"
Team:UC Davis/LacI
From 2011.igem.org
(Difference between revisions)
Aheuckroth (Talk | contribs) |
|||
| Line 17: | Line 17: | ||
<div class="floatbox"> | <div class="floatbox"> | ||
<h1>LacI</h1> | <h1>LacI</h1> | ||
| - | + | <div class="floatbox3"> | |
| + | The lac repressor is responsible for regulating the metabolism of lactose. In the absence of lactose, LacI forms a tetramer with identical subunits which appears as two dimers. Each dimer binds in the major groove of the DNA binding region which subsequently blocks the RNA polymerase from binding. In nature, allolactose will bind the repressor leading to transcription of the lac operon. Using IPTG as an inducer has the same effect as allolactose. | ||
| + | </div> | ||
<div id="mutantwidget" class="floatbox2"> | <div id="mutantwidget" class="floatbox2"> | ||
Revision as of 23:47, 24 September 2011
Our Sponsors
Start a Family
Got a favorite BioBrick? Check our our process for expanding basic parts into part families.Criteria
View our judging criteria for iGEM 2011 here.
LacI
The lac repressor is responsible for regulating the metabolism of lactose. In the absence of lactose, LacI forms a tetramer with identical subunits which appears as two dimers. Each dimer binds in the major groove of the DNA binding region which subsequently blocks the RNA polymerase from binding. In nature, allolactose will bind the repressor leading to transcription of the lac operon. Using IPTG as an inducer has the same effect as allolactose.
Wildtype
caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.99315, 0.78019, 0.58405, 0.45400, 0.35401, 0.29099, 0.13305, 4Mutant 1
caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.68829, 0.48655, 0.27198, 0.15260, 0.08426, 0.05322, 0.01741,Mutant 2
caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattattgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacgca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.68514, 0.43727, 0.27724, 0.17817, 0.11684, 0.08021, 0.03415,Mutant 3
caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaaagtgagttagctcactcattaggcaccccaggctttacactttaagcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.67026, 0.44322, 0.28504, 0.17543, 0.10938, 0.07325, 0.02937,Mutant 4
caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgcgcgcaacgcaactaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacgca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.31888, 0.16625, 0.10228, 0.05821, 0.03985, 0.02549, 0.01329,Mutant 5
caatacgcaaaccgcctctccccgcgcgtcggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctccctcatcaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.63174, 0.33524, 0.17440, 0.09337, 0.03043, 0.03337, 0.01686,Mutant 6
caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctctacactttatgcttccggcttgtatgttgtgtggaattgtgagcggataacaatttcacaca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.42290, 0.29347, 0.15733, 0.09471, 0.05778, 0.03850, 0.01475,Mutant 7
caatacgcaaaccgcctctccccgcgcgttggccgattcattagtgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgtagtgtggaattgtgagcggatatcaatttcacaca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.58989, 0.32402, 0.20047, 0.11183, 0.06365, 0.03915, 0.01712,Construct
DNA Sequence
