Team:Potsdam Bioware/Labjournal/August part 1

From 2011.igem.org

(Difference between revisions)

Revision as of 12:52, 21 September 2011

1 50th Labday 2011-08-01
2 51th Labday 2011-08-02
3 52th Labday 2011-08-03
- 3.1 Transformation of generated pPDV089 (strategy 2)
- 3.2 Ligation of pBAD-mYFP Venus and pEX_HisII with pSB1_K3 and pSB1_A3
4 53th Labday 2011-08-04
- 4.1 digestion of vector pARW089 (strategy 2)
- 4.2 digestion of PCR products vector pARW089 (strategy 2)
5 54th Labday 2011-08-05
6 55th Labday 2011-08-06
7 56th Labday 2011-08-07
8 57th Labday 2011-08-08
9 58th Labday 2011-08-09
10 59th Labday 2011-08-10
11 60th Labday 2011-08-11
12 61th Labday 2011-08-12
13 62th Labday 2011-08-13
- 13.1 Mini-Prep of pUP_SG1_ssTorA_CS-TEV_bla_AraC-TEV and creation of glycerol stock culture
- 13.2 Miniprep of pSB1X3 + Y (X - A/T/K ; Y - YFP/CFP)
14 63th Labday 2011-08-14
15 64th Labday 2011-08-15
16 65th Labday 2011-08-16

50th Labday 2011-08-01

Sequencing of mutated mdnA genes

Investigators: Steffi, Vanessa, Nicole

Aim: Determination of mutation rate employing sequencing of mutated mdnA

Time: 2011-08-01,10:00-13:00

Materials:

Miniprep of mutated mdnA and restricted for 2 resp. 3 hours

Sequencing Primer: sf_mdna_1

Freelabels for Value ReadTube (MWG Eurofins)

Method:

DNA concentration (for sequencing): 100 ng/ µl

Total volume: 15 µl

Primer concentration: 2 pmol/ µl

Total volume: 200 µl (approx. 15 µl per sequencing reaction)

sent to MWG Eurofins with the aid of Free sample bags

Further tasks:

Analyzing sequencing results

Determination of mutation rates

Ligation of mdnA and GeneIII for phage display (strategy 2)

Investigators: Leif

Aim:ligation of mdnA and GenIII to get a fusion gene for phage display

Time: 11:00-13:00

Method:

ligation-samples from 2011-07-27;

Protocol:

5 µl (ca 25 ng) digested geneIII (NgoMIV, AatII)

3 µl (ca 30 ng) digested mdnA (NarI, AgeI)

2 µl 10x T4 Ligase Buffer

1 µl T4 Ligase

9 µl water

2 h, room temperature

Further tasks:
ligation into vector

Ligation of mdnA/GeneIII-fusion gene into pARW089 for phage display (strategy 2)

Investigators: Leif

Aim: ligation of mdnA and GenIII to get a fusion gene for phage display

Time: 11:00-13:00

Method:

ligation-samples from 2011-08-01;

Protocol:

6 µl (ca 70 ng) digested vector pARW089 (NarI, AatII)

1 µl (ca 5 ng) fusion gene mdnA/geneIII

2 µl 10x T4 Ligase Buffer

1 µl T4 Ligase

10 µl water

2 h, room temperature, then over night in the freezer

Further tasks:
transformation of E. coli

Mutagenesis of 14_3C and TEV proteases to remove iGEM restriction sites from the proteases and introduction of iGEM restriction sites

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul, Sebastian

Aim:

Removal of iGEM restriction sites from proteases, amplifying protease fragments with iGEM restriction sites

Materials:

Plasmid 1: pET9d_Thrombin-CS_XbaI-TEV-Protease_BamHI

Primers: (1) f_TEV_ACCAGC , r_TEV_iGEM_BahmHI (2) r_TEV_ACCAGC , f_TEV_AraFusion_NgoMIV

Plasmid 2: pGEX-3_14_3C

Primers: (1) f_14_3C_ACCAGC, r_14_3C_iGEM_BamHI (2) r_14_3C_ACCAGC, f_14_3C_AraFusion_NgoMIV

Used method:

PCR

Template: 1µl = 3,6 ng

Nucleotides: 1µl of 10mM ready to use dNTP mix

5µl 10x Amplification buffer S

5µl 25mM MgCl2

2,5µl primers = 25pmol absolute (2,5µl of each primer = 5µl per tube)

32,5µl of pure water

0,5µl TaqPol

Program: iGEM001

Denat: 3min 94°C

5x:

Denat: 45sec 94°C

Anneal:45sec 53°C

Extend:45sec 72°C

25x:

Denat: 45sec 60°C

Anneal:45sec 60°C

Extend:45sec 72°C

Final Extend: 10min 72°C

Result:

Resolving of PCR products (10µl) on 2% agarose gel

Expected Fragments:

TEV:

TEV_mut_fragI: 360bp

TEV_mut_fragII: 400bp

14_3C:

14_3C_mut_fragI: 420bp

14_3C_mut_fragII: 153bp

Further going:

40µl of PCR products left:*20µl for preparative agarose gel (2%)

20µl for PCR purification Kit

Assembly PCR of purificated products to produce NgoMIV_iGEM_TEV-Protease_iGEM_BamHI and NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI

Amplification of Arabinose Induction System from pBAD_iGEMexpress

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul, Sebastian

Aim:

Amplificarion of an arabinose induction system (AraC) from pBAD_iGEMexpress plasmid, produces a 1273bp fragment

Materials:

Plasmid: pBAD_iGEMexpress (Nr.4)

Primers: f_AraC_HindIII_iGEM , r_AraC_NgoMIV

Used method:

PCR

Template: 1µl = 7,2 ng

Nucleotides: 1 µl of 10mM ready to use dNTP mix

5µl 10x Amplification buffer S

5µl 25mM MgCl2

2,5µl primers = 25pmol absolute (2,5µl of each primer = 5µl per tube)

32,5µl of pure water

0,5µl TaqPol

Program: iGEM002

Denat: 3min 94°C

5x:

Denat: 60sec 94°C

Anneal:60sec 53°C

Extend:60sec 72°C

25x:

Denat: 60sec 60°C

Anneal:60sec 60°C

Extend:60sec 72°C

Final Extend: 10min 72°C

Result:

Resolving of PCR products (10µl) on 1% agarose gel

Expected Fragments: HindIII_iGEM_AraC_NgoMIV 1273bp

Further tasks:

30µl of PCR product left: (1) Preparative Agarose Gel + Extraction(2) Digestion of fragment with HindIII and NgoMIV and gel purification (3) Ligation with (digested) NgoMIV_14_3C-Protease_iGEM_BamHI or NgoMIV_TEV_iGEM_BamHI fragments (see entry above).

EDIT:

The HindIII_iGEM_AraC_NgoMIV fragment was purificated from a preparative gel (1.5%)

Concentration:12,5ng/µl

Annealing of TEV_mut_fragI and TEV_mut_fragII /14_3C_mut_fragI and 14_3C_mut_fragII

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul, Sebastian

Materials:

TEV:

TEV_mut_fragI: 360bp (40µl)

TEV_mut_fragII: 400bp (40µl)

Primers for PCR:

f_TEV_AraFusion_NgoMIV

r_TEV_iGEM_BamHI

HRV 14_3C:

14_3C_mut_fragI: 420bp (40µl)

14_3C_mut_fragII: 153bp (40µl)

Primers for PCR:

f_14_3C_AraFusion_NgoMIV

r_14_3C_iGEM_BamHI

Used method:

1. 20µl of EACH fragment were purificated using a preparative agarose gel followed by extraction with "NucleoSpin ExtractII"-KIT and the other 20µl of EACH fragment were purificated with PCR-purification unsing "NucleoSpin ExtractII"-KIT.

2. Annealing of purificated primers using PCR (program iGEM002):

Template: Everything from purification (~15µl) = 4 reaction batches: 2x for TEV fragments, 2x 14_3C fragments from each purification method, respectively.

Nucleotides: 1 µl of 10mM ready to use dNTP mix

5µl 10x Amplification buffer S

5µl 25mM MgCl2

2,5µl primers = 25pmol absolute (2,5µl of each primer = 5µl per tube)

17,5µl of pure water

0,5µl TaqPol

Program: iGEM0002

Denat: 3min 94°C

5x:

Denat: 60sec 94°C

Anneal:60sec 53°C

Extend:60sec 72°C

25x:

Denat: 60sec 60°C

Anneal:60sec 60°C

Extend:60sec 72°C

Final Extend: 10min 72°C

Result:

Resolving of PCR products (5µl) on 1,5% analytical agarose gel

Expected Fragments

for TEV:

NgoMIV_iGEM_TEV-Protease_iGEM_BamHI - 760bp

for 14_3C:

NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI - 573bp

Summary:

Ligation of TEV_mut_fragI and TEV_mut_fragII did NOT work.

Ligation of 14_3C_mut_fragI and 14_3C_mut_fragII did work.

The two fractions of ligated 14_3C fragments were combined and PCR-purificated using "NucleoSpin ExtractII"-KIT (Concentration: 25ng/µl)

Further tasks:

Digestion of NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI fragment with NgoMIV and BamHI

Starting a new PCR for to produce new TEV-mut_fragI and TEV_mut_fragII fragments!!

Planning and accomplishing the PCRs of pBAD-mYFP Venus with Arabinosis and pEX_HisII with Lac

Investigators: Nicole, Nadja

Aim:To get Biobricks with Arabinosis and IPTG induction

Time: 2011-08-01,14:00-19:00

Materials:

Primer: 1. pr_Ara_Xba1, pf_Ara_EcoR1 and 2. pf_IPTG_EcoR1, pf_IPTG_Xba1

Plasmids: 1. pBAD-mYFP Venus and 2. pEX_HisII

Method:PCR

1.pBAD-mYFP Venus with Ara

1,25 µl pBAD-mYFP Venus (1:10, 10,8 ng/µl)

1,00 µl dNTPs

5,00 µl Buffer

2,50 µl pr_Ara_XbaI

2,50 µl pf_Ara_EcoRI

2,00 µl MgCl₂

0,50 µl Polymerase S

35,25 µl H₂O

2. pEX_HisII with Lac

1,00 µl pEX_HisII(1:20, 9,6 ng/µl)

1,00 µl dNTPs

5,00 µl Buffer

2,50 µl pf_IPTG_EcoRI

2,50 µl pf_IPTG_XbaI

2,00 µl MgCl2

0,50 µl Polymerase S

35,50 µl H₂O

3. Program for both: IGBIOB1 (30 cycles)

Step	Temperature	Time
Hot start	94°C	hold
Initial Denaturation	94°C	3min (180s)
Denaturation	94°C	20s
Annealing	44°C	40s
Extension	72°C	73s
Final Extension	72°C	600s

Further tasks:

See PCR results on agarose gel and do a gel extraction

51th Labday 2011-08-02

Transformation of BBa_I763007 in E. coli XL1-Blue

Investigators: Jessica, Steffi, Vanessa

Aim:Transformation of plasmid BBa_I763007 (containg Lambda promoter, RBS and RFP) in E. coli XL1-Blue cells to produce glycerol stocks for further use

Time: 2011-08-02,

Materials:

Method:

Further tasks:

Picking clones for overnight culturing

Producing glycerol stocks

Repetition of the PCRs of pBAD-mYFP Venus with Arabinosis and pEX_HisII with Lac because of less yield further planning and accomplishing the PCR of BBa_I763007 as it is a constitutive one

Investigators: Nadja, Nicole

Aim:To increase the yield and to get a constitutive Biobrick

Time:2011-08-02

Materials:

Primer: 1. pr_Ara_Xba1, pf_Ara_EcoR1 and 2. pf_IPTG_EcoR1, pf_IPTG_Xba1 and 3. Pr_constitutive_XbaI, pf_constitutive_EcoRI

Plasmids: 1. pBAD-mYFP Venus and 2. pEX_HisII and 3. BBa_1763007

Method:PCR

1. pBAD-mYFP Venus with Ara

1,25 µl pBad (1:10, 10,8ng/µl)

1,00 µl dNTPs

5,00 µl Buffer

2,50 µl pr_Ara_Xba1

2,50 µl pf_Ara_EcoR1

2,00 µl MgCl2

0,50 µl Polymerase S

35,25µl H₂O

2. pEX_HisII with Lac

1,00 µl pEX (1:20, 9,6 ng/µl)

1,00 µl dNTPs

5,00 µl Buffer

2,50 µl pf_IPTG_EcoR1

2,50 µl pf_IPTG_Xba1

2,00 µl MgCl₂

0,50 µl Polymerase S

35,50 µl H₂O

1. BBa_1763007 -constititive

1,00 µl BBa_1763007

1,00 µl dNTPs

5,00 µl Buffer

2,50 µl pr_constitutive_XbaI

2,50 µl pf_ constitutive_EcoR1

2,00 µl MgCl2

0,50 µl Polymerase S

35,5 µl H₂O

3. Program for 1. pBAD-mYFP Venus and 2. pEX_HisII: IGBIOB1 (30 cycles)

Step	Temperature	Time
Hot start	94°C	hold
Initial Denaturation	94°C	3min (180s)
Denaturation	94°C	20s
Annealing	44°C	40s
Extension	72°C	73s
Final Extension	72°C	600s

4. Program for BBa_1763007 -constititive: IGBIOC1 (30 cycles: 2-step PCR, first run10x, second run 20x)

Step	Temperature	Time
Hot start	94°C	hold
Initial Denaturation	94°C	3min (180s)
Denaturation	94°C	20s
Annealing	43°C	40s
Extension	72°C	45s
Denaturation	94°C	20s
Annealing	54°C	40s
Extension	72°C	45s
Final Extension	72°C	600s

Further tasks:

See PCR results on agarose gel and do a gel extraction

Agarose gel electrophoresis:

Gel 1

5 µl PCR + 1 µl 6x loading dye

lane	Sample	Volume in µl	Expected size in bp
M	GeneRuler™ DNA Ladder Mix (diluted 1:10)	10
1	-	-	-
2	PCR Arabinose promotor	6	~1200
3	PCR Arabinose promotor	6	~1200
4	-	-	-
5	PCR Lac promotor	6	~1400
6	PCR Lac promotor	6	~1400

Gel 2

5 µl PCR + 1 µl 6x loading dye

lane	Sample	Volume in µl	Expected size in bp
1	PCR Lambda promotor from BBa_I763007	-	?
2	PCR Lambda promotor from BBa_I763007	-	?
3	-	-
M	GeneRuler™ DNA Ladder Mix (diluted 1:10)	10

Preparing of linearized backbones (pSB1A3, pSB1K3 and pSB1T3) to produce vectors for further applications

Investigators: Nadja, Nicole

Time: 2011-08-02,

Aim: Using linearized backbones for further transformations, iGEM restrictions sites are necessary

Idea:
Producing vectors with different antibiotic resistances (ampicillin, kanamycin and tetracyclin) and iGEM restriction sites to

1. have the choice which resistance you want and then the possibility to clone each gene of interest easily in the chosen vector

2. to clone inducible and constitutive promoter systems in it and use this as expression vector for further experiments

Steps:

1. Restriction enzyme digestion

2. Ligation with reporter gene

3. Transformation and miniprep afterwards

Materials:

Linearized backbones from iGEM Registry of Standard biological parts (part of Spring 2010 DNA distribution kits) - only with EcoRI and PstI restriction sites

pSB1A3 - ampicillin resistance

pSB1T3 - tetracycline resistance

pSB1K3 - kanamycin resistance

pSB1C3 - we already got from KUK lab

Manual ‘Spring 2011 DNA distribution’, see: http://partsregistry.org/Help:Spring_2011_DNA_distribution or File:UP Spring 2011 DNA distribution.pdf

Restriction enzyme digestion of linearized plasmid backbones (pSB1A3, pSB1K3 and pSB1T3)

Investigators: Nadja, Nicole

Time: 2011-08-02,

Aim:Producing vectors, which carry tetracycline, kanamycin and ampicillin resistance genes and have all iGEM restriction sites

Materials:

Linearized backbones from iGEM Registry of Standard biological parts (part of Spring 2010 DNA distribution kits) à only with EcoRI and PstI restriction sites

pSB1A3, pSB1T3, pSB1K3

Manual ‘Spring 2011 DNA distribution’, see: http://partsregistry.org/Help:Spring_2011_DNA_distribution or File:UP Spring 2011 DNA distribution.pdf

NEB Buffer 2

Purified BSA (NEB)

EcoRI (NEB)

pstI (NEB)

dH2O

Method:

1. Enzyme master mix

5 µl NEB Buffer 2

0.5 µl BSA

0.5 µl of each EcoRI, PstI

18.5 µl dH2O

mix 4 µl linearized plasmid backbone (25 ng/ µl) with 4 µl enzyme master mix

2. Reaction conditions

30 min at 37°C by 750 rpm

20 min at 80°C by 750 rpm

Further tasks:

Gel electrophoresis

DNA extraction

Ligation with reporter genes CFP and YFP

Transformation

Miniprep

Sequencing

Gel electrophoresis of digested (linearized) plasmid backbones (pSB1A3, pSB1K3 and pSB1T3)

Investigators: Nadja, Nicole

Time: 2011-08-02,

Aim:Producing vectors, which carry tetracycline, kanamycin and ampicillin resistance genes and have all iGEM restriction sites, through cloning CFP resp. YFP in the linearized plasmid backbones.

Materials:

linearized plasmids backbones (pSB1A3, pSB1K3, pSB1T3) digested with EcoRI and PstI

Agarose broad range (Roth)

1x TAE buffer

Gel Red

DNA Ladder GeneRuler, 100bp plus (1:10) (Fermentas)

6x Loading Dye (Fermentas)

Method:

1. Production of one 1 % and one 1.5 % agarose gels

1 % gel: 0.5 g agarose in 50 ml 1x TAE buffer

1.5 % gel: 0.75 g in 50 ml 1x TAE buffer

Adding 2 µl gel red to each gel

2. Loading gels and running

Add 6 µl Loading dye to each 30 µl sample

Gene Ruler DNA ladder

Running conditions: 100 V, approx. 45 min

3. Loading of gels

	gel 1 (1 %)			gel 2 (1.5 %)
lane	Sample	Volume in µl	Expected size in bp	Sample	Volume in µl	Expected size in bp
1	marker			marker	6
2	-	-	-	-	-	-
3	pSB1T3	36	2206	CFP	36
4	-	-	-	-	-	-
5	pSB1A3	36	1862	YFP	36
6	-	-	-	-	-	-
7	pSB1K3	36	1978	-	-	-

Results:

[[File:]] [[File:]]

The bands were excised and purified using the NucleoSpin Extract II (Macherey-Nagel) extraction Kit.

Further Tasks:

Ligation of CFP resp. YFP in each linearized backbone

Transformation

Minprep and production of glycerol stocks

52th Labday 2011-08-03

Transformation of generated pPDV089 (strategy 2)

Investigators: Leif

Aim:amplification of pPDV089

Time: 13:30-15:00

Method:

addition of 10 µl ligation reaction to XL1-blue cells

incubation 25 min on ice,

heat shock 45 sec at 42°C,

incubation 2 min on ice,

addition of 750 µl LB medium,

incubation 60 min at 37 °C and 750 rpm

plating on agar plates containing 100 µg/ml tetracyclin and 100 µg/µl ampicillin

storage over night at 37°C

Further tasks:
control cell clones

Ligation of pBAD-mYFP Venus and pEX_HisII with pSB1_K3 and pSB1_A3

Investigators:Nadja, Nicole

Aim:Build Biobricks inducible with IPTG or Arabinosis and detectible with YFP or CFP

Time:2011-08-02,10:00-13:00

Materials:

T4 ligase

10x ligase buffer

vectors: pSB1_K3 and pSB1_A3

insert: pBAD-mYFP Venus and pEX_HisII

Method:

total volume of 20µl

1µl T4 ligase

2µl 10x ligase buffer

5µl vector

3µl insert

fill up to 20µl with H20

incubation over night at 18°C

Further tasks:

over night culture

miniprep

sequenzing

53th Labday 2011-08-04

digestion of vector pARW089 (strategy 2)

Investigators: Leif

Aim: digestion of pARW089

Time: 2011-08-04,10:00-12:00

Digestion of vector pARW089 with NarI (EheI isoschizomere) and AatII

20 µl sample

NEB 10x buffer (2 µl)

Buffer M 10x buffer (2 µl)

1 µl restriction enzyme NarI

1 µ restriction enzyme AatII

13 µl H2O

2 h at 37°C, then over night in the fridge

Wrong buffer, so the experiment was rerun.

digestion of PCR products vector pARW089 (strategy 2)

Investigators: Leif

Aim: digestion of pARW089

Time: 2011-08-04,10:00-12:00

Digestion of vector pARW089 with NarI (EheI isoschizomere) and AatII

20 µl sample

NEB 10x buffer (2 µl)

1 µl restriction enzyme NarI

1 µ restriction enzyme AatII

13 µl H2O

2 h at 37°C, then over night in the fridge

Further Tasks:

gel electrophoresis and purification of the two digested fragments

Problem: Shaker was on, so no digest possible!

Investigators: Stefan

Aim:digestion of pARW089

Time: 2011-08-04,10:00-12:00

Digestion of vector pARW089 with NarI (EheI isoschizomere) and AatII

40 µl sample

NEB 4 10x buffer (4 µl)

1 µl restriction enzyme NarI

1 µ restriction enzyme AatII

32 µl H2O

2 µl pARW089 (undiluted sample)

2 h at 37°C, then heat over night in the fridge

Further Tasks:

gel electrophoresis and purification of the two digested fragments

54th Labday 2011-08-05

Digestion of NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI, HindIII_iGEM_AraC_NgoMIV fragments and pJC354-NheI-143C-Xho_blaFL_GGH5 vector

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul, Sebastian

Materials:

NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI - 573bp

HindIII_iGEM_AraC_NgoMIV - 1273bp

pJC354-NheI-143C-Xho_blaFL_GGH5 vector (contains 14_3C cleavage site)

Digestion protocol:

1: NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI (25ng/µl):

30µl NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI

1µl NgoMIV

1µl BamHI

5µl 10x buffer = NEB 4

0.5µl 100x BSA

12.5µl pure water

=50µl

2: HindIII_iGEM_AraC_NgoMIV (12.5ng/µl)

40µl HindIII_iGEM_AraC_NgoMIV

1µl HindIII

1µl NgoMIV

5µl 10x buffer = NEB 4

0.5µl 100x BSA

1.5µl pure water

=50µl

3: pJC354-NheI-143C-Xho_blaFL_GGH5 vector (270ng/µl)

4µl pJC354-NheI-143C-Xho_blaFL_GGH5 vector (contains 14_3C cleavage site)

1µl HindIII

1µl BamHI

5µl 10x buffer

0.5µl 100x BSA

38.5µl pure water

=50µl

-->The reaction was allowed to proceed for 2h!

Result:

Resolving of digested fragments (50µl) and digested vector (50µl) on 1.5% and 1% preparative agarose gels, respectively.

1: NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI (band 5) and HindIII_iGEM_AraC_NgoMIV (band 3) fragments

2: pJC354-NheI-143C-Xho_blaFL_GGH5 vector

Summary:

The bands corresponding to digested fragments were excissed and purificated with PCR-purification unsing "NucleoSpin ExtractII"-KIT.

Further tasks:

Triple ligation of digested fragments

digest pSB1A3, pSB1K3 (clone 1-16)

Investigators: Niels

Aim: prove of Insert

Digestion protocol: 16x

5µl DNA - pSB1A3,pSB1K3

0,5µl XbaI

0,5µl EcoRI

2µl 10x buffer = NEB 4

12.5µl pure water

total: 20µl

37°C for 1h

Result:

Further tasks: sequencing

Restriction enzyme digestion pARW089 for Phage Display strategy II

Investigators: Leif

Time: 2011-08-05,10:00-12:30

Aim: Restriction enzyme digestion of pARW089 according to the protocol by Nadine from the 2011-07-22

Materials:

DNA: 5 µL

NEB Buffer 4 (10x): 4 µL

Enzyme AatII: 0.8 µL

Enzyme NarI: 2 µL

H2O: 28.2 µL

Total Volume: 40 µL

Results: Incubation of the digestion for 2 h with 750 rpm caused a breakdown of the restriction enzymes. The expreriment has to be repeated.

Miniprep of overnight cultures from ligation of pARW089 + mutated mdnA and test digest

Investigators: Jessica

Time: 2011-08-05, 10:00-18:30

Aim: DNA for sequencing and confirmation of insert

1. Miniprep:

20 overnight cultures (1A-2a(2 h digest, clone a),1A-2b,2A-2a,...,5A-3b)

NucleoSpin® Plasmid (NoLid) (Macherey-Nagel)

- Protocol for high-copy plasmids

- elution with 50 µl H₂O

measuring concentration with NanoDrop:

Sample	concentration in ng/µl
1A-2a	435.9
2A-2a	480.1
3A-2a	464.3
4A-2a	362.7
5A-2a	433.9
1A-3a	528.3
2A-3a	489.5
3A-3a	487.3
4A-3a	422.7
5A-3a	537.3
1A-2b	422
2A-2b	297.4
3A-2b	538.2
4A-2b	427
5A-2b	452
1A-3b	375.5
2A-3b	549.9
3A-3b	307.8
4A-3b	450.1
5A-3b	462.3

2. Preparation of glycerol stocks:

adding 300 µl glycerol to 700 µl culture

3. Digest:

2µl DNA (10 samples, only clone a)

0,5µl NarI

0,5µl AatII

2µl 10x buffer NEB 4

15µl H₂O

total: 20µl

37°C for 1h

4. Agarose gel electrophoresis:

1% agarose gel

1 h at 115 V

Samples

20 µl digest + 4 µl 6x loading dye

lane	Sample	Volume in µl	Expected size in bp
M	GeneRuler™ DNA Ladder Mix (diluted 1:10)	10
1	1A-2a	24	10296, 116
2	2A-2a	24	10296, 116
3	3A-2a	24	10296, 116
4	4A-2a	24	10296, 116
5	1A-3a	24	10296, 116
6	5A-2a	24	10296, 116
7	2A-3a	24	10296, 116
8	3A-3a	24	10296, 116
9	4A-3a	24	10296, 116
10	5A-3a	24	10296, 116

Result:

Inserts could be confirmed for samples from clone a

Further tasks:

sequencing to determine mutation rate

Miniprep of overnight cultures from ligation of pBAD-mYFP Venus and pEX_HisII with pSB1_K3 and pSB1_A3

Investigators: Nicole, Nadja

Time: 2011-08-05

Aim: DNA for sequencing and confirmation of insert

Materials/Methods:

1. Miniprep:

16 overnight cultures

NucleoSpin® Plasmid (NoLid) (Macherey-Nagel)

Protocol for high-copy plasmids

elution with 50 µl H₂O

measuring concentration with NanoDrop:

2. Preparation of glycerol stocks:

adding 300 µl glycerol to 700 µl culture

Further tasks:

sequenzing

55th Labday 2011-08-06

2nd Mutagenesis of TEV proteases to remove iGEM restriction sites from the proteases and introduction of iGEM restriction sites

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul

Aim:

Removal of iGEM restriction sites from proteases, amplifying protease fragments with iGEM restriction sites

Materials:

Plasmid 1: pET9d_Thrombin-CS_XbaI-TEV-Protease_BamHI

Primers: (1) f_TEV_ACCAGC , r_TEV_iGEM_BahmHI (2) r_TEV_ACCAGC , f_TEV_AraFusion_NgoMIV

Used method:

PCR

Template: 1µl = 3,6 ng

Nucleotides: 1µl of 10mM ready to use dNTP mix

5µl 10x Amplification buffer S

5µl 25mM MgCl2

2,5µl primers = 25pmol absolute (2,5µl of each primer = 5µl per tube)

32,5µl of pure water

0,5µl TaqPol

Program: iGEM001

Denat: 3min 94°C

5x:

Denat: 45sec 94°C

Anneal:45sec 53°C

Extend:45sec 72°C

25x:

Denat: 45sec 94°C

Anneal:45sec 60°C

Extend:45sec 72°C

Final Extend: 10min 72°C

Result:

Resolving of PCR products (50µl) on 2% preparative agarose gel

Expected Fragments:

TEV:

TEV_mut_fragI: 360bp

TEV_mut_fragII: 400bp

Further going:

gel extraction with NucleoSpin Extract II

Assembly PCR of purificated products to produce NgoMIV_iGEM_TEV-Protease_iGEM_BamHI

2nd Annealing of TEV_mut_fragI and TEV_mut_fragII

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sascha, Paul

Materials:

TEV:

TEV_mut_fragI: 360bp (40µl)

TEV_mut_fragII: 400bp (40µl)

Primers for PCR:

f_TEV_AraFusion_NgoMIV

r_TEV_iGEM_BamHI

Used method:

1. 50µl of EACH fragment were purificated using a preparative agarose gel followed by extraction with "NucleoSpin ExtractII"-KIT.

2. Annealing of purificated primers using PCR (program iGEMMED):

Template: 5µl TEV_mut_fragI and 10µl TEV_mut_fragII = 1 reaction batch.

Nucleotides: 1 µl of 10mM ready to use dNTP mix

5µl 10x Amplification buffer S

5µl 25mM MgCl2

2,5µl primers = 25pmol absolute (2,5µl of each primer = 5µl per tube)

18,5µl of pure water

0,5µl TaqPol

Program: iGEMMED

Denat: 3min 94°C

3x:

Denat: 60sec 94°C

Anneal:60sec 53°C

Extend:60sec 72°C

28x:

Denat: 60sec 94°C

Anneal:60sec 65°C

Extend:60sec 72°C

Final Extend: 10min 72°C

Result:

Resolving of PCR products (50µl) on 1,5% preparative agarose gel

Expected Fragments

for TEV:

NgoMIV_iGEM_TEV-Protease_iGEM_BamHI - 760bp

GelDoc documentation was not possible. 3 bands were visible:

1 band (1) at 700 - 800 bp (NgoMIV_iGEM_TEV-Protease_iGEM_BamHI),

1 band (2) at 500 - 600 bp (unexpected,)

1 band (3) at 300 - 400 bp (TEV_mut_fragI and TEV_mut_fragII)

Summary:

Ligation of TEV_mut_fragI and TEV_mut_fragII did work.

Unexpected band at 500 - 600 bp.

Further tasks:

Digestion of NgoMIV_iGEM_TEV-Protease_iGEM_BamHI fragment and of the unexpected band with NgoMIV and BamHI.

Digestion of NgoMIV_iGEM_TEV-Protease_iGEM_BamHI and of the unexpected band from the 2nd annealing TEV PCR

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators:Sascha

Materials:

NgoMIV_iGEM_TEV-Protease_iGEM_BamHI - 760bp

unexpected band - 500-600 bp

Digestion protocol:

30µl NgoMIV_iGEM_TEV-Protease_iGEM_BamHI / 30µl unexpected band

1µl NgoMIV

1µl BamHI

5µl 10x buffer = NEB 4

0.5µl 100x BSA

12.5µl pure water

=50µl

5µl vector

-->The reaction was allowed to proceed for 2h and was resolving (50µl) on 1,5% preparative agarose gel.

Result:

No visible bands on 1.5% preparative agarose gels.

Further tasks:

New PCR for to produce new TEV-mut_fragI and TEV_mut_fragII fragments!!

Repeated PCR of mdnA and gene III for phage display (strategy 2)

Investigator: Sabine, Sandrina

Time: 2011-08-06,12:00-14:00

Aim:

amplification of mdnA with NarI and AgeI restriction sites (strategy 2)

amplificate GeneIII with NgoMIV and AatII restriction sites (strategy 2)

Primer:

primer: pf_mdnA_iGEM_EheI and pr_mdnA_iGEM_AatII (mdnaA, strategy 2)

primer: pf_geneIII_NgoMIV and pr_geneIII_iGEM_AatII (geneIII, strategy 2)

Reaction Components:

5 µl Vector pARW089/Vector 100blaKDIR

0,25 µl Taq Polymerase S (BioScience)

1 µl dNTPs

1 µl per primer

5 µl 10x PCR Buffer S

37,75 µl DNase free water

Further tasks:

purification

digestion

digestion of PCR products (strategy 2)

Investigator: Sabine, Sandrina

Aim:

digestion of mdnA and gene III for getting an mdnA-geneIII fusion gene with rfc25 restrition sites after ligation

Time: 2011-08-06,14:00-15:30

digestion enzymes:

digestion of mdnA (strategy 2) with NarI and AgeI

digestion of geneIII (strategy 2) with NgoMIV and AatII

reaction components:

4 µl NEB 10x buffer

1 µl per restriction enzyme

30 µl PCR product

4 µl H²O

reaction conditions:

1 h for PCR fragments

37°C NarI, AgeI, NgoMIV and AatII digestion

Further Tasks:

gel electrophoresis for purification of the digested fragments and vectors

gel electrophoresis of digested fragments and digested pARW089

Investigator: Sandrina

Aim:

control and purification of digested PCR fragments

control and purification of digested pARW089 (2011-08-05)

Time: 2011-08-06,14:00-18:00

Results:

mdnA (NarI and AgeI, stategy 2): ca 200 bp, but estimation difficult, because no GelDoc available (weekend)

geneIII (NgoMIV and AatII): no band

pARW089 : ca 10 kb, but estimation difficult, because no GelDoc available (weekend)

Further Tasks:

repeat PCR of geneIII

ligation

prepare samples for sequencing (pARW089 + mutated mdnA)

Investigators: Niels

Aim: mdnA_1 sequencing by eurofins mwg|operon

guidelines (eurofins mwg|operon)

Primer :2 pmol/µl (10 µl each sample)

2,4 µl (100 µM) sf_mdnA_1

117,6 µl water

Sample: 70 ng/µl (15 µl total)

sample (cDNA ng/µl) - DNA µl ( ad water 15 µl)

- 1A-2a (435,9) - 2,4

- 2A-2a (480,1) - 2,2

- 3A-2a (464,3) - 2,3

- 4A-2a (362,7) - 2,9

- 5A-2a (433,9) - 2,4

- 1A-3a (528,3) - 1,99

- 2A-3a (489,5) - 2,15

- 3A-3a (487,3) - 2,15

- 4A-3a (422,7) - 2,48

- 5A-3a (537,3) - 1,95

Legend:

example: 1A-2a

1A-2a

- sample 1-5 : different Mn-concentration (error-pone PCR)

1A-2a

- sample A-C : different error-pone PCR- appendage

1A-2a

- sample 2 or 3: 2h(or 3h) digest of pARW089 with AatII / NarI

1A-2a

- sample a or b : 1. clone(a) or 2. clone(b) from the same plate with: E. coli XL1 blue transformed with ligation of vector pARW089 and insert (error pone - PCR )

Further tasks: sequencing

56th Labday 2011-08-07

PCR purification of TEV_mut_fragI und II

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Stefan

Aim:

PCR purification

Materials:

Promega PCR clean-Up System

TEV_mut_fragI (360bp), TEV_mut_fragII (400bp)

Used method:

Further going:

gel electrophoresisTEV_mut_fragI and II

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Stefan

Aim:

TEV_mut_fragI (360bp), TEV_mut_fragII (400bp)

Materials:

use small raq at 80V

Used method:

no picture could be taken due to the weak UV signal

Further going:

Annealing PCR TEV_mut_fragI and II

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Stefan

Aim:

TEV_mut_fragI (360bp), TEV_mut_fragII (400bp)

Materials:

1. 50µl of EACH fragment were purificated using a preparative agarose gel followed by extraction with "NucleoSpin ExtractII"-KIT.

2. Annealing of purificated primers using PCR (program iGEMMED):

Template: 5µl TEV_mut_fragI and 10µl TEV_mut_fragII = 1 reaction batch.

Nucleotides: 1 µl of 10mM ready to use dNTP mix

5µl 10x Amplification buffer S

5µl 25mM MgCl2

2,5µl primers = 25pmol absolute (2,5µl of each primer = 5µl per tube)

18,5µl of pure water

0,5µl TaqPol

Program: iGEMMED

Denat: 3min 94°C

3x:

Denat: 60sec 94°C

Anneal:60sec 53°C

Extend:60sec 72°C

28x:

Denat: 60sec 94°C

Anneal:60sec 65°C

Extend:60sec 72°C

Final Extend: 10min 72°C

Used method:

Further going:

Ligation of NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI, HindIII_iGEM_AraC_NgoMIV and pJC354-NheI-143C-Xho_blaFL_GGH5 vector

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Stefan

Aim:Triple-ligation of

NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI (573bp), HindIII_iGEM_AraC_NgoMIV (1273bp) and pJC354-NheI-143C-Xho_blaFL_GGH5 vector

Materials:

3 µL 14_3C fragment

3 µL AraC fragment

1 µL pJC354

2 µL T4 liagtion buffer (Fermentas)

1 µL T4 ligase (Fermentas)

10 µL H20

Used method:

ligation at room temperatur for 3h

Results:

band was very blurry on the gel, probably of contaminated running buffer

Further going:

Transformation of Ligation of pJC AraC and 14_3C in E. coli XL1 blue

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Stefan

Aim:transform the ligation into E. coli XL1 blue

Materials:

protocol:

addition of 10 µl ligation reaction to cells (XL1-blue, tet-resistance) in 1.5 ml Eppi,

incubation 25 min on ice,

heat shock 45 sec at 42°C,

incubation 2 min on ice,

addition of 750 µl LB medium,

incubation at 37 °C for 60 min in Eppendorf thermomixer at 750 rpm,

plating on LB medium with 1,5 % agar, 100 µg/ml chloramphenicol,

storage over night at 37°C

Result:

no colonies

Further going:

Repeated PCR gene III for phage display (strategy 2)

Investigator: Sabine

Time: 2011-08-07,11:00-13:00

Aim:

amplificate GeneIII with NgoMIV and AatII restriction sites (strategy 2)

Primer:

primer: pf_geneIII_NgoMIV and pr_geneIII_iGEM_AatII (geneIII, strategy 2)

Reaction Components:

5 µl Vector pARW089 / pak100blaKDIR

0,25 µl Taq Polymerase S (BioScience)

1 µl dNTPs

1 µl per primer

5 µl 10x PCR Buffer S

37,75 µl DNase free water

purification of PCR fragments with QIAquick Gel Extraction Kit (250)

Further tasks: digestion

digestion of PCR products and vector (strategy 2)

Investigator: Sabine

Aim:

digestion of mdnA and gene III for getting an mdnA-geneIII fusion gene with rfc25 restrition sites after ligation

digestion of pARW089 for ligation of mdnA/geneIII fusion gene into it (strategy 2)

Time: 2011-08-06,12:30-15:00

digestion enzymes:

digestion of mdnA (strategy 2) with NarI and AgeI

digestion of geneIII (strategy 2) with NgoMIV and AatII

digestion of pARW089 (strategy 2) with NarI and AatII

reaction components:

5 µl NEB 10x buffer

1 µl per restriction enzyme

40 µl PCR product / 5 µl vector

ad 50 µl water

reaction conditions:

1 h for PCR fragments

3 h for plasmids

37°C

Further Tasks:

gel electrophoresis for purification of the digested fragments and vectors

prepare samples for sequencing (pSB1A3, pSB1K3)

Investigators: Niels

Aim: sequencing by eurofins mwg|operon

guidelines (eurofins mwg|operon)

Primer :2 pmol/µl (10 µl each sample)

Sample: 70 ng/µl (15 µl total)

sample (cDNA ng/µl) - DNA µl ( ad water 15 µl)

- 1A3 CFP (204,5) - 5,13

- 1K3 CFP (216,2) - 4,86

- 1A3 YFP (235,7) - 4,45

- 1K3 YFP (213,6) - 4,92

Further tasks: sequencing

57th Labday 2011-08-08

test digest of pSB1K3

Time: 2011-08-08,11:00-16:00

Investigators: Vanessa, Steffi, Katharina, Nadine

Aim: prove of Insert (CFP or YFP)

Materials:

pSB1K3 (clone 1 and 4 from last week ???)

EcoRI, PstI, XbaI, HindIII, AatII

Buffer 4

Agarose broad range (Roth)

1x TAE buffer

Gel Red

DNA Ladder Mix (Fermentas)

6x Loading Dye (Fermentas)

Digestion protocol (XbaI, EcoRI)

5 µl DNA - pSB1K3 YFP or CFP (clone 4 or 1, respectively)

0.5 µl XbaI

0.5 µl EcoRI

2 µl 10x buffer = NEB 4

12.5 µl pure water

Digestion protocol (PstI, EcoRI)

5 µl DNA - pSB1K3+YFP or CFP (clone 4 or 1, respectively)

0.5 µl EcoRI

0.5 µl PstI

2 µl 10x buffer = NEB 4

12.5 µl pure water

Digestion protocol (AatII, HindIII)

5 µl DNA - pSB1K3 YFP or CFP (clone 4 or 1, respectively)

0.5 µl AatII

0.5 µl HindIII

2 µl 10x buffer = NEB 4

12.5 µl pure water

total: 20µl

37°C for 3h

Production of one 1 %

1 % gel: 0.5 g agarose in 50 ml 1x TAE buffer

Adding 2 µl gel red to each gel

Loading gels and running

Add 4 µl Loading dye to each 20 µl sample

15 µl DNA Ladder Mix

Running conditions: 100 V, approx. 45 min

Loading of gels

lane	Sample	Volume in µl	Expected size in bp
1	marker
2	pSB1K3+CFP (clone1), EcoRI, PstI	24	812, 2163
3	pSB1K3+CFP (clone1), XbaI, EcoRI	24	7, 2968
4	pSB1K3+CFP (clone1), AatII, HindIII	24	721, 2254
2	pSB1K3+YFP (clone4), EcoRI, PstI	24	789, 2163
3	pSB1K3+YFP (clone4), XbaI, EcoRI	24	7, 2945
4	pSB1K3+YFP (clone4), AatII, HindIII	24	721, 2231

Result:

300px

Further tasks: repeat the test digest tomorrow

sequencing pARW089 + mutated mdnA

Investigators: Niels,Steffi

Aim: sequencing by eurofins mwg|operon

samples prepared at 06.08.2011

Primer :2 pmol/µl 120 µl

sf_mdnA_1

pARW089 + mutated mdnA (15 µl total)

sample ID : 2h

- 1A-2a - AKM001W020

- 2A-2a - AKM001W021

- 3A-2a - AKM001W022

- 4A-2a - AKM001W023

- 5A-2a - AKM001W024

sample ID : 3h

- 1A-3a - AKM001W025

- 2A-3a - AKM001W026

- 3A-3a - AKM001W027

- 4A-3a - AKM001W028

- 5A-3a - AKM001W029

Results (arrived on 2011-08-11):

no mutations could be found in mdnA

Assembly PCR of TEV_frag_I and TEV_frag_II

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sebastian, Stefan

Aim: Assembly PCR to mutate the EcoRI site

Materials:

Primer:

2,5 µLf_TEV_AraFusion_NgoMIV (0.5 µmol stock)

2,5 µLr_TEV_iGEM_BamHI (0.5 µmol stock)

1 µL Fragment TEV I (approx. 2.5 ng)

1 µL Fragment TEV II (approx. 2.5 ng)

5 µL 10x polymerase buffer

5 µL 25 mM MgCl2

1 µL dNTP

0.5 µL T4 polymerase(Fermentas)

18.5 µL H20

Used method:

Program: iGEMMED

Denat: 3min 94°C

3x:

Denat: 60sec 94°C

Anneal:60sec 53°C

Extend:60sec 72°C

28x:

Denat: 60sec 94°C

Anneal:60sec 65°C

Extend:60sec 72°C

Final Extend: 10min 72°C

Further going:

analytical gel electrophoresis to confirm the correct size of bands

design primer for biobrick - mdnABC,mdnB,mdnC,mdnDE,mdnD,mdnE

Investigators: Katharina, Niels

Aim: design and order primer

Primer sequence

pf_mdnABC_EcoRI_NotI_XbaI

GAATTCGCGGCCGCTTCTAGATGGCATATCCCAACGATC

pf_mdnB_EcoRI_NotI_XbaI

GAATTCGCGGCCGCTTCTAGATGAAAGAATCGCCTAAAGTTG

pf_mdnC_EcoRI_NotI_XbaI

GAATTCGCGGCCGCTTCTAGATGACCGTTTTAATTGTTAC

pf_mdnE_EcoRI_NotI_XbaI

CAATCATCATATAACTCCGTAGATCTTCGCCGGCGCTTAAG

pf_mdnD_EcoRI_NotI_XbaI

GTCAAAAAGGTCACGAAAGTAGATCTTCGCCGGCGCTTAAG

pr_mdnABC_SpeI_NotI_PstI

GAAATCCTAGTTAACTCATAATACTAGTAGCGGCCGCTGCAG

pr_mdnE_SpeI_NotI_PstI

CTGCAGCGGCCGCTACTAGTAGATATAAGAGTGGGTAAAATTC

pr_mdnDE_SpeI_NotI_PstI

CTGCAGCGGCCGCTACTAGTATCAGCAAACCCTACTTAATTTC

pr_mdnB_SpeI_NotI_PstI

GCGATCGCTGATTTTTTAGTTACTAGTAGCGGCCGCTGCAG

ordered my sigma

Ligation of mdnA/GeneIII-fusion gene into pARW089 for phage display and transformation of competent cells(strategy 2)

Investigators: Sandrina, Sabine

Aim:

ligation of mdnA-geneIII fusiongene into pARW089 with digested fragments (see 2011-08-07)

amplification of generated plasmids by transformation

Time: 10:00-18:00

Method:

ligation-samples from 2011-08-07;

Protocol:

5 µl (ca 11 ng) digested vector pARW089 (NarI, AatII)

1 µl (ca 270 ng) fusion gene mdnA/geneIII

2 µl 10x T4 Ligase Buffer

1 µl T4 Ligase

10 µl water

5 h at 16°C and 1 h at room temperature

two bands were observed after mdnA-geneIII ligation (red boxes)--> ligation with pARW089 was tried with both bands

transformation:

protocol:

addition of 10 µl ligation reaction to cells (XL1-blue, tet-resistance) in 1.5 ml Eppi,

incubation 25 min on ice,

heat shock 45 sec at 42°C,

incubation 2 min on ice,

addition of 750 µl LB medium,

incubation at 37 °C for 60 min in Eppendorf thermomixer at 750 rpm,

plating on LB medium with 1,5 % agar, 100 µg/ml ampicillin, 100 µg/µl tetracyclin

storage over night at 37°C

Further tasks:
test digestion

58th Labday 2011-08-09

test digest of pSB1K3+YFP or CFP and pSB1A3+YFP or CFP

Time: 2011-08-09,9:00-15:00

Investigators: Nadine, Vanessa, Steffi, Laura

Aim: prove of Insert (CFP or YFP)

Materials:

pSB1K3 (clone 1 and 4 from last week ???), pSB1AK (clone 11 and 12 from last week ???)

EcoRI, XbaI, HindIII, AatII, HaeII, BglI

Buffer 4

Buffer 2

100x BSA

Agarose broad range (Roth)

1x TAE buffer

Gel Red

DNA Ladder Mix (Fermentas)

6x Loading Dye (Fermentas)

Digestion protocol (XbaI, EcoRI) (4x)

5 µl DNA - pSB1K3+YFP or CFP (clone 4 or 1, respectively) or pSB1A3+YFP or CFP (clone 12 or 11, respectively)

0.5 µl XbaI

0.5 µl EcoRI

2 µl 10x buffer = NEB 4

12.5 µl pure water

Digestion protocol (AatII, HindIII)

5 µl DNA - pSB1K3 YFP or CFP (clone 4 or 1, respectively) (2x)

0.5 µl AatII

0.5 µl HindIII

2 µl 10x buffer = NEB 4

12.5 µl pure water

total: 20µl

Digestion protocol (HaeII, BglI) (4x)

5 µl DNA pSB1A3+YFP or CFP (clone 12 or 11, respectively)

0.5 µl HaeII

0.5 µl BglI

2 µl 10x buffer = NEB 2

0.2 µl 100xBSA

12.3 µl pure water

37°C for 2h

Production of one 1 % agarose gel

1 % gel: 0.5 g agarose in 50 ml 1x TAE buffer

Adding 2 µl gel red to each gel

Loading gels and running

Add 4 µl Loading dye to each 20 µl sample

15 µl DNA Ladder Mix

Running conditions: 100 V, approx. 45 min

Loading of gels

lane	Sample	Volume in µl	Expected size in bp
1	marker
2	pSB1K3+CFP (clone1), not digested	24
3	pSB1K3+CFP (clone1), XbaI, EcoRI	24	7, 2968
4	pSB1K3+CFP (clone1), AatII, HindIII	24	721, 2254
5	pSB1K3+YFP (clone4), XbaI, EcoRI	24	7, 2945
6	pSB1K3+YFP (clone4), AatII, HindIII	24	721, 2231
7	pSB1K3+YFP (clone4), not digested	24
8	pSB1A3+CFP (clone11), not digested	24
9	pSB1A3+CFP (clone11), XbaI, EcoRI	24	15, 2911
10	pSB1A3+CFP (clone11), HaeII, BglI	24	1359, 1567
11	pSB1A3+YFP (clone12), XbaI, EcoRI	24	15, 2888
12	pSB1A3+YFP (clone12), HaeII, BglI	24	765, 924, 1188

Result:

Further tasks: repeat from beginning: w/ linearized backbones pSB1K3, pSB1A3 and pSB1T3

Gel purification of amplificated TEV protease

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sebastian

Aim: Clean up a pure fraction of TEV protease without iGEM-RS in the nucleotide sequence

Materials:

PCR and gel purification kit purchased by Promega (Wizard SV GEL and PCR Clean-Up System)

Used method:

Done as described in the manual

Results:

NgoMIV_TEV_iGEM_BamHI with a concentration of 6,9 ng/µl

Further going:

Amplification of TEV protease via PCR and digest with BamHI and NgoMIV

Ampilifcation of NgoMIV_TEV_iGEM_BamHI protease via PCR

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sebastian, Niels

Aim: Amplification of the TEV protease for digest with BamHI and NgoMIV

Materials:

1 µl Template - NgoMIV_TEV_iGEM_BamHI (6,9 ng/µl)

2,5 µl Primer 1 - f_TEV_AraFusion_NgoMIV (0,5 µM)

2,5 µl Primer 2 - r_TEV_iGEM_BamHI (0,5 µM)

5 µl 10x Reaction Buffer (Fermentas)

1 µl 10 mM dNTP's (Fermentas)

5 µl 25 µM MgCl2

0,5 µl DNA-Polymerase (Fermentas)

32,5 µl water

Used method:

Program: iGEM004

Denat: 3min 94°C

30x:

Denat: 60sec 94°C

Anneal:60sec 65°C

Extend:60sec 72°C

Final Extend: 10min 72°C

Further going:

PCR-Purification of the amplified DNA-Fragments and digest for ligation

PCR -Purification of amplified NgoMIV_TEV_iGEM_BamHI DNA-Fragements

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sebastian

Aim: Clean UP of the amplified fragments

Materials:

PCR-Clean up kit purchased by Promega(Wizard SV Gel and PCR-Up System)

Used method:

As described in the Manual of the kit

Results:

25 µl NgoMIV_TEV_iGEM_BamHI with 68,5 ng/µl

Further going: digest of the fragments and ligation for transformation

Ampilifcation of NgoMIV_TEV_iGEM_BamHI protease via PCR

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Sebastian

Aim: 2nd amplification of the NgoMIV_TEV_iGEM_BamHI protease for digest with BamHI and NgoMIV

Materials:

1 µl Template - NgoMIV_TEV_iGEM_BamHI (6,9 ng/µl)

2,5 µl Primer 1 - f_TEV_AraFusion_NgoMIV (0,5 µM)

2,5 µl Primer 2 - r_TEV_iGEM_BamHI (0,5 µM)

5 µl 10x Reaction Buffer (Fermentas)

1 µl 10 mM dNTP's (Fermentas)

5 µl 25 µM MgCl2

0,5 µl DNA-Polymerase (Fermentas)

32,5 µl water

Used method:

Program: iGEM005

Denat: 3min 94°C

30x:

Denat: 60sec 94°C

Anneal:60sec 63°C

Extend:60sec 72°C

Final Extend: 10min 72°C

Further going:

PCR-Purification of the amplified DNA-Fragments and digest for ligation

ELISA to test the anti myc-tag antibodies 9E10

Investigators: Sebastian

Aim: Testing the reactivity of the 9E10 antibody fractions

Method:

Coating of an ELISA (96-well microtiter plate) with 50 µl/well 5 mg/ml FITC-BSA and incubation over night

Blocking of the free binding sites with 50 µl/well PBS-5% NKS 0,0025% phenolred for 1 hour

Incubation with different ScFv tagged with myc (unkown concentration)for 1 hour

A1-H4 - anti FITC ScFv

A5-H8 - Z6.1 (anti-FITC ScFV)

A9-H12 - GST-tagged protein

Incubation with the tracer antibody 9E10 (different fractions in different lines (A-H) for 1 hour

Incubation with goat anti mice antibody labeled with HRP for 1 hour

Addition of the HRP-substrate (1 mg/ml OPD, 0,01 % H2O2, in 0,1 M Na-Citrate Buffer pH 5) for 30 min

Stopping of the reaction with 100 µl/well 1 M H2SO4 and 50 mM Na2SO3

measurement of the wavelength at 490 nm and 690 nm af reference

Materials:

1 µg/ml 9E10 antibody (from different fractions)

0,5 µg/ml 9E10 antibody (from different fractions)

several stock solutions (Blocking Solution, Substrate, PBS-NKS-Phenolred)

Results:

2 active fractions of 9E10 for coulping to column NHS-activated sepharose material

Further Tasks:

Coupling of active antibodies to NHS-activated sepharose for purification of myc-tagged proteins

Preparing linearized backbones pSB1K3, pSB1A3 and pSB1T3 for ligation w/ YFP and CFP

Time: 2011-08-09,15:00-20:00

Investigators: Vanessa, Jessica, Nadine

Motivation: first step of expression backbone creation: digest linearized backbones with EcoRI and PstI

Materials:

pSB1K3, pSB1A3 and pSB1T3

EcoRI, PstI

Buffer 4

100x BSA

DpnI

Protocol:

Digestion protocol (following iGEM distribution protocol for linearized backbones):

Mastermix

- 4 µl NEB Buffer 4

- 0.4 µl BSA

- 0.4 µl EcoRI

- 0.4 µl PstI

- 0.4 µl DpnI

- 14.4 µl pure water

- - total: 20 µl

reaction mix:

- 4 µl mastermix + 4 µl linearized backbone (pSB1K3, pSB1A3 or pSB1T3) from distribution

Incubation:

- 37°C for 30 min

Heat deactivation:

- 80°C for 20 min

stored in fridge 4°C

Further Task:

Digestion of YFP from pGA14mVenusGeneart and CFP from pGA14-Cerulean

Ligation of digested linearized backbones from today with digested YFP and CFP (results: pSB1K3+YFP, pSB1T3+YFP, pSB1A2+YFP, pSB1K3+CFP, pSB1T3+CFP, pSB1A2+CFP)

Transformation w/ ligation products, NOTE: !!! Don´t use XL1-Blue for pSB1T3+YFP and pSB1T3+CFP!!! Cells contain Tet-R already!!!

Picking of colonies

over-night cultures for mini-prep

mini-prep of over-night cultures

test-digest

- pSB1A3+YFP/CFP:

- - HaeII and BglI (protocol see 2011-8-9), expected: 3 fragments

- pSB1K3+YFP/CFP

- - HaeII (develop protocol, calculate exact expected bp) expected: 2 fragments

- pSB1T3+YFP/CFP

- - ClaI and ApaLI (develop protocol, calculate exact expected bp) expected: 3 fragments

- also: digested, not ligated linearized backbones (pSB1K3, pSB1A3 and pSB1T3)

- also: undigested pSB1K3+YFP, pSB1T3+YFP, pSB1A2+YFP, pSB1K3+CFP, pSB1T3+CFP, pSB1A2+CFP

if test-digest positive: digestion w/ EcoRI and XbaI

digestion of PCR products form ??? (Ara, Lac and constitutive promotor)

ligation of digested vectors w/digested PCR products from ???? (Ara, Lac and constitutive promotor)(results: pSB1K3+YFP+Ara, pSB1T3+YFP+Ara, pSB1A2+YFP+Ara, pSB1K3+CFP+Ara, pSB1T3+CFP+Ara, pSB1A2+CFP+Ara, pSB1K3+YFP+Lac, pSB1T3+YFP+Lac, pSB1A2+YFP+LAc, pSB1K3+CFP+Lac, pSB1T3+CFP+Lac, pSB1A2+CFP+Lac, pSB1K3+YFP+const, pSB1T3+YFP+const, pSB1A2+YFP+const, pSB1K3+CFP+const, pSB1T3+CFP+const, pSB1A2+CFP+const)

test digestion, sequencing

Digestion of YFP from pGA14mVenusGeneart and CFP from pGA14-Cerulean

Time: 2011-08-09,15:00-20:00

Investigators: Jessica, Nadine, Vanessa

Materials:

Preparation for ligation of YFP/CFP (insert) into pSB1A3, pSB1K3 or pSB1T3 (vectors)

Materials:

pGA14mVenusGeneart and pGA14-Cerulean

EcoRI, PstI

Buffer 4

100x BSA

Protocol:

Digestion protocol (following iGEM distribution protocol for linearized backbones):

Mastermix

- 2 µl NEB Buffer 4

- 0.2 µl BSA

- 0.2 µl EcoRI

- 0.2 µl PstI

- 7.4 µl pure water

- - total: 10 µl

reaction mix:

- 4 µl mastermix + 4 µl 1:2 diluted DNA

Incubation:

- 37°C for 30 min

Heat deactivation:

- 80°C for 20 min

YFP dig., 9.8.11, Nad & Jes stored in fridge 4°C

CFP dig., 9.8.11, Nad & Jes stored in fridge 4°C

over night culture from PDV089

Investigators: Sandrina

Aim:
control plasmid ligation (pARW089, mdnA, geneIII --> PDV089, strategy 2)

Time: 2011-08-09,16.00-17:00

Materials/Methods:

LB-medium with tet and amp

cell clones from over night plate

incubate over night at 37°C and 750 rpm

Further tasks:

plasmid preparation and analytic digestion

Repeated PCR of mdnA for phage display (strategy 1) repeated with new ordered reversed primer and of mdnA with rfc25 restriction sites (strategy 2), gel electrophoresis and purification of PCR products

Investigators: Sandrina

Time: 2011-06-30,11:00-15:00

Aim:

amplification of mdnA with SfiI restriction sites (vector pARW089) to clone it into pAk100 bla KDIR

amplification of mdnA with rfc25 restriction sites to fuse it with geneIII and clone it into pARW089

Materials/Methods:

see 2011-06-10

changes:

program: 123, Thermo Hybrid, PX2

Results:

expected bands (ca. 260 bp for strategy 1 and ca. 230 bp for strategy 2) were observed after gel electrophoresis

further tasks:

digestion of mdnA fragment with sfiI (strategy 1) and NarI and AgeI (strategy 2)

Digestion of mdnA with sfiI over night

Investigators: Sandrina

Time: 2011-08-09,16:30-17:00

Aim:

digestion of apmlificated mdnA to clone it into PAK100 bla KDIR

Materials/Methods:

50 µl sample:

0,2 µl BSA

5 µl 10x Puffer 4

0,5 µl sfiI

40 µl PCR product

4,3 µl H2O

incubation over night at 50°C

further tasks:

ligation with digested PAK100 bla KDIR

design primer for biobrick - redesign of pf_mdnE, pf_mdnD

Investigators: Niels, Nadine

Aim: design and order primer

Primer sequence

pf_mdnE_EcoRI_NotI_XbaI

CAATCATCATATAACTCCGTAGATCTTCGCCGGCGCTTAAG

pf_mdnD_EcoRI_NotI_XbaI

GTCAAAAAGGTCACGAAAGTAGATCTTCGCCGGCGCTTAAG

ordered my sigma

59th Labday 2011-08-10

Digestion of NgoMIV_iGEM_TEV-Protease_iGEM_BamHI fragments (produced on 09.08.2011) and pJC354-NheI-TEV-Xho_blaFL_GGH5 vector

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Paul

Materials:

NgoMIV_iGEM_TEV_iGEM_BamHI:

three samples: one sample produced on 09.08.2011 and already PCR purificated; two samples produced on 09.08.2011 not PCR purificated --> PCR purification of the two unpurificated samples using "NucleoSpin ExtractII"-KIT!

TEVI:67,9ng/µl (2ml eppi in long screening reck)

TEVII:56ng/µl (2ml eppi in long screening reck)

TEVIII:68,5ng/µl (1,5 ml eppi in logn screening reck, eppi named: 2. TEV muta PCR...)

pJC354-NheI-TEV-Xho_blaFL_GGH5 vector (contains TEV cleavage site): 470ng/µl

Digestion protocol:

1: NgoMIV_iGEM_TEV-Protease_iGEM_BamHI (3x, each sample 1x):

20µl NgoMIV_iGEM_TEV-Protease_iGEM_BamHI

1µl NgoMIV

1µl BamHI-HF

5µl 10x buffer = NEB 4

0.5µl 100x BSA

22.5µl pure water

=50µl

2: pJC354-NheI-TEV-Xho_blaFL_GGH5 vector (470ng/µl)

3µl pJC354-NheI-TEV-Xho_blaFL_GGH5 vector (contains TEV cleavage site)

1µl HindIII

1µl BamHI-HF

5µl 10x buffer = NEB4

0.5µl 100x BSA

39.5µl pure water

=50µl

-->The reaction was allowed to proceed for 2h at 37°C!

Result:

pJC354-NheI-TEV-Xho_blaFL_GGH5 vector:

Expected band: 4700bp --> Excission of band and pruification unsing "NucleoSpin ExtractII"-KIT

NgoMIV_iGEM_TEV-Protease_iGEM_BamHI:

Expected bands: 760bp --> Excission of red marked areas and pruification unsing "NucleoSpin ExtractII"-KIT

Further tasks:

Triple ligation of digested fragments and HindIII_iGEM_AraC_NgoMIV

Transformation of E. coli XL1-Blue with pGA14mVenusGeneart resp. pGA14-Cerulean

Investigators: Nadine

Aim:Transformation of E. coli XL1-Blue cells with pGA14mVenusGeneart resp. pGA14-Cerulean to produce glycerol stocks for further use if necessary

Time: 2011-08-10, 9:20-?

Materials:

pGA14mVenusGeneart resp. pGA14-Cerulean

E. coli XL1-Blue cells

LB medium

Method:

addition of 1 µl plasmid to XL1-blue cells

incubation 30 min on ice,

heat shock 45 sec at 42°C,

incubation 2 min on ice,

addition of 750 µl LB medium,

incubation 60 min at 37 °C and 750 rpm

plating on agar plates containing 100 µg/µl ampicillin

storage over night at 37°C

Further tasks:

Picking clones for overnight culture

Producing glycerol stocks

Agarose Gel of digested pSB1K3, pSB1A3 and pSB1T3 and digested CFP and YFP fragments

Investigators: Jessica, Vanessa, Nadine

Aim:Purification of insert and vector for the first ligation of the expression backbone

Time: 2011-08-10, 9:20-16:00

Materials:

digested pSB1K3, pSB1A3 and pSB1T3 from 2011-09-08

digested CFP and YFP from 2011-09-08 (YFP dig. and CFP dig., 9.8.11, Nad & Jes)

Agarose broad range (Roth)

1x TAE buffer

Gel Red

DNA Ladder Mix (Fermentas)

6x Loading Dye (Fermentas)

Production of one 1 % agarose gel

2 x 1 % gel: 0.5 g agarose in 50 ml 1x TAE buffer

Adding 2 µl gel red to each gel

Loading gels and running

Add 1.2 µl Loading dye to each 8 µl sample

12 µl DNA Ladder Mix

Running conditions: 110 V, approx. 45 min

Loading of gel 1

gel 1: pSB1K3, pSB1A3 and pSB1T3

lane	Sample	Volume in µl	Expected size in bp
M	marker	15
1	pSB1A3, EcoRI, PstI	9.2	2114, 41
2	-	-	-
3	pSB1K3, EcoRI, PstI	9.2	2163, 41
4	-	-	-
5	pSB1T3, EcoRI, PstI	-	2422, 41

Result gel 1:

bigger bands appear as expected

41 bp band is to small to appear in the gel

gel extraction with Wizard SV Gel and PCR Clean-Up System (Promega):

- pSB1A3 dig. pur. 10.08.11 Nad & Jes : 9.8 ng/µl

- pSB1K3 dig. pur. 10.08.11 Nad & Jes : 10.7 ng/µl

- pSB1T3 dig. pur. 10.08.11 Nad & Jes : 11.3 ng/µl

- stored in freezer (-20°C), red box: expression backbones

Loading of gel 2

gel 2: CFP and YFP

lane	Sample	Volume in µl	Expected size in bp
1	marker
2	from Screening (TEV Vector)	42
3	-	-	-
4	CFP	9.2	771, 2873
5	-	-	-
6	YFP	9.2	763, 2881

Result gel 2:

in lane 4 and 6 are too many bands

troubleshooting: it seems that the mastermixes were mixed up! In one mastermix was DpnI. DpnI digests methylated DNA. The vectors are from E. coli and therfore methylated. This could be an explanation for these band patterns.

Further tasks:

repeat digest of YFP from pGA14mVenusGeneart and CFP from pGA14-Cerulean

Digestion of YFP from pGA14mVenusGeneart and CFP from pGA14-Cerulean

Time: 2011-08-10,15:00-17:00

Investigators: Vanessa, Jessica, Nadine

Materials:

pGA14mVenusGeneart and pGA14-Cerulean

EcoRI, PstI

Buffer 4

100x BSA

Protocol:

Digestion protocol (following iGEM distribution protocol for linearized backbones):

Mastermix

- 2 µl NEB Buffer 4

- 0.2 µl BSA

- 0.2 µl EcoRI

- 0.2 µl PstI

- 7.4 µl pure water

- - total: 10 µl

reaction mix:

- 4 µl mastermix + 4 µl DNA (not diluted!!!)

Incubation:

- 37°C for 30 min

Heat deactivation:

- 80°C for 20 min

YFP dig., 10.8.11, Van & Jes stored in fridge 4°C

CFP dig., 10.8.11, Van & Jes stored in fridge 4°C

Miniprep of E. coli overnight culture containing pPDV089

Investigators: Sandrina, Sabine

Aim: purification of pPDV089 for test digestion and sequencing (15 clones)

Time: 10:00-13:00

Method/Materials: see protocol 5.1 of the NucleoSpin Plasmid Kit

Further tasks: test digestion

Test digestion of ligations for strategy 2 after Plasmid preperation

Investigators: Sabine, Sandrina

Aim:control if liagation of geneIII and mdnA into pARW089 (strategy 2) worked

Time: 14:00-16:00

Materials/Methods:

Strategy 2:

0,5 µl XbaI

0,5 µl SpeI

2 µl 10x buffer 4 (NEB)

0,2 µl BSA

10 µl vector DNA

12,8 µl H2O

incubate for 1 h at 37°C

Results:

expected size for all samples: strategy 2: ca. 5000 bp, 4000 bp, 600 bp and 200

three different pARW089 vectors (1,2,3) were used for ligation, they were digested with the same enzymes but this was done from three different persons

after digestion of geneIII PCR product with AatII and NgoMIV two bands were seen after gel electrophoresis, ligations were done with both samples (called here: "upper band" and "lower band")

Loading of gels

lane	Sample	Volume in µl	Expected size in bp
M	marker, DNA ladder mix Fermentas
1	free
2	vector 1, upper band, clone 1	20	ca. 5000, 4000, 600, 200
3	vector 1, upper band, clone 2	20	ca. 5000, 4000, 600, 200
4	vector 1, upper band, clone 3	20	ca. 5000, 4000, 600, 200
5	vector 1, lower band, clone 1	20	ca. 5000, 4000, 600, 200
6	vector 1, lower band, clone 2	20	ca. 5000, 4000, 600, 200
7	vector 1, lower band, clone 3	20	ca. 5000, 4000, 600, 200
8	free
9	vector 2, upper band, clone 1	20	ca. 5000, 4000, 600, 200
10	vector 2, upper band, clone 2	20	ca. 5000, 4000, 600, 200
11	vector 2, upper band, clone 3	20	ca. 5000, 4000, 600, 200
12	vector 2, lower band, clone 1	20	ca. 5000, 4000, 600, 200
13	vector 2, lower band, clone 2	20	ca. 5000, 4000, 600, 200
14	vector 2, lower band, clone 3	20	ca. 5000, 4000, 600, 200
15	free
16	vector 3, upper band, clone 1	20	ca. 5000, 4000, 600, 200
17	vector 3, upper band, clone 2	20	ca. 5000, 4000, 600, 200
18	vector 3, upper band, clone 3	20	ca. 5000, 4000, 600, 200

350px

Further tasks:

sequence clones 12, 13 and 17

cultivation of cells containing pAK100 bla KDIR from E. coli glycerol stocks

Investigators: Sabine, Sandrina

Aim: cultivate cells conatining pAK100 bla KDIR (vector) to purify it and use it for phage display.

Time: 2011-06-14,16:00-17.30

Materials/Methods:

glycerol stock nr. 15, pAK100 bla KDIR, XL1-blu, 2003-07-31

LB-medium with chloramphenicol (1:1000)

Further tasks:
plasmid preperation und digestion with SfiI

60th Labday 2011-08-11

Agarose Gel digested CFP and YFP fragments (from 2011-08-10)

Investigators: Jessica, Nadine, Vanessa

Aim:Purification of YFP and CFP fragment

Time: 2011-08-11, 8:00-11:00

Materials:

digested CFP and YFP from 2011-09-08 (YFP dig. and CFP dig., 10.8.11, Van & Jes)

Agarose broad range (Roth)

1x TAE buffer

Gel Red

DNA Ladder Mix (Fermentas)

6x Loading Dye (Fermentas)

Production of one 1 % agarose gel

1 % gel: 0.5 g agarose in 50 ml 1x TAE buffer

Adding 2 µl gel red to each gel

Loading gels and running

Add 1.2 µl Loading dye to each 8 µl sample

12 µl DNA Ladder Mix

Running conditions: 100 V, approx. 45 min

Loading of gel

gel: CFP and YFP

lane	Sample	Volume in µl	Expected size in bp
1	marker	10
2	-	-	-
3	CFP	9.2	771, 2873
4	-	-	-
5	YFP	9.2	763, 2881
6	-	-	-

Result:

bands appear as expected

lower bands (red box) in lane 3 and 4 were excised and DNA was extracted w/ Wizard SV Gel and PCR Clean-Up System (Promega):

- CFP dig. pur. Jes & VB 11.8.2011, 5.7 ng/µl

- YFP dig. pur. Jes & VB 11.8.2011, 5.4 ng/µl

- stored in freezer (-20°C), red box: expression backbones

Further tasks:

ligation of digested and purified YFP and CFP with digested and purified pSB1A3, pSB1K3 and pSB1T3

Ligation of digested and purified CFP and YFP fragments (from 2011-08-11) w/ digested and purified pSB1A3, pSB1K3, pSB1T3 (from 2011-08-10)

Investigators: Nadine, Vanessa, Jessica

Aim:Ligation

Time: 2011-08-11, 11:00-14:30

Materials:

T4 Ligase

10x T4 Ligase buffer

inserts

- CFP dig. pur. Jes & VB 11.8.2011, 5.7 ng/µl

- YFP dig. pur. Jes & VB 11.8.2011, 5.4 ng/µl

vectors:

- pSB1A3 dig. pur. 10.08.11 Nad & Jes : 9.8 ng/µl,

- pSB1K3 dig. pur. 10.08.11 Nad & Jes : 10.7 ng/µl

- pSB1T3 dig. pur. 10.08.11 Nad & Jes : 11.3 ng/µl

- pure sterile water

Protocols

to calculate the volumes http://old.gibthon.org/ was used

pSB1K3 (Volumes in µl)

lane	CFP	YFP	Control
10x T4 ligase buffer	1	1	1
T4 ligase	1	1	1
vector	2.7	2.6	2.6
insert	5.3	5.4	-
water	-	-	5.4

pSB1A3 (Volumes in µl)

lane	CFP	YFP	Control
10x T4 ligase buffer	1	1	1
T4 ligase	1	1	1
vector	2.8	2.8	2.8
insert	5.2	5.2	-
water	-	-	5.2

pSB1T3 (Volumes in µl)

lane	CFP	YFP	Control
10x T4 ligase buffer	1	1	1
T4 ligase	1	1	1
vector	2.6	2.5	2.5
insert	5.4	5.5	-
water	-	-	5.5

Incubation: 2 hrs at room temperature

Result:

pSB1A3+YFP, lig, VB, 11.8.2011

pSB1A3+CFP, lig, VB, 11.8.2011

pSB1A3+control, lig, VB, 11.8.2011

pSB1K3+YFP, lig, VB, 11.8.2011

pSB1K3+CFP, lig, VB, 11.8.2011

pSB1K3+control, lig, VB, 11.8.2011

pSB1A3+YFP, lig, VB, 11.8.2011

pSB1A3+CFP, lig, VB, 11.8.2011

pSB1A3+control, lig, VB, 11.8.2011

pSB1T3+YFP, lig, VB, 11.8.2011

pSB1T3+CFP, lig, VB, 11.8.2011

pSB1T3+control, lig, VB, 11.8.2011

- all stored in freezer (-20°V in red box: expression backbone)

Further tasks:

Transformation in XL1-blue, except for pSB1T3+YFP/CFP: here use RV308

Ligation of NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI or NgoMIV_iGEM_TEV-Protease_iGEM_BamHI, HindIII_iGEM_AraC_NgoMIV into pJC354-NheI-143C-Xho_blaFL_GGH5 or pJC354-NheI-TEV-Xho_blaFL_GGH5 vector

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators: Paul, Sebastian

Aim:

1. Triple-ligation of NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI (573bp), HindIII_iGEM_AraC_NgoMIV (1273bp) and pJC354-NheI-143C-Xho_blaFL_GGH5 vector (~4700bp) to create pUP_SG2_TorA_CS-14_3C_bla_AraC-14_3C

2.Triple-ligation of NgoMIV_iGEM_TEV_iGEM_BamHI (760bp), HindIII_iGEM_AraC_NgoMIV (1273bp) and pJC354-NheI-TEV-Xho_blaFL_GGH5 vector (~4700bp)to create pUP_SG1_TorA_CS-TEV_bla_AraC-TEV

Calculation of volumes to be used with: [http://www.gibthon.org/ligate.html ligation calculator] with 1:1 molar ratio

Materials:

14_3C: 2 reaction batches (we have two digested pJC354-NheI-143C-Xho_blaFL_GGH5 vector fractions)

1:

2 µL NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI fragment (573bp, 3.2ng/µl)

1,5 µL AraC fragment

4,5 µL pJC354-NheI-143C-Xho_blaFL_GGH5 vector (8.3ng/µl)

1 µL T4 liagtion buffer (Fermentas)

1 µL T4 ligase (Fermentas)

=10µl

2:

1,2 µL NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI (573bp, 3.2ng/µl) fragment

0,8 µL AraC fragment

6 µL pJC354-NheI-143C-Xho_blaFL_GGH5 vector (6.7ng/µl)

1 µL T4 liagtion buffer (Fermentas)

1 µL T4 ligase (Fermentas)

=10µl

2 controls: As 1 and 2 but with water instead of fragment

TEV: 3 reaction batches (we have three digested NgoMIV_iGEM_TEV-Protease_iGEM_BamHI fragment fractions)

1:

0.8 µL NgoMIV_iGEM_TEV-Protease_iGEM_BamHI fragment (760bp, 18.5ng/µl) (TEVI, see 10.08.2011)

2,6 µL AraC fragment

4,6 µL pJC354-NheI-TEV-Xho_blaFL_GGH5 vector (19.4ng/µl)

1 µL T4 liagtion buffer (Fermentas)

1 µL T4 ligase (Fermentas)

=10µl

2:

1.1 µL NgoMIV_iGEM_TEV-Protease_iGEM_BamHI fragment (760bp, 12.5ng/µl) (TEVII, see 10.08.2011)

2,5 µL AraC fragment

4,4 µL pJC354-NheI-TEV-Xho_blaFL_GGH5 vector (19.4ng/µl)

1 µL T4 liagtion buffer (Fermentas)

1 µL T4 ligase (Fermentas)

=10µl

3:

0.7 µL NgoMIV_iGEM_TEV-Protease_iGEM_BamHI fragment (760bp, 20.4ng/µl) (TEVIII, see 10.08.2011)

2,6 µL AraC fragment

4,7 µL pJC354-NheI-TEV-Xho_blaFL_GGH5 vector (19.4ng/µl)

1 µL T4 liagtion buffer (Fermentas)

1 µL T4 ligase (Fermentas)

=10µl

1 control: As 2 but with water instead of fragment

Used method:

ligation at room temperatur for 1h

Further going:Transformation of XL1blue cells with ligation products

Transformation of E. Coli XL1 Blue Cells with ligation products (NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI or NgoMIV_iGEM_TEV-Protease_iGEM_BamHI, HindIII_iGEM_AraC_NgoMIV into pJC354-NheI-143C-Xho_blaFL_GGH5 or pJC354-NheI-TEV-Xho_blaFL_GGH5 vectors)

For better understanding of described experiment see also: http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx

Investigators:Paul, Sascha

Aim:transform the ligation into E. coli XL1 blue

Materials:

8x XL1 blue cells from -80 stock, 2x 14_3C-ligations + 2x controls ; 3x TEV-ligations + 1x control

protocol:

Taw cells on ice

addition of 10 µl ligation reaction to cells (XL1-blue, tet-resistance, 60µl) in 2 ml Eppi,

incubation 25 min on ice,

heat shock 45 sec at 42°C,

incubation 2 min on ice,

addition of 750 µl LB medium,

incubation at 37 °C for 60 min in Eppendorf thermomixer at 600 rpm

plating on LB medium with 1,5 % agar, 100 µg/ml chloramphenicol,

storage over night at 37°C

Results

No colonies in case of 14_3C Protease, no colonies in controls of 14_3C

Tev: three colonies on each plate, including control plate

Further tasks

Picking colonies, making precultures and colony-PCRs and isolation/sequencing of pUP_SG1_TorA_CS-TEV_bla_AraC-TEV

Transformation

Time: 2011-8-11, 14:30 - 17:30

Investigators: Vanessa, Jessica, Nadine, Niels

Material:

pSB1A3+YFP, lig, VB, 11.8.2011

pSB1A3+CFP, lig, VB, 11.8.2011

pSB1A3+control, lig, VB, 11.8.2011

pSB1K3+YFP, lig, VB, 11.8.2011

pSB1K3+CFP, lig, VB, 11.8.2011

pSB1K3+control, lig, VB, 11.8.2011

pSB1A3+YFP, lig, VB, 11.8.2011

pSB1A3+CFP, lig, VB, 11.8.2011

pSB1A3+control, lig, VB, 11.8.2011

pSB1T3+YFP, lig, VB, 11.8.2011

pSB1T3+CFP, lig, VB, 11.8.2011

pSB1T3+control, lig, VB, 11.8.2011

6 x XL1-blue cells (competent) for pSB1A3 and pSB1K3 variants

3 x RV380 cells (competent) for pSB1T3 variants

Method:

addition of 2 µl ligation reaction to XL1-blue cells or RV380 cells

incubation 25 min on ice,

heat shock 45 sec at 42°C,

incubation 2 min on ice,

addition of 750 µl LB medium,

incubation 60 min at 37 °C and 750 rpm

plating on agar plates containing 100 µg/ml tetracyclin

plating on agar plates containing 100 µg/ml kanamycin

plating on agar plates containing 100 µg/µl ampicillin

incubation over night at 37°C

NOTE:

pSB1T3+YFP/CFP have the same label; we have to check the insert with test digestion

Further tasks:
control cell clones tomorrow morning

Repeated PCR gene III for phage display (strategy 2)

Investigator: Sabine

Time: 2011-08-11,1:00-12:30

Aim:

amplificate GeneIII with NgoMIV and AatII restriction sites (strategy 2)

Primer:

primer: pf_geneIII_NgoMIV_XbaI_myc and pr_geneIII_iGEM_AatII (geneIII, strategy 2)

Reaction Components:

5 µl pak100blaKDIR

0,25 µl Taq Polymerase S (BioScience)

1 µl dNTPs

1 µl per primer

5 µl 10x PCR Buffer S

37,75 µl DNase free water

Purification:

NucleoSpin Extract II

Further tasks:

digestion

Miniprep of E. coli overnight culture containing pakblaKDIR

Investigators: Sabine

Aim: purification of pakblaKDIR

Time: 10:00-11:00

Method/Materials: see protocol 5.1 of the NucleoSpin Plasmid Kit

Further tasks:

digestion with Sfi (strategy I)

PCR of geneIII (strategy II)

digestion of pak blaKDIR (strategy 1)

Investigator: Sandrina, Sabine

Aim: ligation of digested mdnA into pak blaKDIR to get phage display vector pPDV100 (strategy I)

Time: 2011-08-11, 11:00-14:00

reaction components:

15 µl pak blaKDIR (ca 1 µg)

2 µl NEB 10x buffer

0,2 µl 100x BSA

1 µl restriction enzyme SfiI

1,8 µl water

reaction conditions:

3 h, 37°C

sending clone 12, 13 and 17 from ligation strategy 2 (see 2011-08-10) to MWG for sequencing

Investigators: Sandrina, Sabine

Time: 2011-8-11, 12:00 - 15:00

Aim: get sequence of generated phage display vector pPDV089 (strategy 2) to control the ligation of digested pARW089 with digested mdnA and gene III

Method/Materials:

50-100 ng DNA in 15 µl sample

used primer: sf_mdna_1 (nr. 6)

Further tasks:

perform alignment

Gel electrophoresis of digested PAK100 bla KDIR vector(strategy 1) and PCR of geneIII

Investigators: Sandrina

Aim:Purification of PAK100 bla KDIR (strategy 1) and analysis if PCR worked

Time: 2011-08-11,15:00-16:30

Materials/Methods:

Agarose broad range (Roth)

1x TAE buffer

Gel Red

digested vector PAK100 bla KDIR

DNA Ladder Mix(Fermentas)

6x Loading Dye (Fermentas)

Method:

1. Production of a 1 % agarose gel

adding 2 µl gel red

2. Run

100 V

time: 00:45 h

Results:

lane	Sample	Volume in µl	Expected size in bp
M	marker
1	geneIII PCR	5	ca. 400
2	digested PAK100 bla KDIR vector	30	ca. 5500, 800

one band was cutted out of the gel for purifacation

Further tasks:

ligation of mdnA with pAK100 bla KDIR

ligation of mdnA into pak100blaKDIR (stategy 1)

Investigator: Niels, Sandrina

Aim: generate phage display vector pPDV100 (strategy 1)

Time: 2011-07-20,16:30-18:00

Method/Materials:

3 µl (ca 90 ng) Sfi-digested vector pak100

1 µl (ca 1000 ng) Sfi-digested PCR fragment mdnA from over night digested sample (2011-08-09)

2 µl 10x T4 Ligase Buffer

1 µl T4 Ligase

13 µl water

incubate over night at 14°C

Further Tasks: transformation of competent cells

61th Labday 2011-08-12

Ligation of NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI or NgoMIV_iGEM_TEV-Protease_iGEM_BamHI with HindIII_iGEM_AraC_NgoMIV

Investigators: Sebastian, Paul

Aim:

1. Ligation of NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI (573bp) and HindIII_iGEM_AraC_NgoMIV (1273bp)

2. Ligation of NgoMIV_iGEM_TEV_iGEM_BamHI (760bp) and HindIII_iGEM_AraC_NgoMIV (1273bp)

3. Amplification of ligated fragments via PCR

Calculation of volumes to be used with: [http://www.gibthon.org/ligate.html ligation calculator] with 1:1 molar ratio

Materials:

1:

4.3 µL NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI fragment (573bp, 3.2ng/µl)

3.7 µL AraC fragment

1 µL T4 liagtion buffer (Fermentas)

1 µL T4 ligase (Fermentas)

=10µl

2:

1.1 µL NgoMIV_iGEM_TEV-Protease_iGEM_BamHI fragment (760bp, 18.5ng/µl) (TEVI, see 10.08.2011)

4 µL AraC fragment

2.9 µL pure water

1 µL T4 liagtion buffer (Fermentas)

1 µL T4 ligase (Fermentas)

=10µl

Used method:

ligation at room temperatur for 1h

3:

10µl of ligation reaction batch

1µl dNTP

2.5µl of primer1

2.5µl of primer2

5µl 25mM MgCl2

5µl Amplification Buffer 10x (genaxxon)

0.5µl Taq-Polymerase (genaxxon)

Primer:

TEV+AraC:

r_Tev_iGEM_BamHI

f_AraC_HindIII_iGEM

14_3C+AraC:

r_14_3C_iGEM_BamHI

f_AraC_HindIII_iGEM

Used method:

Initial Denat: 3min 94°C

25x

Denat: 2.02min 94°C

Anneal: 2.02min 70°C

Extension: 2.02min 72°C

final extension: 10min 72°C

Results:

No results, no expected bands were visible

Further Tasks:

resolving of PCR products on preparative 1% agarose gel and exciccion of correspoinding bands (1:~1800bp, 2:~2000bp)

File:UP AG 1% 2011-08-12 prep-TEV AraC.jpg

Colony PCR of TEV clones obtained from transformation

Stefan, Sebastian

Aim:

get a positive clone

Materials:

Primer:

- f_AraC_HindIII_iGEM

- r_TEV_iGEM_BamHI

2.5 µL forward Primer (25 pmol)

2.5 µL reverse Primer (25 pmol)

5 µL 10x Polymerase buffer (Genaxxiom)

5 µL MgCL2

1 µL dNTPs

0.5 µL Taq Polymerase (Genaxxiom)

33.5 µL H20

10 colonies were picked

Used method:

Initial Denat: 3 min 94°C

25x

Denat: 2.02 min 94°C

Anneal: 2.02 min 70°C

Extension: 2.02 min 72°C

final extension: 10min 72°C

Further Tasks:

gel electrophoresis of PCR products 1% agarose gel of corresponding bands (1:~1800bp, 2:~2000bp)

Results of Transformation from 2011-8-11 and Overnight Cultures of marked colonies

Time: 2011-8-12, 9:00-9:30

Investigators : Jessica, Nadine, Katharina

Aim: check Transformation

Results:

Preparing Overnight Cultures of marked colonies

Time: 2011-8-12, 18:00-18:30

Investigators : Jessica

Materials/Method:

5 ml LB-Medium with 5 µl antibiotic (either Tet, Amp or Kan)

cultures:

- pSB1T3+YFP I clone I 12.08.11 Jes, pSB1T3+YFP I clone II 12.08.11 Jes, pSB1T3+YFP I clone III 12.08.11 Jes

- pSB1K3+YFP clone I 12.08.11 Jes, pSB1T3+YFP clone II 12.08.11 Jes, pSB1T3+YFP clone III 12.08.11 Jes

- pSB1K3+CFP clone I 12.08.11 Jes, pSB1T3+CFP clone II 12.08.11 Jes, pSB1T3+CFP clone III 12.08.11 Jes

- pSB1A3+CFP clone I 12.08.11 Jes, pSB1A3+CFP clone II 12.08.11 Jes

Further Task:

repeat Transformation of pSB1T3+YFPII and pSB1A3+YFP

do miniprep of overnight cultures and confirm insert by digest (see 2011-08-09)

Transformation of generated pPDV100 from over night ligation (strategy 1)

Investigators: Sabine, Sandrina

Aim:amplification of pPDV100

Time: 10:00-12:00

Method:

addition of 10 µl ligation reaction to XL1-blue cells

incubation 25 min on ice,

heat shock 45 sec at 42°C,

incubation 2 min on ice,

addition of 750 µl LB medium,

incubation 60 min at 37 °C and 750 rpm

plating on agar plates containing 100 µg/ml tetracyclin and 100 µg/µl ampicillin

storage over night at 37°C

Further tasks:
control cell clones through test digestion with sfiI

Repeated PCR gene III for phage display (strategy 2)

Investigator: Sandrina, Sabine

Time: 2011-08-12,12:30-17:00

Aim:

amplificate GeneIII with NgoMIV and AatII restriction sites (strategy 2)

Primer:

primer: pf_geneIII_NgoMIV_XbaI_myc and pr_geneIII_iGEM_AatII (geneIII, strategy 2)

Reaction Components:

5 µl pak100blaKDIR

0,25 µl Taq Polymerase S (BioScience)

1 µl dNTPs

1 µl per primer

5 µl 10x PCR Buffer S

37,75 µl DNase free water

Purification:

NucleoSpin Extract II

Further tasks:

digestion with AatII and NgoMIV

Miniprep of overnight cultures of Cerulean and mVenus Geneart

Investigators: Katharina

Time: 2011-08-12, 9:00-10:00

Aim:

1. Miniprep:

2 overnight cultures

NucleoSpin® Plasmid (NoLid) (Macherey-Nagel)

- Protocol for high-copy plasmids

- elution with 30 µl H₂O

measuring concentration with NanoDrop:

Sample	concentration in ng/µl
Cerulean	530.1
mVenus Geneart	573.6

stored in -20°C (red box, expression backbones)

2. Preparation of glycerol stocks:

adding 300 µl glycerol to 700 µl culture

gel electrophoresis of colony PCR(TEV)

Investigators: Sascha, Paul, Sebastian

Aim:
screen for positiv clone

Result:

Gel electrophoresis of PCR products (5µl) on 1.5% and agarose gels, respectively.

Expected band (AraC + TEV): ~ 2000 bp.

One positive clone TEV 3 III.

600px

Set up a pre-culter of clon TEV 3 III.

Further tasks:

Stock culture, plasmid preparation

Transformation of pSB1A3+YFP in XL1-Blue and pSB1T3+YFPII in RV308

Investigators: Katharina

Aim: Transformation of Ligations

Time: 2011-08-12, 10:00-13:00

Materials:

competent E. coli cells (XL1-Blue and RV308, respectively)

ligation products: pSB1A3+YFP, lig, VB, 11.8.2011 and pSB1T3+YFP II, lig, VB, 11.8.2011

Method:

addition of 2 µl ligation reaction to cells (XL1-blue, RV) in 1.5 ml Eppi,

incubation 25 min on ice,

heat shock 45 sec at 42°C,

incubation 5 min on ice,

addition of 750 µl LB medium,

incubation at 37 °C shaking for 80 min,

plating on LB medium with appropriate antibiotic (Amp and Tet,respectively

storage over night at 37°C

2 plates: pSB1T3+YFP II Jes and pSB1A3+YFP Jes

Further tasks:

Picking clones for overnight culture

Producing glycerol stocks

Design and ordering of primers to produce BioBricks of the mdn genes

Investigators: Jessica, Nadine, Katharina

Time: 2011-08-12, 11:00-14:00

Materials:

Geneious

Results:

pf_mdnABC_EcoRI_NotI_XbaI 12.08. : TTAATGAATTCGCGGCCGCTTCTAGATGGCATATCCCAACGATC

pf_mdnB_EcoRI_NotI_XbaI 12.08.: ATTATGAATTCGCGGCCGCTTCTAGATGAAAGAATCGCCTAAAGTTG

pf_mdnC_EcoRI_NotI_XbaI 12.08.: TATTTGAATTCGCGGCCGCTTCTAGATGACCGTTTTAATTGTTAC

pf_mdnD_EcoRI_NotI_XbaI 12.08.: TATATGAATTCGCGGCCGCTTCTAGATGAAAGCACTGGAAAAACTG

pf_mdnE_EcoRI_NotI_XbaI 12.08.: TAAATGAATTCGCGGCCGCTTCTAGATGCCTCAATATACTACTAAAC

pr_mdnABC_SpeI_NotI_PstI 12.08.: ATTTCTGCAGCGGCCGCTACTAGTATTATGAGTTAACTAGGATTTC

pr_mdnB_SpeI_NotI_PstI 12.08.: TAATCTGCAGCGGCCGCTACTAGTAACTAAAAAATCAGCGATCGC

pr_mdnD_SpeI_NotI_PstI 12.08.: ATTTCTGCAGCGGCCGCTACTAGTATCAGCAAACCCTACTTAATTTC

pr_mdnE_SpeI_NotI_PstI 12.08.: ATTTCTGCAGCGGCCGCTACTAGTACTATATTCTCACCCATTTTAAG

Further tasks:

develop PCR program

PCR

62th Labday 2011-08-13

Mini-Prep of pUP_SG1_ssTorA_CS-TEV_bla_AraC-TEV and creation of glycerol stock culture

Investigator: Sebastian

Aim:

Isolation of created plasmid pUP_SG1_ssTorA_CS-TEV_bla_AraC-TEV and establishing of an E. coli Xl1 blue glycerol stock culture for later use

Materials:

Overnight culture of E. coli XL1 Blue transformed with pUP_SG1_ssTorA_CS-TEV_bla_AraC-TEV plasmid

NucleoSpin Plasmid (NoLid) Kit purchased by Macherey-Nagel

Method:

preparing the stock culture

350 µl sterile glycerol where mixed with 350 µl form the overnight culture of E. coli XL1 blue transformed with plasmid

pUP_SG1_ssTorA_CS-TEV_bla_AraC-TEV, vortexed and stored at -80°C (stock number: G1)

Mini-prep of pUP_SG1_ssTorA_CS-TEV_bla_AraC-TEV

preparation was performed as described in the manual of the used Kit

Results:

glycerol stock culture G1: E. coli (XL1 blue) transformed with pUP_SG1_ssTorA_CS-TEV_bla_AraC-TEV

isolated plasmid pUP_SG1_ssTorA_CS-TEV_bla_AraC-TEV

Further Tasks:

sequencing of the plasmid pUP_SG1_ssTorA_CS-TEV_bla_AraC-TEV

growth test for the stock culture at different conditions (with induction by IPTG and arabinose at increasing ampicillin concentrations) --> "survival test"

preparing of competent cells, which are transformed with pUP_SG1_ssTorA_CS-TEV_bla_AraC-TEV

Miniprep of pSB1X3 + Y (X - A/T/K ; Y - YFP/CFP)

Investigators: Niels

Aim: isolate plasmid of pSB1X3 + Y (X - A/T/K ; Y - YFP/CFP)

Material: 5 ml / over night culture

pSB1T3+YFP I clone I 12.08.11 Jes

pSB1T3+YFP I clone II 12.08.11 Jes

pSB1T3+YFP I clone III 12.08.11 Jes

pSB1K3+YFP clone I 12.08.11 Jes

pSB1T3+YFP clone II 12.08.11 Jes

pSB1T3+YFP clone III 12.08.11 Jes

pSB1K3+CFP clone I 12.08.11 Jes

pSB1T3+CFP clone II 12.08.11 Jes

pSB1T3+CFP clone III 12.08.11 Jes

pSB1A3+CFP clone I 12.08.11 Jes

pSB1A3+CFP clone II 12.08.11 Jes

<b>Method:

NucleoSpin® Plasmid (NoLid) (Macherey-Nagel)

- Protocol for high-copy plasmids

- elution with 50 µl elution buffer₂O

Check concentration with NanoDrop

pSB1T3+YFP I clone I 12.08.11 Jes 10,3 ng/µl

pSB1T3+YFP I clone II 12.08.11 Jes 16,6 ng/µl

pSB1T3+YFP I clone III 12.08.11 Jes 24,2 ng/µl

pSB1K3+YFP clone I 12.08.11 Jes 29,7 ng/µl

pSB1K3+YFP clone II 12.08.11 Jes 22,9 ng/µl

pSB1K3+YFP clone III 12.08.11 Jes 25,7 ng/µl

pSB1K3+CFP clone I 12.08.11 Jes 23,4 ng/µl

pSB1K3+CFP clone II 12.08.11 Jes 37,6 ng/µl

pSB1K3+CFP clone III 12.08.11 Jes 27,8 ng/µl

pSB1A3+CFP clone I 12.08.11 Jes 5,8 ng/µl

pSB1A3+CFP clone II 12.08.11 Jes 21,7 ng/µl

<b>NOTE:

pSB1T3+YFP/CFP have the same label; we have to check the insert with test digestion

Further tasks:

digest

63th Labday 2011-08-14

Repeated PCR of mdnA and gene III for phage display (strategy 1+2)

Investigator: Sandrina, Sabine

Time: 2011-08-14,11:00-14:00

Aim:

amplification of mdnA with SfiI restriction sites (strategy 1)

amplification of mdnA with NarI and AgeI restriction sites (strategy 2)

amplification of GeneIII with NgoMIV and AatII restriction sites (strategy 2)

5 PCRs of every gene for testing different digestion and ligation conditions

Primer:

primer 31 and 56: pf_sfi-mdnA_2 and pr_sfi_mdnA_myc-2 (mdnA, strategy 1)

primer 19 and 32: pf_mdnA_iGEM_EheI and pr_mdnA_iGEM_AatII (mdnaA, strategy 2)

primer 54 and 55: pf_geneIII_NgoMIV_XbaI_myc and pr_geneIII_iGEM_AatII (geneIII, strategy 2)

Reaction Components:

2 µl (ca 16 ng) Vector pARW089 (mdnA) or pakblaKDIR (geneIII)

0,25 µl Taq Polymerase S (BioScience)

1 µl dNTPs

1 µl per primer

5 µl 10x PCR Buffer S

39,75 µl water

PCR condition changes for geneIII:

higher annealing temperature: 60°C

Stage 1: only 10 cycles (instead of 15)

purification of PCR fragments with QIAquick Gel Extraction Kit (250)

Further tasks:

digestion

Results:

PCRs of mdnA and mdnA were ok, PCR of geneIII: only oligo band

digestion of pak blaKDIR (strategy 1)

Investigator: Sandrina, Sabine

Aim: cut geneIII out of pak100 blaKDIR to use it as template for PCR of geneIII

Time: 2011-08-14, 12:00-15:00

reaction components:

5 µl pak blaKDIR (ca 350 ng)

2 µl NEB 10x buffer 2

1 µl restriction enzyme AvaI

1 µl restriction enzyme HindIII

11 µl water

reaction conditions:

3 h, 37°C

overnight culture of 10 picked clones of XL blue cells transformed with pPDV100

Investigators: Sandrina, Sabine

Aim: amplification and purification of generated phage display vector pPDV100 for test digestion and sequencing

Time: 16:00-16:30

Method/Materials:

5 ml LB medium per clone containining 100 µg/ml chloramphenicol

storage over night at 37°C and 800 rpm

Further tasks:

plasmid preparation, test digestion and sequencing

generate over night culture of

Investigators: Niels

Aim: generate a over night culture for isolating the plasmid

Material:

5 ml LB Medium

5 µl ampicilin (20 mg/ml)

plate pSB1A3+YFP

- clone I 12.08.11 Jes

- clone II 12.08.11 Jes

- clone III 12.08.11 Jes

further tasks

isolation of plasmid

digest with

64th Labday 2011-08-15

Miniprep of pSB1A3 + YFP clone I, pSB1A3 + YFP clone II, pSB1A3 + YFP clone III

Investigators: Steffi

Time: 2011-08-15, 07:00-10:00

Aim: isolate plasmid of pSB1A3 + YFP clone I, pSB1A3 + YFP clone II, pSB1A3 + YFP clone III

Material: 5 ml over night culture

pSB1A3+YFP I clone I 12.08.11 Jes

pSB1A3+YFP I clone II 12.08.11 Jes

pSB1A3+YFP I clone III 12.08.11 Jes

Method:

NucleoSpin® Plasmid (NoLid) (Macherey-Nagel)

- Protocol for high-copy plasmids

- elution with 50 µl elution buffer₂O

Check concentration with NanoDrop and Agarosegel

pSB1A3+YFP I clone I: 134.3 ng/µl

pSB1A3+YFP I clone II: 113.8 ng/µl

pSB1A3+YFP I clone III: 179.2 ng/µl

lane	Sample	Volume in µl
M	GeneRuler™ DNA Ladder Mix (diluted 1:10)	6
1	-	-
2	pSB1A3+YFP I clone I 12.08.11 Jes	1
3	pSB1A3+YFP I clone II 12.08.11 Jes	1
4	pSB1A3+YFP I clone III 12.08.11 Jes	1

Further tasks:

digest

Test digest of minipreps of pSB1X3+YFP/CPF from 2011-08-13 and 2011-08-15

Investigators: Jessica, Laura, Steffi, Vanessa

Time: 2011-08-15, 10:00-15:00

Aim: prove of Insert YFP/CPF

Materials:

pSB1T3+YFP I clone I 12.08.11 Jes pSB1T3+YFP I clone II 12.08.11 Jes pSB1T3+YFP I clone III 12.08.11 Jes pSB1K3+YFP clone I 12.08.11 Jes pSB1T3+YFP clone II 12.08.11 Jes pSB1T3+YFP clone III 12.08.11 Jes pSB1K3+CFP clone I 12.08.11 Jes pSB1T3+CFP clone II 12.08.11 Jes pSB1T3+CFP clone III 12.08.11 Jes pSB1A3+CFP clone I 12.08.11 Jes pSB1A3+CFP clone II 12.08.11 Jes

ApaLI, ClaI, HaeII, BglI

NEB Buffer 4

NEB Buffer 2

100x BSA

Agarose broad range (Roth)

1x TAE buffer

Gel Red

DNA Ladder Mix (Fermentas)

6x Loading Dye (Fermentas)

6x Loading Dye (Promega)

Digestion protocol for pSB1K3+YFP/CFP (with HaeII)

2 µl DNA

0.5 µl HaeII

2 µl 10x buffer = NEB 4

15.8 µl pure water

total: 20µl

Digestion protocol for pSB1A3+YFP/CFP (with HaeII, BglI)

2 µl DNA

0.5 µl HaeII

0.5 µl BglI

2 µl 10x buffer = NEB 2

0.2 µl 100xBSA

15.3 µl pure water

Digestion protocol for pSB1T3+YFPI (with ApaLI, ClaI)

2 µl DNA

0.5 µl ApaLI

0.5 µl ClaI

2 µl 10x buffer = NEB 4

0.2 µl 100xBSA

15.3 µl pure water

37°C for ~1h

Production of one 1 % agarose gel

1 % gel: 0.5 g agarose in 50 ml 1x TAE buffer

Adding 2 µl gel red to each gel

Loading gels and running

Add 4 µl Loading dye to each 20 µl sample

12 µl DNA Ladder Mix

Running conditions: 100 V, approx. 45 min

Loading of gels

Gel 1

lane	Sample	Volume in µl	Expected size in bp
M	GeneRuler™ DNA Ladder Mix (diluted 1:10)	12
1	pSB1A3+YFP clone I	24	765, 924, 1188
2	-
3	pSB1A3+YFP clone II	24	765, 924, 1188
4	pSB1A3+YFP clone III	24	765, 924, 1188
5	pSB1A3+CFP clone I	24	765, 924, 1188
6	pSB1A3+CFP clone II	24	765, 924, 1188

Gel 2

lane	Sample	Volume in µl	Expected size in bp
M	GeneRuler™ DNA Ladder Mix (diluted 1:10)	12
1	pSB1K3+YFP clone I	24	924, 2010
2	pSB1K3+YFP clone II	24	924, 2010
3	pSB1K3+CFP clone I	24	924, 2010
4	pSB1K3+CFP clone II	24	924, 2010
5	pSB1K3+CFP clone III	24	924, 2010
6	pSB1K3+YFP clone III	24	924, 2010
7	-
8	pSB1T3+YFP I clone I	24	536, 869, 1788
9	pSB1T3+YFP I clone II	24	536, 869, 1788
10	pSB1T3+YFP I clone III	24	536, 869, 1788

Result:

Inserts couldn't be confirmed

possible explanation: concentration of insert to low before ligation

Further tasks:

repeat digest of pGA14mVenusGeneart and pGA14-Cerulean to get YFP and CFP

repeat ligation

Transformation of E. coli RV308 with pSB1T3+YFPII

Investigators: Niels, Jessica, Steffi

Aim:Transformation of E. coli RV - cells with

Materials:

ligation of pSB1T3+YFPII from 2011-08-11

E. coli RV308

LB medium

Method:

addition of 2 µl plasmid to RV - cells

incubation 30 min on ice,

heat shock 90 sec at 42°C,

incubation 2 min on ice,

addition of 750 µl LB medium,

incubation 75 min at 37 °C and 700 rpm

plating on agar plates containing 100 µg/µl tetracycline

storage over night at 37°C

Further tasks:

Picking clones for overnight culture

mini prep and test digestion of phage display vector pPDV100 from over night cultures (strategy 1)

Investigators: Laura, Sabine

Aim: test digestion of pPDV100 to control mdnA cloning into pak blaKDIR

Time: 2011-08-15,12:00-14:15 and 16.00-18.00

Digestion of vector pPDV100 with Sfi (10 clones)

10 µl sample

2 µl NEB 10x buffer 4

1 µ restriction enzyme SfiI

7 µl water

over night at 50°C

Digestion of vector pPDV100 with PvuII (10 clones)

10 µl sample

2 µl NEB 10x buffer 4

1 µ restriction enzyme PvuII

7 µl water

over night at 37°C

digestion of vector pARW089 (strategy 2)

Investigators: Laura, Sabine

Aim: cloning od mdnA/geneIII fusion gene into pARW089

Time: 2011-08-15,17:30-18:00

Reaction components:

5 µl pARW089

2 µl NEB 10x buffer 4

1 µ restriction enzyme NarI

1 µ restriction enzyme AatII

11 µl water

Reaction conditions:

over night at 37°C

Results:

no of the expected bands (10,2 kb and 160 bp)

Survival test for E. coli XL1 blue transformed with pUP_SG1_ssTorA_CS-TEV_bla_AraC-TEV

Investigator: Sebastian, Stefan, Sascha

Aim:

testing the influence of the induction with IPTG and arabinose (different concentrations)

capacity of resistence vs. ampicillin after induction of TorA_CS-TEV_bla with IPTG

Materials:

LB-Agar

deluted overnight culture of E. coli XL1-blue transformed with pUP_SG1_TorA_CS-TEV_bla_AraC-TEV

LB-Media

Stock solutions of 1M IPTG, 1M arabinose (ara), 100mg/ml ampicillin (amp) and 25 mg/ml chloramphenicol (cm)

Methode:

100µl of deluted overnight culture of E. coli XL1-blue transformed with pUP_SG1_TorA_CS-TEV_bla_AraC-TEV (OD (600 nm)=0.002) were plated on different perpared agar plates and incubated over night at 30°C.

used plates:

- total plates: 15

- 1 plate with cm (25µg/ml)

- 1 plate with cm (25µg/ml), 1 mM IPTG

- 1 plate with cm (25µg/ml), 1 mM IPTG, amp (50 µg/ml)

- 1 plate with cm (25µg/ml), 1 mM IPTG, amp (100 µg/ml)

- 1 plate with cm (25µg/ml), 1 mM IPTG, amp (200 µg/ml)

- 1 plate with cm (25µg/ml), 1 mM IPTG, amp (400 µg/ml)

- 1 plate with cm (25µg/ml), 1 mM IPTG, amp (800 µg/ml)

- 1 plate with cm (25µg/ml), 1 mM ara

- 1 plate with cm (25µg/ml), 5 mM ara

- 1 plate with cm (25µg/ml), 10 mM ara

- 1 plate with cm (25µg/ml), 20 mM ara

- 1 plate with cm (25µg/ml), 1 mM IPTG, 1 mM ara

- 1 plate with cm (25µg/ml), 1 mM IPTG, 5 mM ara

- 1 plate with cm (25µg/ml), 1 mM IPTG, 10 mM ara

- 1 plate with cm (25µg/ml), 1 mM IPTG, 20 mM ara

Results:

Further tasks:

65th Labday 2011-08-16

Digestion of YFP from pGA14mVenusGeneart and CFP from pGA14-Cerulean

Time: 2011-08-16,08:00-14:00

Investigators: Steffi

Materials:

Preparation for ligation of YFP/CFP (insert) into pSB1A3, pSB1K3 or pSB1T3 (vectors)

Materials:

pGA14mVenusGeneart and pGA14-Cerulean

EcoRI-HF, PstI-HF

Buffer 4

100x BSA

Protocol:

Digestion protocol (following iGEM distribution protocol for linearized backbones):

Mastermix

- 2 µl NEB Buffer 4

- 0.2 µl BSA

- 1 µl EcoRI-HF

- 1 µl PstI-HF

- 10,8 µl pure water

- - total: 15 µl

reaction mix:

- 15 µl mastermix + 5 µl DNA

Incubation:

- 37°C for 1 h

Heat deactivation:

- 80°C for 20 min

Further Task:

gel electrophoresis

gel extraction and purification

Agarose Gel digested CFP and YFP fragments

Investigators: Steffi, Jessica, Nicole

Aim:Purification of YFP and CFP fragment

Time: 2011-08-16, 11:00-12:00

Materials:

digested CFP and YFP

Agarose broad range (Roth)

1x TAE buffer

Gel Red

DNA Ladder Mix (Fermentas)

6x Loading Dye (Fermentas)

Production of one 1 % agarose gel

1 % gel: 0.5 g agarose in 50 ml 1x TAE buffer

Adding 2 µl gel red gel

Loading gel and running

Add 5 µl Loading dye to each 20 µl sample

6 µl DNA Ladder Mix

Running conditions: 85 V, approx. 1 h

Loading of gel

gel: CFP and YFP

lane	Sample	Volume in µl	Expected size in bp
1	marker	6
2	-	-	-
3	CFP	20	771, 2873
4	-	-	-
5	YFP	20	763, 2881
6	-	-	-

Result:

bands appear as expected

lower bands (red box) in lane 3 and 4 were excised and DNA was extracted w/ Wizard SV Gel and PCR Clean-Up System (Promega):

- CFP dig. pur. Jes & VB 11.8.2011, ???? ng/µl

- YFP dig. pur. Jes & VB 11.8.2011, ???? ng/µl

Further tasks:

ligation of digested and purified YFP and CFP with digested and purified pSB1A3, pSB1K3 and pSB1T3

Sequencing of pSB1A3 and pSB1K3 carrying Cerulean resp. mVenus

Investigators:Nicole

Time: 2011-08-16, 13:00-14:00

Aim: Confirmation of ligation of linearized backbones pSB1A3 and pSB1K3 with mVenus and Cerulean as dummies

Materials:

pSB1A3 carrying Cerulean, miniprep done by Nadja/Nicole, cDNA = 164,1 ng/ µl

pSb1A3 carrying mVenus, miniprep done by Steffi, cDNA = 179,2 ng/ µl

pSB1K3 carrying Cerulean, miniprep done by Nadja/Nicole, cDNA = 216,2 ng/ µl

pSb1K3 carrying mVenus, miniprep done by Nadja/Nicole, cDNA = 178,9 ng/ µl

Sequencing primer: VF2

Freelabels for Value Read Tube (MWG Eurofins)

Method:

File:UP 2011-08-16 pSB1A3 pSB1K3 CFP YFP VF2.jpg

DNA concentration (for sequencing): 70 ng/ µl

Total volume: 15 µl

Primer concentration: 2 pmol/ µl

Total volume: 50 µl

sent to MWG Eurofins

Results:

expected 2011-08-18, afternoon

Further tasks:

Analyzing sequencing results

Planning and accomplishing the control PCRs of pSB1A3 and pSB1K3 carrying mVenus resp. Cerulean

Investigators: Jessica, Nicole

Time: 2011-08-16, 14:00-16:00

Aim: Confirmation of ligation of linearized backbones pSB1A3 and pSB1K3 with mVenus and Cerulean as dummies; therefore perfoming PCRs using VF2 and VR2 primers, which bind in the backbone and lead to amplification of insert

Materials:

1. Plasmids

pSB1A3 carrying Cerulean, miniprep done by Nadja/Nicole, cDNA = 164,1 ng/ µl

pSb1A3 carrying mVenus, miniprep done by Steffi, cDNA = 179,2 ng/ µl

pSB1K3 carrying Cerulean, miniprep done by Nadja/Nicole, cDNA = 216,2 ng/ µl

pSb1K3 carrying mVenus, miniprep done by Nadja/Nicole, cDNA = 178,9 ng/ µl

2. Primer

VF2

VR2

bind in the backbone and lead to amplification of insert

3. Other materials

Polymerase S and corresponding buffer

Method:

1. Reaction mix (volumes in µl)

Ingredient	pSB1A3+CFP	pSB1A3+YFP	pSB1K3+CFP	pSB1K3+YFP
DNA (1:100)	6.0	5.6	4.6	5.6
Buffer (15 mM MgCl2)	5.0	5.0	5.0	5.0
dNTPs (10 mM each)	1.0	1.0	1.0	1.0
MgCl2 (25 mM)	2.0	2.0	2.0	2.0
VF2 (10 mM)	1.0	1.0	1.0	1.0
VR2 (10 mM)	1.0	1.0	1.0	1.0
Genaxxon Polymerase S	0.3	0.3	0.3	0.3
H2O	33.7	34.1	35.1	34.1

2. PCR program (IGCONT1)

Step	Temperature	Time
Hot Start	94°C	Hold
Initial denaturation	94°C	3 min
Denaturation	94°C	45 s
Annealing	50°C	45 s
Extension	72°C	70 s
Final extension	72°C	10 min

30 cycles of denaturation, annealing and extension

Agarose gel electrophoresis

lane	Sample	Volume in µl	Expected size in bp
M	GeneRuler™ DNA Ladder Mix (diluted 1:10)	12
1	-
2	PCR of pSB1A3+CFP	6	~1000
3	PCR of pSB1A3+YFP	6	~1000
4	PCR of pSB1K3+CFP	6	~1000
5	PCR of pSB1K3+YFP	6	~1000

Results:

according to PCR all 4 plasmids carry the insert

DNA extraction of mVenus and Cerulean

Investigators: Nicole

Time: 2011-08-16, 15:00-16:00

Aim: DNA of reporter genes mVenus and Cerulean

Materials

Agarose gel electrophoresis of mVenus and Cerulean, done by Steffi previously

Machery-Nagel NucleoSpin Extract II, protocol for DNA extraction from agarose gels

Method:

extraction done based on manufacturer's protocol

Results:

DNA concentrations measured by Nanodrop

cmVenus = 6.9 ng/ µl

cCerulean = 10.6 ng/ µl

Agarose gel electrophoresis test digested pPDV100 (strategy 1)

Investigators: Sabine

Aim: control of created pPDV100

Time: 2011-08-16,10:00-12:00

Materials and Method:

0,75 % agarose gel</b>

100 V

1 h

expected bands:

SfiI digestion pak bla KDIR with mdnA insert: 200 bp and 4,3 kb

SfiI digetion pak bla KDIR without mdnA insert: 800 bp and 4,3 kb

PvuII digestion pak bla KDIR with mdnA insert: 100 bp, 1860 bp and 2550 bp

PvuII digestion pak bla KDIR with mdnA insert: 100 bp, 2480 bp and 2550 bp

Results:

clone 2 may be a positive clone

Further tasks:

send pPDV of clone 2 to Eurofins for sequencing

Sequencing of pPDV100 of clone 2 (strategy 1)

Investigators: Sabine

Aim: Control of created pPDV100

Time: 2011-08-16,13:00-14:00

Material/Method:

Miniprep of clone 2

Sequencing Primer: sf_mdna_1

Freelabels for Value ReadTube (MWG Eurofins)

DNA concentration 70 ng/ µl in a total volume of 15 µl

Primer concentration: 15 pmol/µl in the total volume of 15 µl (mix)

Further tasks:

Analyzing sequencing results

Digestion of pSB1A3/pSB1K3 with CFP/YFP and PCR fragments of the promoters (Ara, Lac, constitutive)

Time: 2011-08-16

Investigators: Nicole, Niels, Jessica

Aim:

Preparation for ligation of promoters into pSB1A3, pSB1K3 carrying CFP/YFP

Materials:

minipreps of:

- pSB1A3+YFP I clone III: 179.2 ng/µl(from 2011-08-15)

- pSB1A3+CFP, pSB1K3+CFP, pSB1K3+YFP from 2011-08-05

purified PCR fragments (Ara, Lac, constitutive) from 2011-08-02

EcoRI-HF, XbaI

Buffer 4

100x BSA

Method:

Digestion protocol (following iGEM distribution protocol for linearized backbones):

Mastermix

- 2 µl NEB Buffer 4

- 0.2 µl BSA

- 1 µl EcoRI-HF

- 1 µl PstI-HF

- 10,8 µl pure water

- - total: 15 µl

reaction mix:

- 15 µl mastermix + 5 µl DNA

Incubation:

- 37°C for 1 h

Heat deactivation:

- 80°C for 20 min

Further Task:

gel electrophoresis

gel extraction and purification

@@ Line 175: / Line 175: @@
 *TEV_mut_fragII: 400bp
-Precission:
+_3C:
-*PreSiccion_mut_fragI: 420bp
+*14_3C_mut_fragI: 420bp
-*PreSiccion_mut_fragII: 153bp
+*14_3C_mut_fragII: 153bp
 [[File:UP MutPCR TEV PRE BAMHI NgoMIV.jpg|400px]]
@@ Line 189: / Line 189: @@
 *20µl for PCR purification Kit
-*Assembly PCR of purificated products to produce NgoMIV_iGEM_TEV-Protease_iGEM_BamHI and NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI
+*Assembly PCR of purificated products to produce NgoMIV_iGEM_TEV-Protease_iGEM_BamHI and NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI
 <br>
@@ Line 259: / Line 259: @@
 <b> Further tasks: </b>
-*30µl of PCR product left: (1) Preparative Agarose Gel + Extraction(2) Digestion of fragment with HindIII and NgoMIV and gel purification (3) Ligation with (digested) NgoMIV_PreSiccion-Protease_iGEM_BamHI or NgoMIV_TEV_iGEM_BamHI fragments (see entry above).
+*30µl of PCR product left: (1) Preparative Agarose Gel + Extraction(2) Digestion of fragment with HindIII and NgoMIV and gel purification (3) Ligation with (digested) NgoMIV_14_3C-Protease_iGEM_BamHI or NgoMIV_TEV_iGEM_BamHI fragments (see entry above).
 <b> EDIT: </b>
@@ Line 269: / Line 269: @@
 <br>
-<h3 style="background-color: rgb(100, 150, 100); font-weight: bold;">Annealing of TEV_mut_fragI and TEV_mut_fragII /PreSiccion_mut_fragI and PreSiccion_mut_fragII</h3>
+<h3 style="background-color: rgb(100, 150, 100); font-weight: bold;">Annealing of TEV_mut_fragI and TEV_mut_fragII /14_3C_mut_fragI and 14_3C_mut_fragII</h3>
 <b>For better understanding of described experiment see also: [[http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx]]</b><br>
@@ Line 289: / Line 289: @@
 *r_TEV_iGEM_BamHI
-Precission:
+HRV 14_3C:
-*PreSiccion_mut_fragI: 420bp (40µl)
+*14_3C_mut_fragI: 420bp (40µl)
-*PreSiccion_mut_fragII: 153bp (40µl)
+*14_3C_mut_fragII: 153bp (40µl)
 Primers for PCR:
-*f_PreSiccion_AraFusion_NgoMIV
+*f_14_3C_AraFusion_NgoMIV
-*r_PreSiccion_iGEM_BamHI
+*r_14_3C_iGEM_BamHI
 <b> Used method: </b>
@@ Line 307: / Line 307: @@
 . Annealing of purificated primers using PCR (program iGEM002):
-*Template: Everything from purification (~15µl) = 4 reaction batches: 2x for TEV fragments, 2x Precission fragments from each purification method, respectively.
+*Template: Everything from purification (~15µl) = 4 reaction batches: 2x for TEV fragments, 2x 14_3C fragments from each purification method, respectively.
 *Nucleotides: 1 µl of 10mM ready to use dNTP mix
@@ Line 353: / Line 353: @@
 NgoMIV_iGEM_TEV-Protease_iGEM_BamHI - 760bp
-for Prescission:
+for 14_3C:
-NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI - 573bp
+NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI - 573bp
 [[File:UP TEV PRE fragment ligation annot.jpg]]
@@ Line 363: / Line 363: @@
 Ligation of TEV_mut_fragI and TEV_mut_fragII did NOT work.
-Ligation of PreSiccion_mut_fragI and PreSiccion_mut_fragII did work.
+Ligation of 14_3C_mut_fragI and 14_3C_mut_fragII did work.
-The two fractions of ligated PreSiccion fragments were combined and PCR-purificated using "NucleoSpin ExtractII"-KIT (Concentration: 25ng/µl)
+The two fractions of ligated 14_3C fragments were combined and PCR-purificated using "NucleoSpin ExtractII"-KIT (Concentration: 25ng/µl)
 <b> Further tasks: </b>
-Digestion of NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI fragment with NgoMIV and BamHI
+Digestion of NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI fragment with NgoMIV and BamHI
 Starting a new PCR for to produce new TEV-mut_fragI and TEV_mut_fragII fragments!!
@@ Line 1,201: / Line 1,201: @@
 <h2 style="background-color: rgb(240, 20, 70);">54th Labday 2011-08-05</h2>
-<h3 style="background-color: rgb(100, 150, 100); font-weight: bold;">Digestion of NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI, HindIII_iGEM_AraC_NgoMIV fragments and pJC354-NheI-143C-Xho_blaFL_GGH5 vector</h3>
+<h3 style="background-color: rgb(100, 150, 100); font-weight: bold;">Digestion of NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI, HindIII_iGEM_AraC_NgoMIV fragments and pJC354-NheI-143C-Xho_blaFL_GGH5 vector</h3>
 <b>For better understanding of described experiment see also: [[http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx]]</b><br>
@@ Line 1,209: / Line 1,209: @@
 <b>Materials:</b><br>
-NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI - 573bp
+NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI - 573bp
 HindIII_iGEM_AraC_NgoMIV - 1273bp
-pJC354-NheI-143C-Xho_blaFL_GGH5 vector (contains PreSciccion cleavage site)
+pJC354-NheI-143C-Xho_blaFL_GGH5 vector (contains 14_3C cleavage site)
 <b> Digestion protocol: </b>
-: NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI (25ng/µl):
+: NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI (25ng/µl):
-*30µl NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI
+*30µl NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI
 *1µl NgoMIV
@@ Line 1,251: / Line 1,251: @@
 : pJC354-NheI-143C-Xho_blaFL_GGH5 vector (270ng/µl)
-*4µl pJC354-NheI-143C-Xho_blaFL_GGH5 vector (contains PreSciccion cleavage site)
+*4µl pJC354-NheI-143C-Xho_blaFL_GGH5 vector (contains 14_3C cleavage site)
 *1µl HindIII
@@ Line 1,271: / Line 1,271: @@
 Resolving of digested fragments (50µl) and digested vector (50µl) on 1.5% and 1% preparative agarose gels, respectively.
-: NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI (band 5) and HindIII_iGEM_AraC_NgoMIV (band 3) fragments
+: NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI (band 5) and HindIII_iGEM_AraC_NgoMIV (band 3) fragments
 [[File:UP AraC Pre digest fragments 20110805.jpg|400px]]
@@ Line 2,071: / Line 2,071: @@
 <br>
-<h3 style="background-color: rgb(100, 150, 100); font-weight: bold;"> Ligation of NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI, HindIII_iGEM_AraC_NgoMIV and pJC354-NheI-143C-Xho_blaFL_GGH5 vector </h3>
+<h3 style="background-color: rgb(100, 150, 100); font-weight: bold;"> Ligation of NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI, HindIII_iGEM_AraC_NgoMIV and pJC354-NheI-143C-Xho_blaFL_GGH5 vector </h3>
 <b>For better understanding of described experiment see also: [[http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx]]</b><br>
@@ Line 2,081: / Line 2,081: @@
 <b>Aim:</b>Triple-ligation of
-NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI (573bp), HindIII_iGEM_AraC_NgoMIV (1273bp) and pJC354-NheI-143C-Xho_blaFL_GGH5 vector
+NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI (573bp), HindIII_iGEM_AraC_NgoMIV (1273bp) and pJC354-NheI-143C-Xho_blaFL_GGH5 vector
 <br><b>Materials:</b><br>
-* 3 µL PreScission fragment
+* 3 µL 14_3C fragment
 * 3 µL AraC fragment
@@ Line 2,109: / Line 2,109: @@
 <br>
-<h3 style="background-color: rgb(100, 150, 100); font-weight: bold;">Transformation of Ligation of pJC AraC and PreScission in ''E. coli'' XL1 blue </h3>
+<h3 style="background-color: rgb(100, 150, 100); font-weight: bold;">Transformation of Ligation of pJC AraC and 14_3C in ''E. coli'' XL1 blue </h3>
 <b>For better understanding of described experiment see also: [[http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx]]</b><br>
@@ Line 3,949: / Line 3,949: @@
 <br>
-<h3 style="background-color: rgb(100, 150, 100); font-weight: bold;"> Ligation of NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI or NgoMIV_iGEM_TEV-Protease_iGEM_BamHI, HindIII_iGEM_AraC_NgoMIV into pJC354-NheI-143C-Xho_blaFL_GGH5 or pJC354-NheI-TEV-Xho_blaFL_GGH5 vector </h3>
+<h3 style="background-color: rgb(100, 150, 100); font-weight: bold;"> Ligation of NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI or NgoMIV_iGEM_TEV-Protease_iGEM_BamHI, HindIII_iGEM_AraC_NgoMIV into pJC354-NheI-143C-Xho_blaFL_GGH5 or pJC354-NheI-TEV-Xho_blaFL_GGH5 vector </h3>
 <b>For better understanding of described experiment see also: [[http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx]]</b><br>
@@ Line 3,957: / Line 3,957: @@
 <b>Aim</b>:<br>
-*<b>1. </b>Triple-ligation of NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI (573bp), HindIII_iGEM_AraC_NgoMIV (1273bp) and pJC354-NheI-143C-Xho_blaFL_GGH5 vector (~4700bp) to create pUP_SG2_TorA_CS-PreSiccion_bla_AraC-PreSiccion<br>
+*<b>1. </b>Triple-ligation of NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI (573bp), HindIII_iGEM_AraC_NgoMIV (1273bp) and pJC354-NheI-143C-Xho_blaFL_GGH5 vector (~4700bp) to create pUP_SG2_TorA_CS-14_3C_bla_AraC-14_3C<br>
 *<b>2.</b>Triple-ligation of NgoMIV_iGEM_TEV_iGEM_BamHI (760bp), HindIII_iGEM_AraC_NgoMIV (1273bp) and pJC354-NheI-TEV-Xho_blaFL_GGH5 vector (~4700bp)to create pUP_SG1_TorA_CS-TEV_bla_AraC-TEV<br>
@@ Line 3,965: / Line 3,965: @@
 <br><b>Materials:</b><br>
-PreSciccion: 2 reaction batches (we have two digested pJC354-NheI-143C-Xho_blaFL_GGH5 vector fractions)
+_3C: 2 reaction batches (we have two digested pJC354-NheI-143C-Xho_blaFL_GGH5 vector fractions)
 :
-* 2 µL NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI fragment (573bp, 3.2ng/µl)
+* 2 µL NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI fragment (573bp, 3.2ng/µl)
 * 1,5 µL AraC fragment
@@ Line 3,983: / Line 3,983: @@
 :
-* 1,2 µL NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI (573bp, 3.2ng/µl) fragment
+* 1,2 µL NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI (573bp, 3.2ng/µl) fragment
 * 0,8 µL AraC fragment
@@ Line 4,051: / Line 4,051: @@
 <br>
-<h3 style="background-color: rgb(100, 150, 100); font-weight: bold;"> Transformation of ''E. Coli'' XL1 Blue Cells with ligation products (NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI or NgoMIV_iGEM_TEV-Protease_iGEM_BamHI, HindIII_iGEM_AraC_NgoMIV into pJC354-NheI-143C-Xho_blaFL_GGH5 or pJC354-NheI-TEV-Xho_blaFL_GGH5 vectors)</h3>
+<h3 style="background-color: rgb(100, 150, 100); font-weight: bold;"> Transformation of ''E. Coli'' XL1 Blue Cells with ligation products (NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI or NgoMIV_iGEM_TEV-Protease_iGEM_BamHI, HindIII_iGEM_AraC_NgoMIV into pJC354-NheI-143C-Xho_blaFL_GGH5 or pJC354-NheI-TEV-Xho_blaFL_GGH5 vectors)</h3>
 <b>For better understanding of described experiment see also: [[http://141.89.201.101/iGEM/wiki2011/images/c/c8/UP_SG_Klonierungsschema_Protease.pptx]]</b><br>
@@ Line 4,063: / Line 4,063: @@
 <b>Materials:<br>
-x XL1 blue cells from -80 stock, 2x PreSciccion-ligations + 2x controls ; 3x TEV-ligations + 1x control</b><br>
+x XL1 blue cells from -80 stock, 2x 14_3C-ligations + 2x controls ; 3x TEV-ligations + 1x control</b><br>
 <b>protocol:</b><br>
@@ Line 4,087: / Line 4,087: @@
 <b>Results</b><br>
-No colonies in case of PreSciccion Protease, no colonies in controls of PreSciccion
+No colonies in case of 14_3C Protease, no colonies in controls of 14_3C
 Tev: three colonies on each plate, including control plate
@@ Line 4,367: / Line 4,367: @@
 <h2 style="background-color: rgb(240, 20, 70);">61th Labday 2011-08-12</h2>
-<h3 style="background-color: rgb(100, 150, 100); font-weight: bold;"> Ligation of NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI or NgoMIV_iGEM_TEV-Protease_iGEM_BamHI with HindIII_iGEM_AraC_NgoMIV </h3>
+<h3 style="background-color: rgb(100, 150, 100); font-weight: bold;"> Ligation of NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI or NgoMIV_iGEM_TEV-Protease_iGEM_BamHI with HindIII_iGEM_AraC_NgoMIV </h3>
 <b>Investigators:</b> Sebastian, Paul
@@ Line 4,373: / Line 4,373: @@
 <b>Aim</b>:
-. Ligation of NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI (573bp) and HindIII_iGEM_AraC_NgoMIV (1273bp)<br>
+. Ligation of NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI (573bp) and HindIII_iGEM_AraC_NgoMIV (1273bp)<br>
 . Ligation of NgoMIV_iGEM_TEV_iGEM_BamHI (760bp) and HindIII_iGEM_AraC_NgoMIV (1273bp)<br>
@@ Line 4,385: / Line 4,385: @@
 :
-* 4.3 µL NgoMIV_iGEM_PreSiccion-Protease_iGEM_BamHI fragment (573bp, 3.2ng/µl)
+* 4.3 µL NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI fragment (573bp, 3.2ng/µl)
 * 3.7 µL AraC fragment
@@ Line 4,437: / Line 4,437: @@
 f_AraC_HindIII_iGEM
-Pre+AraC:
+_3C+AraC:
-r_PreSciccion_iGE´M_BamHI
+r_14_3C_iGEM_BamHI
 f_AraC_HindIII_iGEM

Team:Potsdam Bioware/Labjournal/August part 1

From 2011.igem.org

Revision as of 12:52, 21 September 2011

Contents

50th Labday 2011-08-01

Sequencing of mutated mdnA genes

Ligation of mdnA and GeneIII for phage display (strategy 2)

Ligation of mdnA/GeneIII-fusion gene into pARW089 for phage display (strategy 2)

Mutagenesis of 14_3C and TEV proteases to remove iGEM restriction sites from the proteases and introduction of iGEM restriction sites

Amplification of Arabinose Induction System from pBAD_iGEMexpress

Annealing of TEV_mut_fragI and TEV_mut_fragII /14_3C_mut_fragI and 14_3C_mut_fragII

Planning and accomplishing the PCRs of pBAD-mYFP Venus with Arabinosis and pEX_HisII with Lac

51th Labday 2011-08-02

Transformation of BBa_I763007 in E. coli XL1-Blue

Repetition of the PCRs of pBAD-mYFP Venus with Arabinosis and pEX_HisII with Lac because of less yield further planning and accomplishing the PCR of BBa_I763007 as it is a constitutive one

Preparing of linearized backbones (pSB1A3, pSB1K3 and pSB1T3) to produce vectors for further applications

Restriction enzyme digestion of linearized plasmid backbones (pSB1A3, pSB1K3 and pSB1T3)

Gel electrophoresis of digested (linearized) plasmid backbones (pSB1A3, pSB1K3 and pSB1T3)

52th Labday 2011-08-03

Transformation of generated pPDV089 (strategy 2)

Ligation of pBAD-mYFP Venus and pEX_HisII with pSB1_K3 and pSB1_A3

53th Labday 2011-08-04

digestion of vector pARW089 (strategy 2)

digestion of PCR products vector pARW089 (strategy 2)

54th Labday 2011-08-05

Digestion of NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI, HindIII_iGEM_AraC_NgoMIV fragments and pJC354-NheI-143C-Xho_blaFL_GGH5 vector

digest pSB1A3, pSB1K3 (clone 1-16)

Restriction enzyme digestion pARW089 for Phage Display strategy II

Miniprep of overnight cultures from ligation of pARW089 + mutated mdnA and test digest

Miniprep of overnight cultures from ligation of pBAD-mYFP Venus and pEX_HisII with pSB1_K3 and pSB1_A3

55th Labday 2011-08-06

2nd Mutagenesis of TEV proteases to remove iGEM restriction sites from the proteases and introduction of iGEM restriction sites

2nd Annealing of TEV_mut_fragI and TEV_mut_fragII

Digestion of NgoMIV_iGEM_TEV-Protease_iGEM_BamHI and of the unexpected band from the 2nd annealing TEV PCR

Repeated PCR of mdnA and gene III for phage display (strategy 2)

digestion of PCR products (strategy 2)

gel electrophoresis of digested fragments and digested pARW089

prepare samples for sequencing (pARW089 + mutated mdnA)

56th Labday 2011-08-07

PCR purification of TEV_mut_fragI und II

gel electrophoresisTEV_mut_fragI and II

Annealing PCR TEV_mut_fragI and II

Ligation of NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI, HindIII_iGEM_AraC_NgoMIV and pJC354-NheI-143C-Xho_blaFL_GGH5 vector

Transformation of Ligation of pJC AraC and 14_3C in E. coli XL1 blue

Repeated PCR gene III for phage display (strategy 2)

digestion of PCR products and vector (strategy 2)

prepare samples for sequencing (pSB1A3, pSB1K3)

57th Labday 2011-08-08

test digest of pSB1K3

sequencing pARW089 + mutated mdnA

Assembly PCR of TEV_frag_I and TEV_frag_II

design primer for biobrick - mdnABC,mdnB,mdnC,mdnDE,mdnD,mdnE

Ligation of mdnA/GeneIII-fusion gene into pARW089 for phage display and transformation of competent cells(strategy 2)

58th Labday 2011-08-09

test digest of pSB1K3+YFP or CFP and pSB1A3+YFP or CFP

Gel purification of amplificated TEV protease

Ampilifcation of NgoMIV_TEV_iGEM_BamHI protease via PCR

PCR -Purification of amplified NgoMIV_TEV_iGEM_BamHI DNA-Fragements

Ampilifcation of NgoMIV_TEV_iGEM_BamHI protease via PCR

ELISA to test the anti myc-tag antibodies 9E10

Preparing linearized backbones pSB1K3, pSB1A3 and pSB1T3 for ligation w/ YFP and CFP

Digestion of YFP from pGA14mVenusGeneart and CFP from pGA14-Cerulean

over night culture from PDV089

Repeated PCR of mdnA for phage display (strategy 1) repeated with new ordered reversed primer and of mdnA with rfc25 restriction sites (strategy 2), gel electrophoresis and purification of PCR products

Digestion of mdnA with sfiI over night

design primer for biobrick - redesign of pf_mdnE, pf_mdnD

59th Labday 2011-08-10

Digestion of NgoMIV_iGEM_TEV-Protease_iGEM_BamHI fragments (produced on 09.08.2011) and pJC354-NheI-TEV-Xho_blaFL_GGH5 vector

Transformation of E. coli XL1-Blue with pGA14mVenusGeneart resp. pGA14-Cerulean

Agarose Gel of digested pSB1K3, pSB1A3 and pSB1T3 and digested CFP and YFP fragments

Digestion of YFP from pGA14mVenusGeneart and CFP from pGA14-Cerulean

Miniprep of E. coli overnight culture containing pPDV089

Test digestion of ligations for strategy 2 after Plasmid preperation

cultivation of cells containing pAK100 bla KDIR from E. coli glycerol stocks

60th Labday 2011-08-11

Agarose Gel digested CFP and YFP fragments (from 2011-08-10)

Ligation of digested and purified CFP and YFP fragments (from 2011-08-11) w/ digested and purified pSB1A3, pSB1K3, pSB1T3 (from 2011-08-10)

Ligation of NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI or NgoMIV_iGEM_TEV-Protease_iGEM_BamHI, HindIII_iGEM_AraC_NgoMIV into pJC354-NheI-143C-Xho_blaFL_GGH5 or pJC354-NheI-TEV-Xho_blaFL_GGH5 vector

Transformation of E. Coli XL1 Blue Cells with ligation products (NgoMIV_iGEM_14_3C-Protease_iGEM_BamHI or NgoMIV_iGEM_TEV-Protease_iGEM_BamHI, HindIII_iGEM_AraC_NgoMIV into pJC354-NheI-143C-Xho_blaFL_GGH5 or pJC354-NheI-TEV-Xho_blaFL_GGH5 vectors)

Transformation