Team:UNITS Trieste/Parts

From 2011.igem.org

(Difference between revisions)
Line 40: Line 40:
<tr><td>Vr</td> <td>ATTACCGCCTTTGAGTGAGC</td> <td>95° 5' | 30x ( 93° 30" | 50° 30" | 72° 30-120") | 72° 7' | 4° ∞</td> </tr>
<tr><td>Vr</td> <td>ATTACCGCCTTTGAGTGAGC</td> <td>95° 5' | 30x ( 93° 30" | 50° 30" | 72° 30-120") | 72° 7' | 4° ∞</td> </tr>
<tr><td>RB Fv</td> <td>CCGCTCTAGAGAAAGAGGAGAAA</td> <td>95° 5' | 30x ( 93° 30" | 50° 30" | 72° 30-120") | 72° 7' | 4° ∞</td>  </tr>
<tr><td>RB Fv</td> <td>CCGCTCTAGAGAAAGAGGAGAAA</td> <td>95° 5' | 30x ( 93° 30" | 50° 30" | 72° 30-120") | 72° 7' | 4° ∞</td>  </tr>
-
<tr><td>Hope1 fw</td> <td>GCATATTAATGAATTCGCGGCCGCTTCTAGAGGGTCGGGCTGAAAGGGAATGTGCAGATC</td> <td>95° 5' | 10x (93° 30" | 56° 30" | 72° 40") | 23x ( (93° 30" | 65° 30" | 72° 40") | 72° 7' | 4° ∞</td></tr>
 
-
<tr><td>Hope1 rev</td> <td>GCATGGATCCCTGCAGCGGCCGCTACTAGTAAATTCGGGGCCGCGGAG</td> <td>95° 5' | 10x (93° 30" | 56° 30" | 72° 40") | 23x ( (93° 30" | 65° 30" | 72° 40") | 72° 7' | 4° ∞</td></tr>
 
</tbody>
</tbody>
</table>
</table>

Revision as of 22:23, 21 September 2011

<groupparts>iGEM011 UNITS_Trieste</groupparts>
Name Seq 5' --> 3' Notes
TraI rev GTTTCTTCCTGCAGCGGCCGCTACTAGTATCACGCCGCACTCCTCAACG 95° 5' | 10x (93° 30" | 56° 30" | 72° 40") | 23x ( (93° 30" | 65° 30" | 72° 40") | 72° 7' | 4° ∞
TraI fw GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCTGATTCTGACCGTCTCGCC 95° 5' | 10x (93° 30" | 56° 30" | 72° 40") | 23x ( (93° 30" | 65° 30" | 72° 40") | 72° 7' | 4° ∞
TraR rev GTTTCTTCCTGCAGCGGCCGCTACTAGTATCAGATGAGTTTCCGCCGGATG 95° 5' | 10x (93° 30" | 56° 30" | 72° 40") | 23x ( (93° 30" | 65° 30" | 72° 40") | 72° 7' | 4° ∞
TraR fw GTTTCTTCGAATTCGCGGCCGCTTCTAGATCGACGACTGGCTGGACAAGC 95° 5' | 10x (93° 30" | 56° 30" | 72° 40") | 23x ( (93° 30" | 65° 30" | 72° 40") | 72° 7' | 4° ∞
PromTraFw GTTTCTCGAATTCGCGGCCGCTTCTAGAGAAGTGCAGATTTGCACATGAAATCAACG 95° 5' | 10x (93° 30" | 56° 30" | 72° 40") | 23x ( (93° 30" | 65° 30" | 72° 40") | 72° 7' | 4° ∞
PromTra rev GTTTCTTCCTGCAGCGGCCGCTACTAGTATAGCGGAGAGAAAACATCTCATTCAGG 95° 5' | 10x (93° 30" | 56° 30" | 72° 40") | 23x ( (93° 30" | 65° 30" | 72° 40") | 72° 7' | 4° ∞
Vf2 TGCCACCTGACGTCTAAGAA 95° 5' | 30x ( 93° 30" | 50° 30" | 72° 30-120") | 72° 7' | 4° ∞
Vr ATTACCGCCTTTGAGTGAGC 95° 5' | 30x ( 93° 30" | 50° 30" | 72° 30-120") | 72° 7' | 4° ∞
RB Fv CCGCTCTAGAGAAAGAGGAGAAA 95° 5' | 30x ( 93° 30" | 50° 30" | 72° 30-120") | 72° 7' | 4° ∞

Overview on Synbiome's results

At the beginning of the summer we aimed at having the whole consortium ready before the regional jamboree but probably we undertook too hard a challenge. We believed that engaging a tough challenge would definitely be a good way to prompt us to do our best, and so it was.
In the end, looking at our BioBricks and results, you can appreciate the validation (PDF BoBricks DataSheet) of almost all the BioBricks that we submitted.
In particular we would like to focus the attention on:

BBa_K553006
BBa_K553003
BBa_K553008
BBa_K553020
BBa_K553021
BBa_K553022

The part BBa_K553020 presents the coding sequence for a mammalian secreted beta-lactamase (sBLA).
We've used it associated to BBa_K553022 and BBa_K553022, that represent the core element of the DNA sequence recognized by TraR and a minimal CMV promoter, respectively. In a mammalian system these three elements plus a TraR-based trans-activator represent an OXOC8-inducible expression system for the production of sBLA.
The part BBa_K553008 is the core element of the communication between the two kingdoms. This part guarantees the production of OXOC8 under the stimulation of OXOC12, while BBa_K553006 produces the C.firmi-derived beta-glucosidase upon OXOC12 stimulation.
All these parts have been quantitatively tested and will guarantee the communication and mostly the inter-independence between the two kingdoms. If bacteria and eukaryotes will communicate using OXOC8, they will cooperate for the survival of the whole consortium: eukaryotes will produce beta-lactamase, vital for bacterial survival in an ampicillin-added medium, while bacteria will produce the glucosidase needed for the conversion of cellobiose (the sole - but unusable - carbon source) into glucose available for eukaryotes bacterial consumption and consequent growth.
Unfortunately we haven't had enough time to gain the same detailed results on

BBa_K553005
BBa_K553007
BBa_K553004

But we already had some confident preliminary datas that let us confirm that also the communication between bacterial strain A and B is possible, in agreement with our model.