Team:Freiburg/Notebook/23 August
From 2011.igem.org
(Difference between revisions)
(→blue light receptor) |
|||
(6 intermediate revisions not shown) | |||
Line 1: | Line 1: | ||
{{:Team:Freiburg/Templates/header}} | {{:Team:Freiburg/Templates/header}} | ||
+ | <html> | ||
+ | <div id="notebook-page-header"> | ||
+ | <div id="notebook-back" width="100px" > | ||
+ | <a href="https://2011.igem.org/Team:Freiburg/Notebook/22_August">Previous entry</a> | ||
+ | </div> | ||
+ | <div id="notebook-title"> | ||
+ | <a href="https://2011.igem.org/Team:Freiburg/Notebook"> 23 August </a> | ||
+ | </div> | ||
+ | <div id="notebook-next"> | ||
+ | <a href="https://2011.igem.org/Team:Freiburg/Notebook/24_August">Next entry</a> | ||
+ | </div> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | |||
==<span style="color:green;">green light receptor</span>== | ==<span style="color:green;">green light receptor</span>== | ||
Line 33: | Line 48: | ||
For a 50 µl reaction use | For a 50 µl reaction use | ||
+ | |||
+ | P77: <br/> | ||
+ | * CACAGGAAACCtcactaATGAGgATcCTTTTAGTGGAGGATGATTTGCc <br/> | ||
+ | P78: <br/> | ||
+ | * gGCAAATCATCCTCCACTAAAAGgATcCTCATtagtgaGGTTTCCTGTG <br/> | ||
Line 146: | Line 166: | ||
|} | |} | ||
+ | <br/> | ||
+ | |||
+ | ===continuing with quickchanged CcaS and CcaR=== | ||
+ | |||
+ | '''Investigator: Julia''' | ||
<br/> | <br/> | ||
+ | on the plates for CcaR were no colonies at all :(<br/> | ||
+ | the quickchanged CcaS had about six colonies per plate. <br/> nine were picked for miniprep ( 3ml LB medium with Kanamycin).<br/> | ||
==<span style="color:blue;">blue light receptor</span>== | ==<span style="color:blue;">blue light receptor</span>== | ||
Line 159: | Line 186: | ||
'''Investigators: Sophie:''' | '''Investigators: Sophie:''' | ||
- | LOV-pcr, NOT-pcr and the Amp vector where ligated at | + | LOV-pcr, NOT-pcr and the Amp vector where ligated for 1h at room temperature |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
===Transformation=== | ===Transformation=== | ||
Line 203: | Line 226: | ||
For a 50 µl reaction use | For a 50 µl reaction use | ||
+ | |||
+ | P58: | ||
+ | * TTCGAATTCGCGGCCGCTTCTAGATGGCCACCACCGTACAA <br/> | ||
+ | P59: | ||
+ | * CCGCTACTAGTATTATTACCCTTCTTTTGTCATGCCCT <br/> | ||
Line 330: | Line 358: | ||
==<span style="color:grey;">Precipitator</span>== | ==<span style="color:grey;">Precipitator</span>== | ||
- | === | + | ===Ligation=== |
+ | |||
+ | '''Investigators: Sophie''' | ||
+ | |||
+ | Ligation of IPTG-promoter BBa_J04500, GFP-pbd and psb1c3-vector | ||
+ | |||
+ | ===Transformation=== | ||
- | '''Investigators: | + | '''Investigators: Sophie''' |
+ | Transformation of ligation product | ||
{{:Team:Freiburg/Templates/footer}} | {{:Team:Freiburg/Templates/footer}} |
Latest revision as of 01:11, 22 September 2011