Team:Glasgow/Ranaspumin2
From 2011.igem.org
Line 7: | Line 7: | ||
Ranaspumin 2 is one of six proteins used by the tungara frog (<i>Engystomops pustulosus</i>, found in Central and South America) to form protein foam nests in which it deposits its eggs. Protein foams are relatively rare in biology, and in this case offer a biocompatible solution to incubation and protection from mechanical destruction, as well as anti-microbial properties. | Ranaspumin 2 is one of six proteins used by the tungara frog (<i>Engystomops pustulosus</i>, found in Central and South America) to form protein foam nests in which it deposits its eggs. Protein foams are relatively rare in biology, and in this case offer a biocompatible solution to incubation and protection from mechanical destruction, as well as anti-microbial properties. | ||
</p> | </p> | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
Revision as of 19:59, 20 September 2011
Ranaspumin2
Ranaspumin 2 is one of six proteins used by the tungara frog (Engystomops pustulosus, found in Central and South America) to form protein foam nests in which it deposits its eggs. Protein foams are relatively rare in biology, and in this case offer a biocompatible solution to incubation and protection from mechanical destruction, as well as anti-microbial properties.
Structure
Coded for by the gene rsn-2, Ranaspumin-2 is a monomeric surfactant protein, with an atomic mass of 11kDa. Rsn-2(non-His-tagged) Sequence: gtgtgtgaattcgcggccgcttctagagAGGAGGATTACAAAATGTTAATATTAGATGGGGACCT ACTAAAGGACCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGTTA ATATTAGATGGGGACCTACTAAAGGACAAGTTAAAGTTACCGGTCATTGACAATCTGTTTGGTAA AGAACTCCTTGACAAGTTTCAAGATGATATTAAGGACAAATATGGGGTGGACACCAAAGACCTTA AGATCCTCAAGACATCAGAAGATAAAAGGTTTTACTATGTGTCGGTCGATGCTGGAGATGGCGAG AAATGTAAATTCAAGATTAGAAAAGATGTCGATGTTCCAAAGATGGTCGGACGCAAATGTAGGAA GGACGATGATGATGATGATGGTAATAAtactagtagcggccgctgcagacacac Lowercase Nucleotides: biobrick ends. No illegal restriction sites are present. Rsn-2(His-tagged)Sequence: gtgtgtgaattcgcggccgcttctagagAAGAAGGAGATATACCATGGGCAGCAGCCATCATCAT CATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGTTAATATTAGATGGGGACCTACT AAAGGACAAGTTAAAGTTACCGGTCATTGACAATCTGTTTGGTAAAGAACTCCTTGACAAGTTTC AAGATGATATTAAGGACAAATATGGGGTGGACACCAAAGACCTTAAGATCCTCAAGACATCAGAA GATAAAAGGTTTTACTATGTGTCGGTCGATGCTGGAGATGGCGAGAAATGTAAATTCAAGATTAG AAAAGATGTCGATGTTCCAAAGATGGTCGGACGCAAATGTAGGAAGGACGATGATGATGATGATG G(ttac)TAATAAtactagtagcggccgctgcagacacac Lowercase Nucleotides: biobrick ends. Note: Last TAATAA is double stop codon that we introduced. No illegal restriction sites are present. Poly-histidine tag may be used for protein purification, should this be required. Protein Product Amino Acid Sequence: MGSSHHHHHH SSGLVPR↓GSH MLILDGDLLK DKLKLPVIDN LFGKELLDKF QDDIKDKYGV DTKDLKILKT SEDKRFYYVS VDAGDGEKCK FKIRKDVDVP KMVGRKCRKD DDDDDGY 117AA’s, MW= 13415.2 == Function == The protein undergoes a conformational refolding whilst in solution, exhibiting significant surfactant properties at the air-water interface. This property makes it potentially useful when working with biofilms that form at the same phase-interface, as it is thought that it may assist in the destruction of the biofilm.