains(E.Coli)) |
||
| Line 14: | Line 14: | ||
</table> | </table> | ||
==Strains(E.Coli)== | ==Strains(E.Coli)== | ||
| - | + | {| class="materials" | |
| - | + | !Name||Genotype and/or Relevant Features||Source or Reference | |
| - | + | |- | |
| - | + | | JM109 | |
| - | + | | <i>end</i>A, <i>rec</i>A1, <i>gyr</i>A96,<i>thi</i>,<i>hsd</i>R17,(r<sub>κ</sub><sup>-</sup>,m<sub>κ</sub><sup>+</sup>),<i>rel</i>A1, <i>sup</i>E44,λ<sup>-</sup>,Δ(<i>lac-pro</i>AB),[F',<i>tra</i>D36,<i>pro</i>AB,<i>lac</i>l<sup>q</sup><i>Z</i>ΔM15] | |
| - | + | |Promega[http://www.promega.com/products/cloning-and-dna-markers/cloning-tools-and-competent-cells/bacterial-strains-and-competent-cells/bacterial-strain-jm109_de3_/] | |
| - | λ<sup>-</sup>,Δ(<i>lac-pro</i>AB),[F',<i>tra</i>D36,<i>pro</i>AB,<i>lac</i>l<sup>q</sup><i>Z</i>ΔM15] | + | |- |
| - | + | | BW25113 | |
| - | + | | ∆(araD-araB)567, ∆lacZ4787(::rrnB-3), lambda-, rph-1, ∆(rhaD-rhaB)568, hsdR514 | |
| - | + | | E.coliwiki[http://ecoliwiki.net/colipedia/index.php/BW25113] | |
| - | BW25113 | + | |} |
| - | ∆(araD-araB)567, ∆lacZ4787(::rrnB-3), lambda-, rph-1, ∆(rhaD-rhaB)568, hsdR514 | + | |
| - | E.coliwiki[http://ecoliwiki.net/colipedia/index.php/BW25113] | + | |
==Primers== | ==Primers== | ||
Revision as of 22:13, 4 October 2011
Contents |
Materials
Strain(Fruits Fly)
| Name | Genotype and/or Relevant Features | Source or Reference |
|---|---|---|
| D.melanogaster(fly) | Oregon-R-C | DGRC[http://kyotofly.kit.jp/cgi-bin/stocks/search_res_det.cgi?DB_NUM=1&DG_NUM=105669] |
Strains(E.Coli)
| Name | Genotype and/or Relevant Features | Source or Reference |
|---|---|---|
| JM109 | endA, recA1, gyrA96,thi,hsdR17,(rκ-,mκ+),relA1, supE44,λ-,Δ(lac-proAB),[F',traD36,proAB,laclqZΔM15] | Promega[http://www.promega.com/products/cloning-and-dna-markers/cloning-tools-and-competent-cells/bacterial-strains-and-competent-cells/bacterial-strain-jm109_de3_/] |
| BW25113 | ∆(araD-araB)567, ∆lacZ4787(::rrnB-3), lambda-, rph-1, ∆(rhaD-rhaB)568, hsdR514 | E.coliwiki[http://ecoliwiki.net/colipedia/index.php/BW25113] |
Primers
| Date | Name | Sequence |
|---|---|---|
| 07/21 | S Forward (Same as SRRz Forward) | gGAATTCGCGGCCGCTTCTAGAGgcctggatttgttctatcagtaatcga |
| 07/21 | S Reverse | CTGCAGCGGCCGCTACTAGTAttattgatttctaccatcttctactccggc |
| 07/21 | SRRz Reverse | CTGCAGCGGCCGCTACTAGTAtgagttgcccatcgatatgggc |
| 07/28 | ΔTMD1 Forward | cgcggcagatataatggcggt |
| 07/28 | ΔTMD1 Reverse | gtcatgtttttctggcatcttcatgtct |
| 08/19, 08/24 | Sam7 Forward | ggttcattcgtgaccttctcgacttc |
| 08/19, 08/24 | Sam7 Reverse | aggcgataatggcgcacatc |
| 08/20 | SRRz Forward Retry | gGAATTCGCGGCCGCTTCTAGAGgagcaaatccccttattgggggtaagacatg |
| 08/20 | SRRz Reverse Retry | CTGCAGCGGCCGCTACTAGTAgcaactctatctgcactgctcattaatatacttctgg |
| 08/23, 08/24 | Deletion of Upstream Forward | gagcaaatccccttattgggggtaagacatg |
| 08/23, 08/24 | Deletion of Upstream Reverse | ctctagaagcggccgcgaattcc |
| 09/13, 09/22 | Add J23105 Forward | CAGTCCTAGGTACTATGCTAGCtactagtagcggccgctgc |
| 09/13, 09/22 | Add J23105 Reverse | AGCTAGCCGTAAActctagtatataaacgcagaaaggcccacc |
| 10/10 | Deletion of GFP Forward (Primer1) | ccaggcatcaaataaaacgaaaggctc |
| 10/10 | Deletion of GFP-DT Forward (Primer2) | tactagtagcggccgctgc |
| 10/10 | Deletion of GFP, GFP-DT Reverse (Primer3) | ctctagtattattgatttctaccatcttctactcc |
| - | VF2 (<partinfo>G00100</partinfo>) | tgccacctgacgtctaagaa |
| - | VF (<partinfo>G00101</partinfo>) | attaccgcctttgagtgagc |
