Team:Edinburgh/Biorefinery
From 2011.igem.org
(→Sorbitol) |
|||
Line 30: | Line 30: | ||
aatcaccaaacaaaaaacttcccaaatttatttaacaaaaaaatttaa</code> | aatcaccaaacaaaaaacttcccaaatttatttaacaaaaaaatttaa</code> | ||
- | This sequence contains no forbidden sites. | + | This sequence contains no forbidden sites. It does have very low GC content, though. |
This strain is available at DSMZ as [http://www.straininfo.net/strains/149324/browser DSM 4680]. | This strain is available at DSMZ as [http://www.straininfo.net/strains/149324/browser DSM 4680]. |
Revision as of 10:10, 8 July 2011
We can use stuff to break down stuff and then create new stuff with the stuff.
Once we have glucose, the natural product of cellulose degradation, possible products we can make are:
- Levan
- Levan can be used in foods, feeds, cosmetics, and the pharmaceutical and chemical industry. However limitations exist. Weak chemical stability and purification are problems. Once they are solved, the market for this should be very high.
- How to make levan is so far a mystery!
- Levan can be used in foods, feeds, cosmetics, and the pharmaceutical and chemical industry. However limitations exist. Weak chemical stability and purification are problems. Once they are solved, the market for this should be very high.
- Ethanol
- If the goal is to produce low yield high value, then ethanol is probably not the best option. There is sustainable issues which arise from making ethanol from biomass etc.
- Isoprene
- High Fructose Corn Syrup
- Xylose isomerase is the enzyme used in industry to break down glucose into fructose. It catalyses the chemical reaction D-xylose into D-xylulose. (Part not available in registry). However there has been talk on UK and EU level of banning HFCS. It has been linked with an increase in obesity and type2 diabetes, i.e. a lot of bad press.
- Sucrose
- Xylitol
- Vitamin C (Ascorbic Acid) from glucose
Sorbitol
Borrelia burgdorferi B31 is [http://www.ncbi.nlm.nih.gov/nuccore/15594346?from=538328&to=539275&report=gbwithparts reported to have an aldose reductase gene], as follows:
gtgaataatcttaaagacaagataaatacttatagcaaattaattttagggtcttggcaattcggaggaggatattttaagcaagtcgaaaaagaaactg
ctaaaaaaatattaaaaaaagcatatgatcacgggatcagaaatattgatactgcaagagcttatggaaatggaatttcggaaaaaataattggcgaaat
aatagaaaaagatccaacaataagagaaaatattttaattgcaagtaaatgctacccaatggaaatttcagaatatagagagaactttaatgaaagtctt
aaaaatttaaaaactgattatatagatatttactatatacactggcctaaagccgattttgacctaagaccaatcgcatcatttcttgaagaaatgagag
taaaaggaagaataaaatatgtaggcgtaagtaattttgaaatatcacacatggaaagcataaaaaaagtttgcaaaattgacgtaaaccaaataggata
caaccccttatttagaaataaagaaaaagatgtaattccttactgtgaagacaacaatattgccaccatatcatattcaacaattgctcaaggactttta
tctaaagctaatataaaagacaaaaacaaatttaatgatattagaacagaaaaattgatacttttcaaaaaagaaatttggccttatactttgaaaacca
taaataaacttgaagagatagcaaagataaataacttaacaattttagaattaacatattcatggcttaaaaaaacaaaattaagtggatttatagtggg
ctttagcaaggaaaattatgtagaatcaaacgtaaattcatttaaagcagaaattaatgataaagtatatgaagagattacatcaattttagataatttc
aatcaccaaacaaaaaacttcccaaatttatttaacaaaaaaatttaa
This sequence contains no forbidden sites. It does have very low GC content, though.
This strain is available at DSMZ as [http://www.straininfo.net/strains/149324/browser DSM 4680].
This was the old Navbox for Edinburgh; now it's obsolete...
- Edinburgh 2011
- Project documentation: Project - BioSandwich - Parts - Modeling - Lab Notebook - Safety - Team - Attributions
- Pages for members: Wiki Watch - Useful Links - Sequences - Primers - Practices - Official Profile (has email addresses)
- (edit this navigation box)