"
Team:Kyoto/Material
From 2011.igem.org
(Difference between revisions)
(→Materials) |
(→Materials) |
||
| Line 5: | Line 5: | ||
=Materials= | =Materials= | ||
==Strain(Fruits Fly)== | ==Strain(Fruits Fly)== | ||
| + | <table class="materials"> | ||
| + | <tr> | ||
| + | <th>Name</th><th>Genotype and/or Relevant Features</th><th>Source or Reference | ||
| + | </th></tr> | ||
| + | <tr> | ||
| + | <td>D.melanogaster(fly)</td><td>Oregon-R-C</td><td>DGRC[http://kyotofly.kit.jp/cgi-bin/stocks/search_res_det.cgi?DB_NUM=1&DG_NUM=105669] | ||
| + | </td></tr> | ||
| + | </table> | ||
==Strains(E.Coli)== | ==Strains(E.Coli)== | ||
| + | <table class="materials"> | ||
| + | <tr> | ||
| + | <th>Name</th><th>Genotype and/or Relevant Features</th><th>Source or Reference | ||
| + | </th></tr> | ||
| + | <tr> | ||
| + | <td>JM109</td><td><i>end</i>A, <i>rec</i>A1, <i>gyr</i>A96,<i>thi</i>,<i>hsd</i>R17,(r<sub>κ</sub><sup>-</sup>,m<sub>κ</sub><sup>+</sup>),<i>rel</i>A1, <i>sup</i>E44, | ||
| + | λ<sup>-</sup>,Δ(<i>lac-pro</i>AB),[F',<i>tra</i>D36,<i>pro</i>AB,<i>lac</i>l<sup>q</sup><i>Z</i>ΔM15] | ||
| + | <td>Promega[http://www.promega.com/products/cloning-and-dna-markers/cloning-tools-and-competent-cells/bacterial-strains-and-competent-cells/bacterial-strain-jm109_de3_/] | ||
| + | </td></tr> | ||
| + | |||
{| class="materials" | {| class="materials" | ||
!Name||Genotype and/or Relevant Features||Source or Reference | !Name||Genotype and/or Relevant Features||Source or Reference | ||
Revision as of 03:07, 30 September 2011
Contents |
Materials
Strain(Fruits Fly)
| Name | Genotype and/or Relevant Features | Source or Reference |
|---|---|---|
| D.melanogaster(fly) | Oregon-R-C | DGRC[http://kyotofly.kit.jp/cgi-bin/stocks/search_res_det.cgi?DB_NUM=1&DG_NUM=105669] |
Strains(E.Coli)
| Name | Genotype and/or Relevant Features | Source or Reference |
|---|---|---|
| JM109 | endA, recA1, gyrA96,thi,hsdR17,(rκ-,mκ+),relA1, supE44,
λ-,Δ(lac-proAB),[F',traD36,proAB,laclqZΔM15] | Promega[http://www.promega.com/products/cloning-and-dna-markers/cloning-tools-and-competent-cells/bacterial-strains-and-competent-cells/bacterial-strain-jm109_de3_/] |
| Name | Genotype and/or Relevant Features | Source or Reference |
|---|---|---|
| TOP10 | F-, mcrA, Δ(mrr-hsdRMS-mcrBC), φ80lacZΔM15, ΔlacX74, nupG, recA1, araD139, Δ(ara-leu)7697, galE15, galK16 rpsL(StrR), endA1, λ- | Invitrogen |
| KRX | [F′, traD36, ΔompP, proA+B+, lacIq, Δ(lacZ)M15] ΔompT, endA1, recA1, gyrA96 (Nalr), thi-1, hsdR17 (rk–, mk+), e14– (McrA–), relA1, supE44, Δ(lac-proAB), Δ(rhaBAD)::T7 RNA polymerase. | Laboratory of Gene Biodynamics, Graduate School of Biostudies, Kyoto University |
| (Promega [http://www.promega.com/catalog/catalogproducts.aspx?categoryname=productleaf_1698]) | ||
| BL21(DE3)pLysS | F–, ompT, hsdSB (rB–, mB–), dcm, gal, λ(DE3), pLysS, Cmr. | Promega [http://www.promega.com/catalog/catalogproducts.aspx?categoryname=productleaf_1005] |
DNA
| Name | Source or Reference |
|---|---|
| Lambda Phage (cI857 Sam7) | DNA Digested Markers (#3403 λ-Hind III digest) from Takara Bio [http://catalog.takara-bio.co.jp/en/product/basic_info.asp?unitid=U100005399] |
| http://www.ncbi.nlm.nih.gov/nuccore/NC_001416 |
Primers
| Date | Name | Sequence |
|---|---|---|
| 07/21 | S Forward (Same as SRRz Forward) | gGAATTCGCGGCCGCTTCTAGAGgcctggatttgttctatcagtaatcga |
| 07/21 | S Reverse | CTGCAGCGGCCGCTACTAGTAttattgatttctaccatcttctactccggc |
| 07/21 | SRRz Reverse | CTGCAGCGGCCGCTACTAGTAtgagttgcccatcgatatgggc |
| 07/28 | ΔTMD1 Forward | cgcggcagatataatggcggt |
| 07/28 | ΔTMD1 Reverse | gtcatgtttttctggcatcttcatgtct |
| 08/19, 08/24 | Sam7 Forward | ggttcattcgtgaccttctcgacttc |
| 08/19, 08/24 | Sam7 Reverse | aggcgataatggcgcacatc |
| 08/20 | SRRz Forward Retry | gGAATTCGCGGCCGCTTCTAGAGgagcaaatccccttattgggggtaagacatg |
| 08/20 | SRRz Reverse Retry | CTGCAGCGGCCGCTACTAGTAgcaactctatctgcactgctcattaatatacttctgg |
| 08/23, 08/24 | Deletion of Upstream Forward | gagcaaatccccttattgggggtaagacatg |
| 08/23, 08/24 | Deletion of Upstream Reverse | ctctagaagcggccgcgaattcc |
| 09/13, 09/22 | Add J23105 Forward | CAGTCCTAGGTACTATGCTAGCtactagtagcggccgctgc |
| 09/13, 09/22 | Add J23105 Reverse | AGCTAGCCGTAAActctagtatataaacgcagaaaggcccacc |
| 10/10 | Deletion of GFP Forward (Primer1) | ccaggcatcaaataaaacgaaaggctc |
| 10/10 | Deletion of GFP-DT Forward (Primer2) | tactagtagcggccgctgc |
| 10/10 | Deletion of GFP, GFP-DT Reverse (Primer3) | ctctagtattattgatttctaccatcttctactcc |
| - | VF2 (<partinfo>G00100</partinfo>) | tgccacctgacgtctaagaa |
| - | VF (<partinfo>G00101</partinfo>) | attaccgcctttgagtgagc |
