Team:Potsdam Bioware/BioBricks
From 2011.igem.org
(→BioBrick mdnE) |
(→BioBrick mdnA) |
||
Line 90: | Line 90: | ||
<b>Part name:</b> BBa_K627001<br> | <b>Part name:</b> BBa_K627001<br> | ||
<b>Part type:</b> Coding<br> | <b>Part type:</b> Coding<br> | ||
- | <b>Short description:</b> Ribosomal precursor peptide ( | + | <b>Short description:</b> Ribosomal precursor peptide gene (mdnA) from mdn-cluster<br> |
<br> | <br> | ||
<b>Full description:</b><br> | <b>Full description:</b><br> |
Revision as of 08:36, 21 September 2011
Contents |
BioBricks
Label number | BioBrick Nickname | Tube label |
---|---|---|
BBa_K627000 | mdnED | 1 |
BBa_K627001 | mdnA | 2 |
BBa_K627002 | mdnB | 3 |
BBa_K627003 | mdnC | 4 |
BBa_K627004 | mdnD | 5 |
BBa_K627005 | mdnE | 6 |
BBa_K627006 | mdnA c-myc gene III | 7 |
BBa_K627007 | c-myc gene III | 8 |
BBa_K627008 |
BioBrick mdnED
Part name: BBa_K627000
Part type: Coding
Short description: ABC transporter and N-acetyltransferase from the mdn-cluster
Full description:
The BioBrick mdnED is a part of the whole microviridin gene (mdn) cluster, which encodes the protease
inhibitor microviridin L. Microviridins are tricyclic depsipeptides, which are ribosomally synthesized
by the cyanobacteria Microcystis aeruginosa (Ziemert et al., 2010). They have a promising potential for therapy as they can block
disease-relevant proteases (Ziemert et al., 2008).
Microviridins are synthesized from a ribosomal precursor peptide (MdnA). Additionally, the microviridin L
biosynthesis gene cluster consists of genes encoding an ATP-grasp-type ligase (mdnB and mdnC) and genes,
which encode an ABC transporter (mdnE) and a N-acetyltransferase of the GNAT family (mdnD) (Ziemert et al.,
2008).
In the following BioBrick mdnED the genes mdnD (N-acetyltransferase of the GNAT family) and mdnE (ABC
transporter) is encoded (Ziemert et al., 2008).
Source of the part:
The BioBrick mdnDE as a part of the microviridin gene (mdn) cluster was isolated from Microcystis aeruginosa strain NIES-843.
Design information:
This BioBrick was built by PCR using the following PCR primers
Forward primer: TAAATGAATTCGCGGCCGCTTCTAGATGCCTCAATATACTACTAAAC
Reverse primer: ATTTCTGCAGCGGCCGCTACTAGTATCAGCAAACCCTACTTAATTTC
To insert mdnED in the vector pSB1C3, the resulting PCR product and the vector were digested with the restriction enzymes, EcoRI and SpeI.
Because this BioBrick is an expression part, the adenin of mdnE gene's start codon is part of the XbaI
recognition site.
References:
Ziemert, N., Ishida, K., Liaimer, A., Hertweck, C. & Dittmann, E. (2008). Ribosomal synthesis of tricyclic depsipeptides in bloom-forming cyanobacteria. Angewandte Chemie (International ed. in English) 47, 7756-9
Ziemert, N., Ishida, K., Weiz, A., Hertweck, C. & Dittmann, E. (2010). Exploiting the natural diversity of microviridin gene clusters for discovery of novel tricyclic depsipeptides. Applied and environmental microbiology 76, 3568-74
Genebank file:
Media: UP_BioBrick_mdnED.gb
BioBrick mdnA
Part name: BBa_K627001
Part type: Coding
Short description: Ribosomal precursor peptide gene (mdnA) from mdn-cluster
Full description:
The BioBrick mdnA is a part of the whole microviridin gene (mdn) cluster, which encodes the protease inhibitor microviridin L. Microviridins are tricyclic depsipeptides, which are ribosomally synthesized by Microcystis aeruginosa (Ziemert et al., 2010). They have a promising potential for therapy as they can block disease-relevant proteases (Ziemert et al., 2008).
Microviridins are synthesized from a ribosomal precursor peptide (MdnA). Additionally, the microviridin L biosynthesis gene cluster consists of genes encoding an ATP-grasp-type ligase (mdnB and mdnC) and genes, which encode an ABC transporter (mdnE) and a N-acetyltransferase of the GNAT family (mdnD) (Ziemert et al., 2008).
The following BioBrick mdnA encodes the ribosomal precursor peptide (MdnA), which is encodes the microviridin (Ziemert et al., 2008).
Because this BioBrick is an expression part, the adenin of mdnB gene start codon is part of the XbaI recognition site.
Source of the part:
The BioBrick mdnA as a part of the microviridin gene (mdn) cluster was isolated from Microcystis aeruginosa strain NIES-843.
Design information:
This BioBrick was built by PCR using the following PCR primers
Forward primer:
Reverse primer:
To insert mdnA in the vector pSB1C3, the resulting PCR product and the vector were digested with the restriction enzymes EcoRI and SpeI.
Because this BioBrick is an expression part, the adenin of mdnA gene start codon is part of the XbaI recognition site. Further the sequence contains a AgeI recognition site after mdnA.
Experiences:
References:
Ziemert, N., Ishida, K., Liaimer, A., Hertweck, C. & Dittmann, E. (2008). Ribosomal synthesis of tricyclic depsipeptides in bloom-forming cyanobacteria. Angewandte Chemie (International ed. in English) 47, 7756-9
Ziemert, N., Ishida, K., Weiz, A., Hertweck, C. & Dittmann, E. (2010). Exploiting the natural diversity of microviridin gene clusters for discovery of novel tricyclic depsipeptides. Applied and environmental microbiology 76, 3568-74
Genbank file:
Media: UP_Biobrick_mdnA.gb
BioBrick mdnB
Part name: BBa_K627002
Part type: Coding
Short description: ATP-grasp-type ligase from mdn-cluster
Full description:
The BioBrick mdnB is a part of the whole microviridin gene (mdn) cluster, which encodes the protease inhibitor microviridin L. Microviridins are tricyclic depsipeptides, which are ribosomally synthesized by Microcystis aeruginosa (Ziemert et al., 2010). They have a promising potential for therapy as they can block disease-relevant proteases (Ziemert et al., 2008).
Microviridins are synthesized from a ribosomal precursor peptide (MdnA). Additionally, the microviridin L biosynthesis gene cluster consists of genes encoding an ATP-grasp-type ligase (mdnB and mdnC) and genes, which encode an ABC transporter (mdnE) and a N-acetyltransferase of the GNAT family (mdnD) (Ziemert et al., 2008).
The following BioBrick mdnB encodes a ATP-grasp-type ligase (Ziemert et al., 2008).
Because this BioBrick is an expression part, the adenin of mdnB gene start codon is part of the XbaI recognition site.
Source of the part:
The BioBrick mdnB as a part of the microviridin gene (mdn) cluster was isolated from Microcystis aeruginosa strain NIES-843.
Design information:
This BioBrick was built by PCR using the following PCR primers
Forward primer: ATTATGAATTCGCGGCCGCTTCTAGATGAAAGAATCGCCTAAAGTTG
Reverse primer: TAATCTGCAGCGGCCGCTACTAGTATCAACCGAAGACTAAAAAATCAGCG
To insert mdnB in the vector pSB1C3, the resulting PCR product and the vector were digested with the restriction enzymes EcoRI and SpeI.
Because this BioBrick is an expression part, the adenin of mdnE gene's start codon is part of the XbaI recognition site.
References:
Ziemert, N., Ishida, K., Liaimer, A., Hertweck, C. & Dittmann, E. (2008). Ribosomal synthesis of tricyclic depsipeptides in bloom-forming cyanobacteria. Angewandte Chemie (International ed. in English) 47, 7756-9
Ziemert, N., Ishida, K., Weiz, A., Hertweck, C. & Dittmann, E. (2010). Exploiting the natural diversity of microviridin gene clusters for discovery of novel tricyclic depsipeptides. Applied and environmental microbiology 76, 3568-74
Genbank file:
Media: UP_BioBrick_mdnB.gb
BioBrick mdnC
Part name: BBa_K627003
Part type: Coding
Short description: ATP-grasp-type ligase from the mdn-cluster
Full description:
The BioBrick mdnC is a part of the whole microviridin gene (mdn) cluster, which encodes the protease
inhibitor microviridin L. Microviridins are tricyclic depsipeptides, which are ribosomally synthesized
by Microcystis (Ziemert et al., 2010). They have a promising potential for therapy as they can block
disease-relevant proteases (Ziemert et al., 2008).
Microviridins are synthesized from a ribosomal precursor peptide (MdnA). Additionally, the microviridin L
biosynthesis gene cluster consists of genes encoding an ATP-grasp-type ligase (mdnB and mdnC) and genes,
which encode an ABC transporter (mdnE) and a N-acetyltransferase of the GNAT family (mdnD) (Ziemert et al.,
2008).
The following BioBrick mdnC encodes the ATP-grasp-type ligase (Ziemert et al., 2008).
Because this BioBrick is an expression part, the adenin of mdnC gene's start codon is part of the XbaI
recognition site.
Source of the part:
The BioBrick mdnC as a part of the microviridin gene (mdn) cluster was isolated from Microcystis aeruginosa strain NIES-843.
Design information:
This BioBrick was built by PCR using the following PCR primers
Forward primer: TATTTGAATTCGCGGCCGCTTCTAGATGACCGTTTTAATTGTTAC
Reverse primer: ATTTCTGCAGCGGCCGCTACTAGTATTATGAGTTAACTAGGATTTC
To insert mdnC in the vector pSB1C3, the resulting PCR product and the vector were digested with the restriction enzymes EcoRI and SpeI.
Because this BioBrick is an expression part, the adenin of mdnA gene start codon is part of the XbaI recognition site.
References:
Ziemert, N., Ishida, K., Liaimer, A., Hertweck, C. & Dittmann, E. (2008). Ribosomal synthesis of tricyclic depsipeptides in bloom-forming cyanobacteria. Angewandte Chemie (International ed. in English) 47, 7756-9
Ziemert, N., Ishida, K., Weiz, A., Hertweck, C. & Dittmann, E. (2010). Exploiting the natural diversity of microviridin gene clusters for discovery of novel tricyclic depsipeptides. Applied and environmental microbiology 76, 3568-74
Genebank file:
Media: UP_BioBrick_mdnC.gb
BioBrick mdnD
Part name: BBa_K627004
Part type: Coding
Short description: N-acetyltransferase from the mdn-cluster
Full description:
The BioBrick mdnD is a part of the whole microviridin gene (mdn) cluster, which encodes the protease
inhibitor microviridin L. Microviridins are tricyclic depsipeptides, which are ribosomally synthesized
by Microcystis (Ziemert et al., 2010). They have a promising potential for therapy as they can block
disease-relevant proteases (Ziemert et al., 2008).
Microviridins are synthesized from a ribosomal precursor peptide (MdnA). Additionally, the microviridin L
biosynthesis gene cluster consists of genes encoding an ATP-grasp-type ligase (mdnB and mdnC) and genes,
which encode an ABC transporter (mdnE) and a N-acetyltransferase of the GNAT family (mdnD) (Ziemert et al.,
2008).
The following BioBrick mdnD encodes a N-acetyltransferase of the GNAT family (Ziemert et al., 2008).
Because this BioBrick is an expression part, the adenin of mdnD gene's start codon is part of the XbaI
recognition site.
Source of the part:
The BioBrick mdnD as a part of the microviridin gene (mdn) cluster was isolated from Microcystis aeruginosa strain NIES-843.
Design information:
This BioBrick was built by PCR using the following PCR primers
Forward primer: TATATGAATTCGCGGCCGCTTCTAGATGAAAGCACTGGAAAAACTG
Reverse primer: ATTTCTGCAGCGGCCGCTACTAGTATCAGCAAACCCTACTTAATTTC
To insert mdnD in the vector pSB1C3, the resulting PCR product and the vector were digested with the restriction enzymes EcoRI and SpeI.
Because this BioBrick is an expression part, the adenin of mdnD gene start codon is part of the XbaI recognition site.
References:
Ziemert, N., Ishida, K., Liaimer, A., Hertweck, C. & Dittmann, E. (2008). Ribosomal synthesis of tricyclic depsipeptides in bloom-forming cyanobacteria. Angewandte Chemie (International ed. in English) 47, 7756-9
Ziemert, N., Ishida, K., Weiz, A., Hertweck, C. & Dittmann, E. (2010). Exploiting the natural diversity of microviridin gene clusters for discovery of novel tricyclic depsipeptides. Applied and environmental microbiology 76, 3568-74
Genebank file
Media: UP_BioBrick_mdnD.gb
BioBrick mdnE
Part name: BBa_K627005
Part type: Coding
Short description: ABC transporter from the mdn-cluster
Full description:
The BioBrick mdnE is a part of the whole microviridin gene (mdn) cluster, which encodes the protease
inhibitor microviridin L. Microviridins are tricyclic depsipeptides, which are ribosomally synthesized
by Microcystis (Ziemert et al., 2010). They have a promising potential for therapy as they can block
disease-relevant proteases (Ziemert et al., 2008).
Microviridins are synthesized from a ribosomal precursor peptide (MdnA). Additionally, the microviridin L
biosynthesis gene cluster consists of genes encoding an ATP-grasp-type ligase (mdnB and mdnC) and genes,
which encode an ABC transporter (mdnE) and a N-acetyltransferase of the GNAT family (mdnD) (Ziemert et al.,
2008).
The following BioBrick mdnE encodes an ABC transporter (Ziemert et al., 2008).
Because this BioBrick is an expression part, the adenin of mdnE gene's start codon is part of the XbaI
recognition site.
Source of the part:
The BioBrick mdnE as a part of the microviridin gene (mdn) cluster was isolated from Microcystis aeruginosa strain NIES-843.
Design information:
This BioBrick was built by PCR using the following PCR primers
Forward primer: TAAATGAATTCGCGGCCGCTTCTAGATGCCTCAATATACTACTAAAC
Reverse primer: ATTTCTGCAGCGGCCGCTACTAGTACTATATTCTCACCCATTTTAAG
To insert mdnE in the vector pSB1C3, the resulting PCR product and the vector were digested with the restriction enzymes EcoRI and SpeI.
Because this BioBrick is an expression part, the adenin of mdnE gene start codon is part of the XbaI recognition site.
References:
Ziemert, N., Ishida, K., Liaimer, A., Hertweck, C. & Dittmann, E. (2008). Ribosomal synthesis of tricyclic depsipeptides in bloom-forming cyanobacteria. Angewandte Chemie (International ed. in English) 47, 7756-9
Ziemert, N., Ishida, K., Weiz, A., Hertweck, C. & Dittmann, E. (2010). Exploiting the natural diversity of microviridin gene clusters for discovery of novel tricyclic depsipeptides. Applied and environmental microbiology 76, 3568-74
Genebank file
Media: UP_BioBrick_mdnE.gb
BioBrick mdnA c-myc gene III
Part name: BBa_K627006
Part type: Coding
Short description: Fusion part of mdnA gene with c-terminal myc-tag and gene III
Full description:
An appropriate vector containing the biobrick mdnA-myc-geneIII-fusion gene is a very important milestone of the development of a functional phage display system for screening of a microviridin (mdnA) library. Microviridins are tricyclic peptides from cyanocacteria which are able to bind and inhibit proteases. The gene III protein is a coat protein from the filamentous bacteriophage M13. It appears only 3-5 times on the tip of the phage and is responsible for infection of bacterial cells. After transformation of E. coli with the vector and co-infection with helper phages E. coli cells are able to produce phage particles carrying microviridin on their surface. Using these phages the fundamental suitability of phage display as a screening method for mdnA varieties was indicated. This has great importance for identifying microviridin varieties of therapeutical relevance. The inserted myc sequence enables the easy detection or purification . In our project the successful expression of the mdnA-myc -gene-III-fusion protein was determined by ELISA. Subsequent the production of phages carrying mdnA in E. coli was analyzed by phage display.
Source of the part:
The BioBrick mdnA is a part of the microviridin gene (mdn) cluster which was isolated from Microcystis aeruginosa strain NIES-843.
The gene III protein is a coat protein from the filamentous bacteriophage M13.
Design information:
Gene III was amplified from the vector pak100 bla KDIR using the following primer
Forward:TAAGCTTCTAGATGGCCGGCGAGCAGAAGCTGATCTCTGAGGAAGACCTGGGTGGTGGCTCTGGTTCC
Reverse: TGCTTAGACGTCCTGCAGCGGCCGCTACTAGTATTAACCGGTAGACTCCTTATTACGCAGTA
MdnA was amplified from the vector pARW089 using the following primer
Forward: TTCCATGGCGCCAGAGGAATCTAGATGGCATATCCCAACGATC
Reverse: CTTCTGACTGGGAAGATTATACCGGTTAATACTAGTAGCGGCCGCTGCAGGACGTC
Gene III was amplified from pak100blaKDIR and mdnA from pARW089 by PCR. The primers were designed to enable the introduction of iGEM. The PCR product gene III was digested by whereas the PCR product mdnA was digested by AgeI. Thus a mdnA-gene III fusion part according to RFC25 was generated whereby AgeI and NgoMIV overhangs are compatible and placed in frame with the protein sequence. The ligation of AgeI and NgoMIV overhangs resulted in a scar coding for the threonine and glycine. Because the introduction of restriction sites before mdnA leaded to a great distance between ribosome binding site and mdnA a second RBS was inserted among SfoI and XbaI recognition sites to ensure a sufficiently expression rate of the mdnA-geneIII-fusion gene. Between mdnA and gene III myc sequence was inserted.
Because this BioBrick is an expression part, the adenin of mdnA gene start codon is part of the XbaI recognition site. Further the sequence contains a AgeI recognition site after gene III.
Experiences:
References:
Smith, G.P. (1985). Filamentous fusion phage: Novel expression vectors that display cloned antigens on the virus surface. Science 228: 1315-17
Ziemert, N., Ishida, K., Liaimer, A., Hertweck, C. & Dittmann, E. (2008). Ribosomal synthesis of tricyclic depsipeptides in bloom-forming cyanobacteria. Angewandte Chemie (International ed. in English) 47, 7756-9
Ziemert, N., Ishida, K., Weiz, A., Hertweck, C. & Dittmann, E. (2010). Exploiting the natural diversity of microviridin gene clusters for discovery of novel tricyclic depsipeptides. Applied and environmental microbiology 76, 3568-74
Genbank file:
Media: UP_Biobrick_mdnA_c-myc_geneIII.gb