Revision as of 20:18, 20 September 2011

Ranaspumin2

Ranaspumin 2 is one of six proteins used by the tungara frog (Engystomops pustulosus, found in Central and South America) to form protein foam nests in which it deposits its eggs. Protein foams are relatively rare in biology, and in this case offer a biocompatible solution to incubation and protection from mechanical destruction, as well as anti-microbial properties.

A Tungara frog foam nest from Trinidad¹

Structure

Coded for by the gene rsn-2, Ranaspumin-2 is a monomeric surfactant protein, with an atomic mass of 11kDa. Ranaspumin-2 (Rsn-2) is a monomeric, 11 kDa surfactant protein identiﬁed as one of the major foam nest components of the tungara frog (Engystomops pustulosus), with an amino acid sequence unlike any other protein described so far. Wereport here on its structure in solution as determined by high-resolution NMR analysis, together with investigations of its conformation and packing at the air-water interface using a combination of infrared and neutron reﬂectivity techniques. Despite the lack of any signiﬁcant sequence similarity, Rsn-2 in solution adopts a compact globular fold characteristic of the cystatin family, comprising a single helix over a four-stranded sheet, in a motif not previously associated with surfactant activity. The NMR structure of Rsn-2 shows no obvious amphiphilicity that might be anticipated for a surfactant protein. This suggests that it must undergo a signiﬁcant conformational change when incorporated into the air-water interface that may involve a hinge-bending, clamshell opening of the separate helix and sheet segments to expose hydrophobic faces to air while maintaining the highly polar surfaces in contact with the underlying water layer. This model is supported by direct observation of the relative orientations of secondary structure elements at the interface by infrared reﬂection absorption spectroscopy, and by protein packing densities determined from neutron reﬂectivity proﬁles MW= 13415.2 117 AAs Retrieved from "http://2011.igem.org/Team:Glasgow/Ranaspumin2"

@@ Line 8: / Line 8: @@
 </p>
+<table>
+<tr>
+<td>
+<div>
+<img src="http://farm7.static.flickr.com/6169/6166704517_2646892173_m.jpg" width="300" height="250" />
+<p>
+<font size="1" color="grey>
+<i>E. pustulosus</i> forming its foam nest<sup>1</sup></font></p>
+</div>
+</td>
+<td>
+<div>
+<img src="http://farm7.static.flickr.com/6169/6166704517_2646892173_m.jpg" width="300" height="250" />
+<p>
+<font size="1" color="grey">
+A Tungara frog foam nest from Trinidad<sup>1</sup></font></p>
+</div>
+</td>
+</tr>
+</table>
 <h2>Structure </h2>
 <p>
-Coded for by the gene <i>rsn-2</i>, Ranaspumin-2 is a monomeric surfactant protein, with an atomic mass of 11kDa.
+Coded for by the gene <i>rsn-2</i>, Ranaspumin-2 is a monomeric surfactant protein, with an atomic mass of 11kDa. Ranaspumin-2 (Rsn-2) is a monomeric, 11 kDa surfactant protein identiﬁed as one of the major foam nest components of the tungara frog (Engystomops pustulosus), with an amino acid sequence unlike any other protein described so far. Wereport here on its structure in solution as determined by high-resolution NMR analysis, together with investigations of its conformation and packing at the air-water interface using a combination of infrared and neutron reﬂectivity techniques. Despite the lack of any signiﬁcant sequence similarity, Rsn-2 in solution adopts a compact globular fold characteristic of the cystatin family, comprising a single helix over a four-stranded sheet, in a motif not previously associated with surfactant activity. The NMR structure of Rsn-2 shows no obvious amphiphilicity that might be anticipated for a surfactant protein. This suggests that it must undergo a signiﬁcant conformational change when incorporated into the air-water interface that may involve a hinge-bending, clamshell opening of the separate helix and sheet segments to expose hydrophobic faces to air while maintaining the highly polar surfaces in contact with the underlying water layer. This model is supported by direct observation of the relative orientations of secondary structure elements at the interface by infrared  reﬂection absorption spectroscopy, and by protein packing densities
+determined from neutron reﬂectivity proﬁles
+MW= 13415.2 117 AAs
-Rsn-2(non-His-tagged) Sequence:
-gtgtgtgaattcgcggccgcttctagagAGGAGGATTACAAAATGTTAATATTAGATGGGGACCT
-ACTAAAGGACCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGTTA
-ATATTAGATGGGGACCTACTAAAGGACAAGTTAAAGTTACCGGTCATTGACAATCTGTTTGGTAA
-AGAACTCCTTGACAAGTTTCAAGATGATATTAAGGACAAATATGGGGTGGACACCAAAGACCTTA
-AGATCCTCAAGACATCAGAAGATAAAAGGTTTTACTATGTGTCGGTCGATGCTGGAGATGGCGAG
-AAATGTAAATTCAAGATTAGAAAAGATGTCGATGTTCCAAAGATGGTCGGACGCAAATGTAGGAA
-GGACGATGATGATGATGATGGTAATAAtactagtagcggccgctgcagacacac
-Lowercase Nucleotides: biobrick ends.
-No illegal restriction sites are present.
-Rsn-2(His-tagged)Sequence:
-gtgtgtgaattcgcggccgcttctagagAAGAAGGAGATATACCATGGGCAGCAGCCATCATCAT
-CATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGTTAATATTAGATGGGGACCTACT
-AAAGGACAAGTTAAAGTTACCGGTCATTGACAATCTGTTTGGTAAAGAACTCCTTGACAAGTTTC
-AAGATGATATTAAGGACAAATATGGGGTGGACACCAAAGACCTTAAGATCCTCAAGACATCAGAA
-GATAAAAGGTTTTACTATGTGTCGGTCGATGCTGGAGATGGCGAGAAATGTAAATTCAAGATTAG
-AAAAGATGTCGATGTTCCAAAGATGGTCGGACGCAAATGTAGGAAGGACGATGATGATGATGATG
-G(ttac)TAATAAtactagtagcggccgctgcagacacac
-Lowercase Nucleotides: biobrick ends.
-Note: Last TAATAA is double stop codon that we introduced.
-No illegal restriction sites are present.
-Poly-histidine tag may be used for protein purification, should this be required.
-Protein Product Amino Acid Sequence:
-MGSSHHHHHH SSGLVPR↓GSH MLILDGDLLK DKLKLPVIDN LFGKELLDKF QDDIKDKYGV
-DTKDLKILKT SEDKRFYYVS VDAGDGEKCK FKIRKDVDVP KMVGRKCRKD DDDDDGY
-AA’s, MW= 13415.2
+<a href="2011.igem.org/Team:Glasgow/Ranaspumin2 Sequence> Click here for Ranaspumin2 sequence</a>