Team:Glasgow/LOV2
From 2011.igem.org
(Difference between revisions)
Chris Wood (Talk | contribs) |
Chris Wood (Talk | contribs) |
||
Line 54: | Line 54: | ||
LOV2 was amplified from a plasmid containing <i>lov2</i> which we acquired from Dr Andrew Roe at the University of Glasgow. The LOV2 gene contains one illegal restriction site which we removed site directed mutagenesis (SDM) using the Stratagene QuikChange kit. The primers used to remove this site: forward CGCAAAGGCGGTCTTCAGTACTTCATTGGTG and reverse CACCAATGAAGTACTGAAGACCGCCTTTGCG. | LOV2 was amplified from a plasmid containing <i>lov2</i> which we acquired from Dr Andrew Roe at the University of Glasgow. The LOV2 gene contains one illegal restriction site which we removed site directed mutagenesis (SDM) using the Stratagene QuikChange kit. The primers used to remove this site: forward CGCAAAGGCGGTCTTCAGTACTTCATTGGTG and reverse CACCAATGAAGTACTGAAGACCGCCTTTGCG. | ||
</br></br> | </br></br> | ||
- | <h3>iLOV | + | <h3>iLOV</h3> |
Taking the amino acid sequence for iLOV we codon optimised the nucleotide sequence for <i>E. Coli</i> and remove three illegal restriction sites in the sequence. The final sequence was synthesised by Geneart. Strong RBS (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_B0030">BBa_B0030</a>) and a terminator (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_B1006">BBa_B1006</a>) were also added to the iLOV sequence as a handy construct for characterising promoters. This construct was also synthesised by Geneart. | Taking the amino acid sequence for iLOV we codon optimised the nucleotide sequence for <i>E. Coli</i> and remove three illegal restriction sites in the sequence. The final sequence was synthesised by Geneart. Strong RBS (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_B0030">BBa_B0030</a>) and a terminator (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_B1006">BBa_B1006</a>) were also added to the iLOV sequence as a handy construct for characterising promoters. This construct was also synthesised by Geneart. | ||
<h2>References</h2> | <h2>References</h2> |
Revision as of 20:48, 20 September 2011
LOV 2 Domain
Fluorescent proteins have transformed our ability to visualise, quantify and monitor expression of proteins and other molecules within cells. One commonly used fluorescent proteins is GFP (Green Fluorescent Protein) Plants contain a vast array of different photoreceptors which allow them to detect light around them in order to induce responses. One class of such receptors is the phototropins (phot1 and phot2). These are blue-light responsive domains which allow responses such as phototropism (the unidirectional movement of plants in response to blue light). Phototropins are structurally made up of two regions: a photosensory domain (N-Terminus) and a serine/threonine kinase domain (C-Terminus). The photosensory region consists of two LOV (Light, oxygen and voltage) domains known as LOV1 and LOV2, which are each ~110 amino acids long. These domains are a subgroup of the larger receptor group known as the PAS family, because they are associated with co-factor binding. Each of the two LOV domains acts by binding a flavin mononucleotide (FMN) in order to form a covalent adduct with a conserved cysteine residue. The photosensory region consists of two LOV domains (Light, oxygen and voltage domain) known as LOV1 and LOV2 which are each ~110 amino acids long. These domains are a subgroup of the larger receptor group known as the PAS family, because they are associated with co-factor binding. Each of the two LOV domains acts by binding a flavin mononucleotide (FMN) in order to form a covalent adduct with a conserved cysteine residue. Research was carried out to investigate the roles played by both LOV domains in phototropism, and it was found that LOV 2 of both phot1 and phot2 plays a significant role, whereas LOV on only plays a role in phot1 (Cho et al 2007) LOV domain activity can be monitored by fluorescence. In darkenss, FMN binds non-covalently, and upon irradiation with light, this binds covalently. The reaction can be regarded as a reversible photocycle. This bound FMN co-factor is what gives the green fluorescence |
|