Team:Freiburg/Notebook/23 August

From 2011.igem.org

(Difference between revisions)
(blue light receptor)
 
(6 intermediate revisions not shown)
Line 1: Line 1:
{{:Team:Freiburg/Templates/header}}
{{:Team:Freiburg/Templates/header}}
 +
<html>
 +
<div id="notebook-page-header">
 +
<div id="notebook-back" width="100px" >
 +
<a href="https://2011.igem.org/Team:Freiburg/Notebook/22_August">Previous entry</a>
 +
</div>
 +
<div id="notebook-title">
 +
<a href="https://2011.igem.org/Team:Freiburg/Notebook"> 23 August </a>
 +
</div>
 +
<div id="notebook-next">
 +
<a href="https://2011.igem.org/Team:Freiburg/Notebook/24_August">Next entry</a>
 +
</div>
 +
</div>
 +
</html>
 +
 +
==<span style="color:green;">green light receptor</span>==
==<span style="color:green;">green light receptor</span>==
Line 33: Line 48:
For a 50 µl reaction use
For a 50 µl reaction use
 +
 +
P77: <br/>
 +
* CACAGGAAACCtcactaATGAGgATcCTTTTAGTGGAGGATGATTTGCc <br/>
 +
P78: <br/>
 +
* gGCAAATCATCCTCCACTAAAAGgATcCTCATtagtgaGGTTTCCTGTG <br/>
Line 146: Line 166:
|}
|}
 +
<br/>
 +
 +
===continuing with quickchanged CcaS and CcaR===
 +
 +
'''Investigator: Julia'''
<br/>
<br/>
 +
on the plates for CcaR were no colonies at all :(<br/>
 +
the quickchanged CcaS had about six colonies per plate. <br/> nine were picked for miniprep ( 3ml LB medium with Kanamycin).<br/>
==<span style="color:blue;">blue light receptor</span>==
==<span style="color:blue;">blue light receptor</span>==
Line 159: Line 186:
'''Investigators: Sophie:'''
'''Investigators: Sophie:'''
-
LOV-pcr, NOT-pcr and the Amp vector where ligated at 16°C
+
LOV-pcr, NOT-pcr and the Amp vector where ligated for 1h at room temperature
-
 
+
-
===Ligation===
+
-
 
+
-
'''Investigators: Sophie''' I ligated the purified inserts to the vector in the ratio 5:2 and 10:5 because of the loss of DNA due to the gelextraction
+
===Transformation===
===Transformation===
Line 203: Line 226:
For a 50 µl reaction use
For a 50 µl reaction use
 +
 +
P58:
 +
* TTCGAATTCGCGGCCGCTTCTAGATGGCCACCACCGTACAA <br/>
 +
P59:
 +
* CCGCTACTAGTATTATTACCCTTCTTTTGTCATGCCCT <br/>
Line 330: Line 358:
==<span style="color:grey;">Precipitator</span>==
==<span style="color:grey;">Precipitator</span>==
-
===NAME OF YOUR EXPERIMENT===
+
===Ligation===
 +
 
 +
'''Investigators: Sophie'''
 +
 
 +
Ligation of IPTG-promoter BBa_J04500, GFP-pbd and psb1c3-vector
 +
 
 +
===Transformation===
-
'''Investigators: NAME'''
+
'''Investigators: Sophie'''
 +
Transformation of ligation product
{{:Team:Freiburg/Templates/footer}}
{{:Team:Freiburg/Templates/footer}}

Latest revision as of 01:11, 22 September 2011


This is the wiki page
of the Freiburger student
team competing for iGEM 2011.
Thank you for your interest!