From 2011.igem.org

(Difference between revisions)

Latest revision as of 15:34, 5 September 2011

back to Team:Potsdam_Bioware
back to Laborjournal

#th Prototype-Labday 2011-05-xx

Prototype Experiment

Investigators:

Aim:

Time:

Material:

clones:
- name, source, date
- name, source, date

Method:

Results:

Example for a table

optional table caption
Column heading 1	Column heading 2	Column heading 3
Row heading 1	Cell 2	Cell 3
Row heading A	Cell B	Cell C

Conclusion:

Output: clone_name, cell type, stored fridge/freezer/-80°C; model saved as name in folder

wiki text formatting: http://en.wikipedia.org/wiki/Wikipedia:Cheatsheet; wiki table formatting: http://meta.wikimedia.org/wiki/Help:Table

lab journal May 2011

1st Labday 12.05.2011

Preparative DNA Electrophoresis, Test Experiment 629, 654 digest

Investigators: Sascha, Jessica, Steffi, Sandrina, Nadine; introduction by Kristian, Tobias, Tim
Aim: get used to the lab
Time: 13:40
Method:
Samples digested with AscI and NheI from Tim
vector: 629 source: Tobias; prep-type: ? ; prep-date: ; clone-no: ?
insert: 654 source: Tobias; prep-type: ? ; prep-date: ; clone-no: ?
Electrophoresis
sample preparation: 30 µl 629 (digested) + 6 µl 6x loading dye solution, 30 µl 654 (digested) + 6 µl 6x loading dye
0,5 g Agarose, 50 ml TAE (1%), 2 µl GELRED (3-6µl), at 100 Volt,running
marker: GeneRuler ladder mix (Fermentas)

lane	Sample	Sample/µl]	Expected size (bp)	approx. size
1	marker	4 µl
3	629	5 µl	4060, 140	6000, 3000, 150
4	629	31 µl	4060, 140	6000, 3000, 150
6	654	5 µl	4140, 1268	6000, 4000, 1700
7	654	31 µl	4140, 1268	6000, 4000, 1700 (2 bands?)

Gel Extraction
DNA excision: lane 4: 6000 bp band and 3000 bp band; lane 7: 1700 bp band
DNA purification: with Qiagen Gel Extraction Kit according to Qiagen manual (incl. isopropanol step)

Result: size estimation by eye;
lanes 3+4: plasmid was digested, small band has the expected size, two upper bands with unexpected size;
lanes 6+7: plasmid was digested; 6000 bp unexpected; 4000 bp band might correspond to expected 4140 bp band, 1700 bp band above expected 1268 bp
Conclusions:

exact vector fragment unknown, therefore 6000 bp band and 3000 bp band were excised from lane 4, lane 7: 1700 bp band was excised;
because of unexpected sizes marker should be compared with another marker, plasmids should be digested to yield several fragments for size control, maybe heat inactivation might help to resolve higher bands

Output: three plasmid fragments with 6000 bp (V1), 3000 bp (V2) and 1700 bp (I1) in 1,5 ml Eppendorf tubes, stored at -20 °C, box with fragments

Ligation 629 vector frag, 654 insert

Investigators: Sascha, Jessica, Steffi, Sandrina, Nadine
Aim: create a new vector for Tim
Time: 16:30
Method: vector: 629 source: Tobias; prep-type: ; prep-date: 12.4.2011; clone-no: ?
insert: 654 source: Tobias; prep-type: ; prep-date: 12.4.2011; clone-no: ?
Ligation: 2 µl vector, 2 µl insert, 1 µl quick ligase, 5 µl 2x quick ligase NEB, 10 min
Output: plasmid: pNoname_Tim_V1, pNoname_Tim_V2, 2 Eppendorf tubes labeled 'ligation', handed over to Tim

Transformation of ligation 629_vec_frag 654_insert

Investigators: Sascha, Jessica, Steffi, Sandrina, Nadine
Aim:amplification of previous ligation
Time: 16:40
Method:
ligation-samples from 12.5.11;
pNoname_Tim_V1 in BL21 (CaCl2 chemical competent, source: Tobias, date: unknown) and XL1 (CaCl2 chemical competent, source: Tobias, date: unknown)
pNoname_Tim_V2 in BL21 (CaCl2 chemical competent, source: Tobias, date: unknown) and XL1 (CaCl2 chemical competent, source: Tobias, date: unknown)

protocol: addition of 2 µl ligation reaction to cells in 1.5 ml Eppendorf tubes,
incubation 30 min on ice,
heat shock 45 sec at 42°C,
addition of 750 µl SOC medium,
incubation at 37 °C for 45 min in Eppendorf thermomixer at 750 rpm,
centrifugation at 2000xg; for 3 min,
decantation of supernatant,
resuspension of pellet in approx. 150 µl,
plating on LB medium with 1,5 % agar, 100 µg/ml ampicillin,
storage over night at 37°C

Results and Conclusion (13.5.2011): pNoname_Tim_V2 in BL21: 4 distinct colonies
test ligation is missing, not enough clones, pick one clone for test digest, repeat experiment
Output four agar plates given to Tim (only one with clones)

2nd Labday 2011-05-13

Design of primers and annotation of pARW071

Investigators: Jessica, Katharina, Hanna, Nadja, Nicole

Aim: Design of primers for sequencing pARW071, annotation of pARW071

Time: 2011-05-12, 4:00 pm - 8:00 pm and 2011-05-13, 11:15 am - 12:30 am

Materials/ Software:

Geneious Pro 5.1.7
Oligo Calc: Oligonucleotide Properties Calculator (http://www.basic.northwestern.edu/biotools/oligocalc.html)

Method:
1. Annotation of pARW071

Alignment of pARW071 and pDrive_Qiagen (PCR cloning vector)
Alignment of pARW071 and AM943877 (Microcystis aeruginosa NIES-298 microviridin biosynthetic gene cluster, strain NIES-298)

2. Primer design

melting temperature based on 4+2 method and sum has to be 56°C
check specific binding using dotplot feature (parameters: low sensitivity: 10, tick at reverse complementary) of Genious Pro 5.7.1
Check self-complementarity and melting temperature using Oligo Calc

Results:
Primer sequences

sf_bb_1_1 ACAATTCACTGGCCGTCG
sf_bb_2_1 AAGATCCTTGAGAGTTTTCG
sf_bb_3_1_n AAATTCCAACATGGATGCTG
sf_bb_4_1 TAATACGACTCACTATAGGG
sf_mdn_1_1 ACCAACAAATACAGAGCCAG
sf_mdna_1 GGTTATTGCAGGTGGTTAG
sf_mdnc_1 ATCGCTTCCCTACAGAGG
sf_mdnd_1 CTCCTAACCCCACC
sf_mdne_1_n AAGGTTTTTGGGTCTTTATCG
sf_mdne_2_1 CGATAAATTCTCCACAATTACC
sf_mdne_3_1 AATTGAGAAAAAGCAAATAACC
sf_mndb_1 GTTATTACAACTTCGTTTGG

pARW071 with primers and annotations

400px

Conclusion:
Primer ordering by Sigma-Aldrich

Further tasks

Midi Prep of E. coli
Sequencing of pARW071

3rd Labday 2011-05-23

Overnight culture of pARW071 and pARW089 carrying cells

Investigators: Jessica, Nadja, Nicole

Time: 2011-05-23, 5:30 pm - 7:30 pm

Materials:

LB medium
Ampicillin 100 µg/ ml

Clones:
1. pARW071 pDrive-mdnA-E, N843(Top10 cells) - clone 1; Source: Elke Dittmann; Date of plate:
2. pARW089 pDrive-mdn cluster with Aat II/ Ehe I restriction sites before and afterwards mdnA (XL1O gold cells) - clone 1; Source: Elke Dittmann

Method:
Inoculation of one clone each in 100 ml LB medium
shaking over night at 37°C, 300 rpm, approx. 19 hours

Further tasks:

Midiprep
Sequencing of complete pARW071
Sequencing of mdnA in pARW089

Output:2 overnight cultures pARW071 in Top10 cells, pARW089 in XL10 cells

4th Labday 2011-05-24

Midiprep of pARW071 and pARW089 carrying cells

Investigators: Nadja, Nicole

Aim:

Midiprep of pARW071 and pARW089 carrying cells
Glycerol stocks of E. coli cells carrying pARW071 and pARW089

Time: 2011-05-24, 3:00 pm - 7:00 pm

Materials:

Qiagen Plasmid Plus Midi Kit
Glycerol
overnight cultures ###

Method:
1. Glycerol stocks

700 µl of cell suspension
300 µl glycerol
gently mixed and frozen by -80°C

2. Midiprep

using Qiagen Plasmid Plus Midi Kit Quick-Start Protocol, Media: UP_QIAGEN_Plasmid_Plus_Midi_Kit.pdf

Output: DNA Eppendorf tubes Tube label, storage###

Further tasks:

DNA concentration determination
Sequencing of complete pARW071
Sequencing of mdnA in pARW089

5th Labday 2011-05-25

Overnight culture of E.coli cells carrying MRC and N298 fosmids

Investigators: Nadja, Nicole

Time: 2011-05-25, 4:00 pm - 7:00 pm

Materials:

LB medium
12.5 µg/ml Chloramphenicol

Method:
One clone in approx. 2 ml LB medium

N298 fosmid (mdnB) Epi cells - plate/clone 1
N298 fosmid (mdnB) Epi cells - plate/clone 2
MRC fosmid (mdnJ variants) Epi cells - clone 1
MRC fosmid (mdnJ variants) Epi cells - clone 1

shaking over night at 37°C, 300 rpm

Output: overnight cultures

Further tasks:

Glycerol stocks of each clone

6th Labday 2011-05-26

Glycerol stocks of E.coli cells carrying MRC and N298 fosmids

Investigators: Nadja, Nicole

Aim: Generating stocks for further research

Time: 2011-05-26,17:45-18:15

Materials:

Glycerol
N298 fosmid (mdnB) Epi cells - plate/clone 1
MRC fosmid (mdnJ variants) Epi cells - clone 1

Method:

700 µl of cell suspension
300 µl glycerol
mixed gently and frozen by -80°C

7th Labday 2011-05-27

Preparation of sequencing

Investigators: Jessica, Nicole, Nadja

Aim: Prepare mixtures for sequencing

Time: 2011-05-27,13:45-15:45

Materials:

Nanodrop
Primers ordered previously by Sigma Aldrich --> see labday
Isolated DNA of pARW071 and pARW089

Method:
1. Preparation of primer stocks

Primers arrived dry
Adding ddH2O (based on manufacture's sheet)
Reached concentration 100 µM

2. DNA concentration determination

Using nanodrop

3. Preparing sequencing mixtures
a. Dilution of DNA and primers

Primers: needed concentration = 10 pmol/ µl, volume needed: 20 µl
DNA: needed concentration = 60 ng/ µl, volume needed: 20 µl per 8 sequencing reactions

b. Preparation of sequencing tubes for sequencing by GATC

For each tube one barcode, green = DNA, yellow = primer
2 tubes with DNA (pARW071 and pARW089)
12 tubes with primers (sf_mdna_1 is used for pARW071 and pARW089)

Results:
1. Concentration of plasmid DNA

pARW071: 626.7 ng/ µl
pARW089: 857.3 ng/ µl

2. Sequencing ordered by GATC

Further tasks:

Analysis of sequencing of pARW071 and pARW089 (hopefully the results will arrive on monday)
Testing PCR of the complete pARW071 resp. pARW089
Inserting myc-tag
Cloning mdnA in phagemid
Cloning gene 3 in pARW089

8th Labday 2011-05-30

Searching for promotor region and primer design

Investigators: Jessica, Nicole, Sabine, Sandrina, Steffi, Nadja

Aim: Find the putative mdn promoters and design a primer (r_bb_1) which will make a PCR of the hole mdn possible

Time: 2011-05-30,15:00-17:50

Materials:

Geneious Pro 5.1.7
Oligo Calc: Oligonucleotide Properties Calculator (http://www.basic.northwestern.edu/biotools/oligocalc.html)
Some online tools to search for the promotors:

1. http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb
2. http://bioinformatics.biol.rug.nl/websoftware/ppp/ppp_start.php
3. http://genie.dartmouth.edu/scope/results.php?jobid=111290

Method:
1. Primer design

melting temperature based on 4+2 method and sum has to be 56°C
check specific binding using dotplot feature (parameters: low sensitivity: 10, tick at reverse complementary) of Genious Pro 5.7.1
Check self-complementarity and melting temperature using Oligo Calc

2. Promoter search

Application of software tools
Annotation of pARW071

Results:
1. Primer sequence

r_bb_1 CGACGAATTCAGATTAGGAA

2. Search for the promotors

Search results see PDF file Media: UP_2011-05-30_PromoterSearchResults.pdf‎

Further tasks:

PCR of mdn
Talk with Elke about the promoter

9th Labday 2011-05-31

Analysis of sequencing results and Primer design

Investigators: Jessica, Nicole, Sandrina, Nadja

Aim: Confirm pARW071 sequence and order primer (r_mdna_1) for PCR of mdnA of pARW089

Time: 2011-05-31,11:45-16:00

Materials:

Geneious Pro 5.1.7
Oligo Calc: Oligonucleotide Properties Calculator (http://www.basic.northwestern.edu/biotools/oligocalc.html)

Method:
1. Primer design

melting temperature based on 4+2 method and sum has to be 56°C
check specific binding using dotplot feature (parameters: low sensitivity: 10, tick at reverse complementary) of Genious Pro 5.7.1
Check self-complementarity and melting temperature using Oligo Calc

2. Sequencing analysis

Alignment of sequencing results with pARW071

Results:
1. Primer sequence

r_mdna_1 CGGTGTAATCAAGAAAAGT

2. Sequencing analysis

pARW071

Primer	Mismatch	Consensus location
sf_bb_1 1	-	-
sf_bb_2 1	-	-
sf_bb_3 1n	-	-
sf_bb_4 1	3	677, 777, 857
sf_mdna_1	-	-
sf_mdnb_1	/	/
sf_mdnc_1	3	2678, 2860, 2960
sf_mdn	2	3780, 4270
sf_mdne_1n	3	4718, 5041, 5158
sf_mdne_2 1	3	5480, 5800, 6050
sf_mdne_3 1	1	6824

pARW089

Primer	Mismatch	Consensus location
sf_mdna_1	-	-

Legend: - = no mismatches; / = sequencing did not work

Further tasks:

Check how serious the consequences of the found mismatches are

@@ Line 1: / Line 1: @@
+[[Laborjournal|back to Team:Potsdam_Bioware]]<br>
 [[Laborjournal|back to Laborjournal]]
 ==<p style="background-color: rgb(50, 100, 255);">#th Prototype-Labday 2011-05-xx</p>==

Labjournal may

From 2011.igem.org

Latest revision as of 15:34, 5 September 2011

Contents

#th Prototype-Labday 2011-05-xx

Prototype Experiment

lab journal May 2011

1st Labday 12.05.2011

Preparative DNA Electrophoresis, Test Experiment 629, 654 digest

Ligation 629 vector frag, 654 insert

Transformation of ligation 629_vec_frag 654_insert

2nd Labday 2011-05-13

Design of primers and annotation of pARW071

3rd Labday 2011-05-23

Overnight culture of pARW071 and pARW089 carrying cells

4th Labday 2011-05-24

Midiprep of pARW071 and pARW089 carrying cells

5th Labday 2011-05-25

Overnight culture of E.coli cells carrying MRC and N298 fosmids

6th Labday 2011-05-26

Glycerol stocks of E.coli cells carrying MRC and N298 fosmids

7th Labday 2011-05-27

Preparation of sequencing

8th Labday 2011-05-30

Searching for promotor region and primer design

9th Labday 2011-05-31

Analysis of sequencing results and Primer design