Team:Potsdam Bioware/BioBricks

BioBricks

BioBrick mdnED

Part name: BBa_K627000
Part type: Coding
Short description: ABC transporter and N-acetyltransferase from the mdn-cluster

Full description:
The BioBrick mdnED is a part of the whole microviridin gene (mdn) cluster, which encodes the protease inhibitor microviridin L. Microviridins are tricyclic depsipeptides, which are ribosomally synthesized by the cyanobacteria Microcystis aeruginosa (Ziemert et al., 2010). They have a promising potential for therapy as they can block disease-relevant proteases (Ziemert et al., 2008).

Microviridins are synthesized from a ribosomal precursor peptide (MdnA). Additionally, the microviridin L biosynthesis gene cluster consists of genes encoding an ATP-grasp-type ligase (mdnB and mdnC) and genes, which encode an ABC transporter (mdnE) and a N-acetyltransferase of the GNAT family (mdnD) (Ziemert et al., 2008).

In the following BioBrick mdnED the genes mdnD (N-acetyltransferase of the GNAT family) and mdnE (ABC transporter) is encoded (Ziemert et al., 2008).

Source of the part:
The BioBrick mdnDE as a part of the microviridin gene (mdn) cluster was isolated from Microcystis aeruginosa strain NIES-843.

Design information:
This BioBrick was built by PCR using the following PCR primers
Forward primer: TAAATGAATTCGCGGCCGCTTCTAGATGCCTCAATATACTACTAAAC
Reverse primer: ATTTCTGCAGCGGCCGCTACTAGTATCAGCAAACCCTACTTAATTTC
To insert mdnED in the vector pSB1C3, the resulting PCR product and the vector were digested with the restriction enzymes, EcoRI and SpeI.

Because this BioBrick is an expression part, the adenin of mdnE gene's start codon is part of the XbaI recognition site.

References:
Ziemert, N., Ishida, K., Liaimer, A., Hertweck, C. & Dittmann, E. (2008). Ribosomal synthesis of tricyclic depsipeptides in bloom-forming cyanobacteria. Angewandte Chemie (International ed. in English) 47, 7756-9

Ziemert, N., Ishida, K., Weiz, A., Hertweck, C. & Dittmann, E. (2010). Exploiting the natural diversity of microviridin gene clusters for discovery of novel tricyclic depsipeptides. Applied and environmental microbiology 76, 3568-74

Genebank file:
Media: UP_BioBrick_mdnED.gb

BioBrick mdnA

Part name: BBa_K627003
Part type: Coding
Short description: Ribosomal precursor peptide (MdnA) from mdn-cluster

Full description:
The BioBrick mdnA is a part of the whole microviridin gene (mdn) cluster, which encodes the protease inhibitor microviridin L. Microviridins are tricyclic depsipeptides, which are ribosomally synthesized by Microcystis aeruginosa (Ziemert et al., 2010). They have a promising potential for therapy as they can block disease-relevant proteases (Ziemert et al., 2008).

Microviridins are synthesized from a ribosomal precursor peptide (MdnA). Additionally, the microviridin L biosynthesis gene cluster consists of genes encoding an ATP-grasp-type ligase (mdnB and mdnC) and genes, which encode an ABC transporter (mdnE) and a N-acetyltransferase of the GNAT family (mdnD) (Ziemert et al., 2008).

The following BioBrick mdnA encodes the ribosomal precursor peptide (MdnA), which is encodes the microviridin (Ziemert et al., 2008).

Because this BioBrick is an expression part, the adenin of mdnB gene start codon is part of the XbaI recognition site.

Source of the part:
The BioBrick mdnA as a part of the microviridin gene (mdn) cluster was isolated from Microcystis aeruginosa strain NIES-843.

Design information: This BioBrick was built by PCR using the following PCR primers
Forward primer:
Reverse primer:
To insert mdnA in the vector pSB1C3, the resulting PCR product and the vector were digested with the restriction enzymes EcoRI and SpeI.

Because this BioBrick is an expression part, the adenin of mdnA gene start codon is part of the XbaI recognition site. Further the sequence contains a AgeI recognition site after mdnA.

Experiences:

References: Ziemert, N., Ishida, K., Liaimer, A., Hertweck, C. & Dittmann, E. (2008). Ribosomal synthesis of tricyclic depsipeptides in bloom-forming cyanobacteria. Angewandte Chemie (International ed. in English) 47, 7756-9
Ziemert, N., Ishida, K., Weiz, A., Hertweck, C. & Dittmann, E. (2010). Exploiting the natural diversity of microviridin gene clusters for discovery of novel tricyclic depsipeptides. Applied and environmental microbiology 76, 3568-74

Genbank file:
Media: UP_Biobrick_mdnA.gb

BioBrick mdnB

Part name: BBa_K627004
Part type: Coding
Short description: ATP-grasp-type ligase from mdn-cluster

Full description:
The BioBrick mdnB is a part of the whole microviridin gene (mdn) cluster, which encodes the protease inhibitor microviridin L. Microviridins are tricyclic depsipeptides, which are ribosomally synthesized by Microcystis aeruginosa (Ziemert et al., 2010). They have a promising potential for therapy as they can block disease-relevant proteases (Ziemert et al., 2008).

Microviridins are synthesized from a ribosomal precursor peptide (MdnA). Additionally, the microviridin L biosynthesis gene cluster consists of genes encoding an ATP-grasp-type ligase (mdnB and mdnC) and genes, which encode an ABC transporter (mdnE) and a N-acetyltransferase of the GNAT family (mdnD) (Ziemert et al., 2008).

The following BioBrick mdnB encodes a ATP-grasp-type ligase (Ziemert et al., 2008).

Because this BioBrick is an expression part, the adenin of mdnB gene start codon is part of the XbaI recognition site.

Source of the part:
The BioBrick mdnB as a part of the microviridin gene (mdn) cluster was isolated from Microcystis aeruginosa strain NIES-843.

Design information: This BioBrick was built by PCR using the following PCR primers
Forward primer: ATTATGAATTCGCGGCCGCTTCTAGATGAAAGAATCGCCTAAAGTTG
Reverse primer: TAATCTGCAGCGGCCGCTACTAGTAACTAAAAAATCAGCGATCGC
To insert mdnB in the vector pSB1C3, the resulting PCR product and the vector were digested with the restriction enzymes EcoRI and SpeI.

Because this BioBrick is an expression part, the adenin of mdnE gene's start codon is part of the XbaI recognition site.

References: Ziemert, N., Ishida, K., Liaimer, A., Hertweck, C. & Dittmann, E. (2008). Ribosomal synthesis of tricyclic depsipeptides in bloom-forming cyanobacteria. Angewandte Chemie (International ed. in English) 47, 7756-9
Ziemert, N., Ishida, K., Weiz, A., Hertweck, C. & Dittmann, E. (2010). Exploiting the natural diversity of microviridin gene clusters for discovery of novel tricyclic depsipeptides. Applied and environmental microbiology 76, 3568-74

Genbank file:
Media: UP_Biobrick_mdnB.gb

BioBrick mdnC

Part name: BBa_K627005
Part type: Coding
Short description: ATP-grasp-type ligase from the mdn-cluster

Full description:
The BioBrick mdnC is a part of the whole microviridin gene (mdn) cluster, which encodes the protease inhibitor microviridin L. Microviridins are tricyclic depsipeptides, which are ribosomally synthesized by Microcystis (Ziemert et al., 2010). They have a promising potential for therapy as they can block disease-relevant proteases (Ziemert et al., 2008).

Microviridins are synthesized from a ribosomal precursor peptide (MdnA). Additionally, the microviridin L biosynthesis gene cluster consists of genes encoding an ATP-grasp-type ligase (mdnB and mdnC) and genes, which encode an ABC transporter (mdnE) and a N-acetyltransferase of the GNAT family (mdnD) (Ziemert et al., 2008).

The following BioBrick mdnC encodes the ATP-grasp-type ligase (Ziemert et al., 2008).

Because this BioBrick is an expression part, the adenin of mdnC gene's start codon is part of the XbaI recognition site.

Source of the part:
The BioBrick mdnC as a part of the microviridin gene (mdn) cluster was isolated from Microcystis aeruginosa strain NIES-843.

Design information:
This BioBrick was built by PCR using the following PCR primers
Forward primer: TATTTGAATTCGCGGCCGCTTCTAGATGACCGTTTTAATTGTTAC
Reverse primer: ATTTCTGCAGCGGCCGCTACTAGTATTATGAGTTAACTAGGATTTC
To insert mdnC in the vector pSB1C3, the resulting PCR product and the vector were digested with the restriction enzymes EcoRI and SpeI.

Because this BioBrick is an expression part, the adenin of mdnA gene start codon is part of the XbaI recognition site.

References:
Ziemert, N., Ishida, K., Liaimer, A., Hertweck, C. & Dittmann, E. (2008). Ribosomal synthesis of tricyclic depsipeptides in bloom-forming cyanobacteria. Angewandte Chemie (International ed. in English) 47, 7756-9

Ziemert, N., Ishida, K., Weiz, A., Hertweck, C. & Dittmann, E. (2010). Exploiting the natural diversity of microviridin gene clusters for discovery of novel tricyclic depsipeptides. Applied and environmental microbiology 76, 3568-74

Genebank file:
Media: UP_BioBrick_mdnC.gb

BioBrick mdnD

Part name: BBa_K627006
Part type: Coding
Short description: N-acetyltransferase from the mdn-cluster

Full description:
The BioBrick mdnD is a part of the whole microviridin gene (mdn) cluster, which encodes the protease inhibitor microviridin L. Microviridins are tricyclic depsipeptides, which are ribosomally synthesized by Microcystis (Ziemert et al., 2010). They have a promising potential for therapy as they can block disease-relevant proteases (Ziemert et al., 2008).

Microviridins are synthesized from a ribosomal precursor peptide (MdnA). Additionally, the microviridin L biosynthesis gene cluster consists of genes encoding an ATP-grasp-type ligase (mdnB and mdnC) and genes, which encode an ABC transporter (mdnE) and a N-acetyltransferase of the GNAT family (mdnD) (Ziemert et al., 2008).

The following BioBrick mdnD encodes a N-acetyltransferase of the GNAT family (Ziemert et al., 2008).

Because this BioBrick is an expression part, the adenin of mdnD gene's start codon is part of the XbaI recognition site.

Source of the part:
The BioBrick mdnD as a part of the microviridin gene (mdn) cluster was isolated from Microcystis aeruginosa strain NIES-843.

Design information:
This BioBrick was built by PCR using the following PCR primers
Forward primer: TATATGAATTCGCGGCCGCTTCTAGATGAAAGCACTGGAAAAACTG
Reverse primer: ATTTCTGCAGCGGCCGCTACTAGTATCAGCAAACCCTACTTAATTTC
To insert mdnD in the vector pSB1C3, the resulting PCR product and the vector were digested with the restriction enzymes EcoRI and SpeI.

Because this BioBrick is an expression part, the adenin of mdnD gene start codon is part of the XbaI recognition site.

References:
Ziemert, N., Ishida, K., Liaimer, A., Hertweck, C. & Dittmann, E. (2008). Ribosomal synthesis of tricyclic depsipeptides in bloom-forming cyanobacteria. Angewandte Chemie (International ed. in English) 47, 7756-9

Ziemert, N., Ishida, K., Weiz, A., Hertweck, C. & Dittmann, E. (2010). Exploiting the natural diversity of microviridin gene clusters for discovery of novel tricyclic depsipeptides. Applied and environmental microbiology 76, 3568-74

Genebank file

BioBrick mdnE

Part name: BBa_K627007
Part type: Coding
Short description: ABC transporter from the mdn-cluster

Full description:
The BioBrick mdnE is a part of the whole microviridin gene (mdn) cluster, which encodes the protease inhibitor microviridin L. Microviridins are tricyclic depsipeptides, which are ribosomally synthesized by Microcystis (Ziemert et al., 2010). They have a promising potential for therapy as they can block disease-relevant proteases (Ziemert et al., 2008).

Microviridins are synthesized from a ribosomal precursor peptide (MdnA). Additionally, the microviridin L biosynthesis gene cluster consists of genes encoding an ATP-grasp-type ligase (mdnB and mdnC) and genes, which encode an ABC transporter (mdnE) and a N-acetyltransferase of the GNAT family (mdnD) (Ziemert et al., 2008).

The following BioBrick mdnE encodes an ABC transporter (Ziemert et al., 2008).

Because this BioBrick is an expression part, the adenin of mdnE gene's start codon is part of the XbaI recognition site.

Source of the part:
The BioBrick mdnC as a part of the microviridin gene (mdn) cluster was isolated from Microcystis aeruginosa strain NIES-843.

References:
Ziemert, N., Ishida, K., Liaimer, A., Hertweck, C. & Dittmann, E. (2008). Ribosomal synthesis of tricyclic depsipeptides in bloom-forming cyanobacteria. Angewandte Chemie (International ed. in English) 47, 7756-9

Ziemert, N., Ishida, K., Weiz, A., Hertweck, C. & Dittmann, E. (2010). Exploiting the natural diversity of microviridin gene clusters for discovery of novel tricyclic depsipeptides. Applied and environmental microbiology 76, 3568-74

Genebank file