• Introduction
  • Home
  • The Team
  • Photo Gallery
• Our Project
  • Results Summary
  • Selection System
  • In-Vitro Characterization
  • In-Vivo Characterization
  • Microfluidics
  • Data
  • Attributions
• Tools
  • Gibson Assembly
  • MITOMI
• Notebook
  • Protocols
  • May
  • June
  • July
  • August
  • September
  • October
• Considerations
  • Human Practices
  • Safety
• Acknowledgements
  • Sponsors
  • Partners

Data

team, please check this page: [1]

New parts

we must have 3 favourite, then the others come in a "other biobrick" section

Medium-strength Plac

blablabla

TetR Mutants

• V36F

Sequence

ATGTCCAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTCGCCCAGAAGCTAGGTTTCGAGCAGCCTACATTGTATTGGCATGTAAAAAATAAGCGGGCTTTGCTCGACGCCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACTTTTGCCCTTTAGAAGGGGAAAGCTGGCAAGATTTTTTACGTAATAACGCTAAAAGTTTTAGATGTGCTTTACTAAGTCATCGCGATGGAGCAAAAGTACATTTAGGTACACGGCCTACAGAAAAACAGTATGAAACTCTCGAAAATCAATTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTATATGCACTCAGCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATCAAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCATTATTACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCCTTGAATTGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCT

• P39K

• Y42F

• P39Q-Y42M

Sequence

ATGTCCAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTCGCCCAGAAGCTAGGTGTAGAGCAGCAAACAGTGATGTGGCATGTAAAAAATAAGCGGGCTTTGCTCGACGCCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACTTTTGCCCTTTAGAAGGGGAAAGCTGGCAAGATTTTTTACGTAATAACGCTAAAAGTTTTAGATGTGCTTTACTAAGTCATCGCGATGGAGCAAAAGTACATTTAGGTACACGGCCTACAGAAAAACAGTATGAAACTCTCGAAAATCAATTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTATATGCACTCAGCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATCAAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCATTATTACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCCTTGAATTGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCT

T7 promoter variants

Pre-existing parts

add something about the lysis cassette, and add also on its page on the partsregistry!

DNA recovery

Vincent, you could drop your nice explanations & graphs in here :)
I guess the "Characterization of Variants Using Fluorescence" should go with the T7 promoters biobricks

T7 Promoter Variants

Characterization of Variants Using Fluorescence

For each family, we tested the randomers and the designed variants separately. To characterize the promoter strengths, we used RFP as the reporter gene and used a platereader to test for fluorescence during and after induction with IPTG.

The six designed T7 promoter variants are named as a function of their predicted promoter efficiency, relative to the wildtype. For example, T7 14 has a predicted efficiency of 14% compared to the consensus T7 promoter, whereas T7 111 is predicted to be 111% more efficient than the wildtype. In the chart above, you find each of the designed promoter variants for both the T7 with and without the lac operator, arranged in increasing predicted efficiency. Contrary to our expectation, some variants that were designed to have a lesser efficiency than the wildtype (e.g. T7 54) seem to have a much higher strength (as measured by fluorescence at saturation, normalized by the optical density). Already in the designed variants, we see a substantial difference in the behaviour of the promoters that have a lac operator as opposed to those that do not. The data for this graph was produced in triplicate, so the error bar represents the standard error across those three measurements.

In addition to fluorescence at saturation, another way to characterize promoter strength is to look at its induction ratio, which is the ratio, at saturation, of fluorescence produced by induction with IPTG versus fluorescence produced without induction. In layman's terms, it indicates how strongly the promoter reacts to induction. Here again, our results indicate that some promoter variants (T7 80 in particular) stand out with respect to this feature. Here too the importance of the lac operator in producing high induction ratios is not to be underestimated.

For the three sets of randomers for T7 with and without the lac operator, we tested seventy-two different variants and characterized their expression using the same IPTG induction protocol as with the designed variants. The goal of using these variants was to examine the range of expressions that can be produced by random mutations as opposed to directed mutations. The results, as presented in the graph, indicate that the designed variants (with and without lac operator put together) produce a much higher average normalized fluorescence than the randomers.

Characterization and DNA Recovery with Lysis

Since a major component of our scheme for selecting promoters and transcription factors with strong binding affinities required the ability to lyse cells, we also wanted to test a T7-driven lysis cassette.

Induction with various concentrations of IPTG reveals a steady increase in the amount of lysis that can be obtained. Here 500 uM yields the most substantial amount of lysis, and that concentration was used in all further experiments dealing with lysis. The negative controls were two-fold: one is an unsuccessful attempt at inserting the lysis cassette downstream of a T7 promoter in the psB3K1 plasmid, while the other is a T7 promoter upstream of an RFP gene. Neither should express lysis.

In vivo characterization - Readout systems

We created two different readout systems to characterize TetR mutants in vivo. This is the last step of our whole method, after having selected the interesting TetR-Ptet mutant pairs with the lysis device and having characterized them in vitro.

TetR - RFP

The first readout system is composed of TetR with a constitutive promoter, followed by RFP with a Ptet promoter. If TetR binds to Ptet, then RFP is repressed. For more details about them and the experimental results, please refer to the Reporter systems page.

TetR - LacI - RFP

This second readout system is composed of 3 genes: TetR under Pconst control, LacI under Ptet control (playing the role of an inverter) and finally RFP under pLac control. Here, RFP is induced when TetR binds to pTet. The experimental results are available on the systems page.