Plasmid Integration Protocol (for CRIM plasmids)
1. Prepare electrocompetent cells that have been transformed with the helper plasmid (pAH57) and that have been grown in 5 mL SOB to an OD of 600nm of ca. 0.6 with ampicillin antibiotic at 30 degC.
2. Perform an electroporation transformation with the BioBrick Compatible Lambda Chromosomal Insertion Plasmid making sure to resuspend the cells in 1 mL of SOC (without ampicillin). Incubate at 37 degC for 1 hour, and then 42 degC for 30 minutes. Spread plate onto a selective agar plate and incubate at 37 degC.
K617000 Creation
Day 1
The CRIM pAH125 vector was obtained in a pir+ strain. The culture was streaked from the -80C onto a LB kanamycin 30ug/mL plate. Plate was incubated 37C for 18 hours. White colonies resulted.
A single colony was picked from the previous plate and was used to inoculate 6mL of LB kanamycin 30ug/mL. The culture was then incubated 37C on a tube turner for 16 hours. A turbid yellow-white culture resulted.
5mL of the culture was pelleted and miniprepped using the Promega mini-prep kit and protocol described in our protocol download. The resulting concentration was 30ng/uL.
The plasmid map of pAH125 is shown below:
The following primers were then designed in order to amplify the highlighted (red)section below. The primers contain overhangs such that subsequent SpeI digestion and an intramolecular ligation of the pcr product will produce a biobrick cloning site, which replaces the original MCS and lacZ ORF in the pAH125 diagram.
Primers:
ATCG T ACTAGT A GCGGCCG CTGCAG CAGTGAATTAATGGCGATGACGC
Tm = 68 C
GC = 48%
ATCG ACTAGTA CTCTAGAAGCGGCCGCGAATTC GCATGCAAGCTTGGCACTGG
Tm = 64 C
GC = 60%
The following PCR rxn was then set up and run with the subsequent parameters:
0.3 uL pAH125
2uL primer 1 (100ng/uL)
2uL primer2 (100ng/uL)
5uL 10X Pfu buffer (Agilent)
2.5uL 10mM dNTP mix
1uL Turbo Polymerase (Agilent)
37uL ddH2O
95C 5 min
95C 30sec
59C 30 sec
72C 3 min
Cycle 30X
72C 5 min
14C forever
The pcr rxn was then purified using a Qiagen pcr purification kit. Resulting concentration was 99ng/uL.
500ng of the reaction was then digested SpeI with the following reaction set up:
0.5uL pcr product
5uL NEB Buffer 2
1uL 100X BSA
1uL SpeI (from NEB)
42.5uL ddH2O
Digest ran 1 hour 37C and was followed by an 80C heat inactivation.
2uL of the digestion reaction was then used in a 20 uL volume ligation reaction. Set up was as follows:
2uL SpeI digest
2uL 10X Promega T4 ligase buffer
1uL Promega T4 ligase
15uL ddH2O
Ligation reaction ran at for 8 hours at 15C.
3uL of the ligation reaction was then transformed into two strains via heat shock as described in our protocol download. The first strain was a normal pir- DH5alpha E. coli strain and the second was a E. coli K-12 pir-116 strain. The latter should allow replication of the plasmid while the first should not. The transformations were plated on LB kan 30ug/mL. Plates were incubated 18 hours at 37C. The following pictures show that robust colonies resulted on the pir-116 transformant plate but not on the pir- DH5alpha plate.
(above) pir-116 transformations, (below) DH5alpha pir- transformation
Canidate colonies were then picked off the pir-116 plate and grown up in 6mL LB kanamycin 30ug/mL. The resulting cultures were miniprepped and the products digested EcoRI, PstI. The resulting restriction profile was expected to yield a 2.4 kb band. The four canidates were run on a gel (see the lower left quadrant of the below picture:
Three out of the four candidates were a match, the top most candidate was sent in as K617000. It has showed the correct restriction profile of 2.4kb when digested with EcoRI and PstI and as been shown to replicate in pir-116 but not DH5alpha pir-. A final gel of K617000 digested EcoRI, PstI is shown below, highlighted in red.
The restriction profiles of submitted parts K617003 and 004 are also shown on the same gel above (EcoRI, PstI digested).
Plasmid Integration Protocol (for CRIM plasmids)
K617003 and K617004 Creation
Set up pcr reactions using the pAH125 template miniprep that was also used for the creation of the K617000 plasmid. Concentration is 30ng/uL
Lambda attP P’OP pcr (K617004)
Primer 1
ATCG GAATTC GCGGCCGC T TCTAGA G CCATGGCATCACAGTATCGTG
Tm = 64 C (eq)
Primer 2
ATCG CTGCAGCGGCCGCTACTAGTA AGCTTTGCACTGGATTGCGAG
Tm = 64 C (eq)
GC=52%
0.3uL pAH125
2uL primer 1 (100ng/uL)
2uL primer2 (100ng/uL)
5uL 10X Pfu Buffer
2.5uL 10mM dNTP mix
1uL Turbo Polymerase
37uL ddH2O
95C 5 min
95C 30 sec
59C 30 sec
72C 1 min
Cycle 30X
72C 5 min
4C forever
R6K origin pcr (K617003)
Primer 1’
ATCG GAATTC GCGGCCGC T TCTAGA G CCATGTCAGCCGTTAAGTGTTCC
Tm(eq)= 70 C
GC = 52%
Primer2’
ATCG CTGCAGCGGCCGCTACTAGTA GATCTGAAGATCAGCAGTTCAACC
Tm(eq)= 70 C
GC = 46%
0.3uL pAH125
2uL primer 1’ (100ng/uL)
2uL primer2’ (100ng/uL)
5uL 10X Pfu Buffer
Both pcr reactions were pcr purified using Qiagen pcr purification kits. Both concentrations were approximately 90 ng/uL.
Products were then digested EcoRI PstI and assembled with pSB1C3 also cut EcoRI PstI to release an RFP generator. Ligation reactions were performed as previously described (between pSB1C3 and the digested pcr fragments). LB Chloramphenicol 25ug/mL were used for selection as well as red white selection as seen in pictures below.
The three section gel previsouly shown confirms the correct canidates were picted for K617003 and 004.
"
