Team:Freiburg/Notebook/15 August
From 2011.igem.org
(Difference between revisions)
Juliimapril (Talk | contribs) (→NAME OF YOUR EXPERIMENT) |
|||
(24 intermediate revisions not shown) | |||
Line 1: | Line 1: | ||
{{:Team:Freiburg/Templates/header}} | {{:Team:Freiburg/Templates/header}} | ||
+ | <html> | ||
+ | <div id="notebook-page-header"> | ||
+ | <div id="notebook-back" width="100px" > | ||
+ | <a href="https://2011.igem.org/Team:Freiburg/Notebook/14_August">Previous entry</a> | ||
+ | </div> | ||
+ | <div id="notebook-title"> | ||
+ | <a href="https://2011.igem.org/Team:Freiburg/Notebook"> 15 August </a> | ||
+ | </div> | ||
+ | <div id="notebook-next"> | ||
+ | <a href="https://2011.igem.org/Team:Freiburg/Notebook/16_August">Next entry</a> | ||
+ | </div> | ||
+ | </div> | ||
+ | </html> | ||
- | |||
- | === | + | ==<span style="color:green;">green light receptor</span>== |
- | + | ===Order primers=== | |
+ | '''Investigators: Jakob''' | ||
+ | *Order new primers for the quickchange of CcaS and CcaR | ||
+ | *I got the sequence from the iGEM-Team Uppsala THX again! | ||
==<span style="color:blue;">blue light receptor</span>== | ==<span style="color:blue;">blue light receptor</span>== | ||
- | === | + | ===Transformation=== |
- | '''Investigators: | + | '''Investigators: Sophie''' |
+ | Transformation of ligated parts: | ||
+ | *LovTAP | ||
+ | *Not-Gate | ||
+ | *T3 vector | ||
+ | stored in incubator at 37°C. | ||
+ | <br/> | ||
+ | <br/> | ||
==<span style="color:red;">red light receptor</span>== | ==<span style="color:red;">red light receptor</span>== | ||
Line 73: | Line 95: | ||
cph8 Suffix: CCGCTACTAGTATTATTACCCTTCTTTTGTCATGCCCT<br/> | cph8 Suffix: CCGCTACTAGTATTATTACCCTTCTTTTGTCATGCCCT<br/> | ||
<br/> | <br/> | ||
+ | PCR program: <br/> Temp. Time,Nr of cycles <br/> | ||
+ | 98° 5' 1x <br/> | ||
+ | 98° 30'' 10x <br/> | ||
+ | 65° 30'' <br/> | ||
+ | 72° 1'15'' <br/> | ||
+ | 98° 30'' 20x <br/> | ||
+ | 72° 1'15'' <br/> | ||
+ | 72° 7' 1x <br/> | ||
+ | 4° ∞ <br/> | ||
+ | <br/> | ||
+ | |||
+ | Template: Voights plasmid (10x dilution)<br/> | ||
+ | Amplicon: 2235 bp<br/> | ||
+ | |||
+ | Elongation time Phusion 67,05 sec | ||
==<span style="color:orange;">Lysis cassette</span>== | ==<span style="color:orange;">Lysis cassette</span>== | ||
- | === | + | ===2A Assembly of the Lysis Cassette (S4+S15)=== |
- | '''Investigators: | + | '''Investigators:Theo''' |
+ | Since 3A assemly doesn't want to help us, we are going to try a 2A Assembly of S4 with S15.<br> | ||
+ | S4 is cut with SpeI and PstI.<br> | ||
+ | S15 is cut with XbaI and PstI, and is to be run on a gel, cut, isolated, ligated with S4 and finally transformed in competent cells.<br> | ||
+ | |||
+ | After the gel with S15 was run, I noticed there was no band to be seen and our instructor told me it was because I had not used a lot of DNA (500ng). | ||
+ | <br> | ||
+ | |||
+ | I am going to repeat this tomorrow. | ||
==<span style="color:grey;">Precipitator</span>== | ==<span style="color:grey;">Precipitator</span>== | ||
- | === | + | ===Ligation=== |
+ | |||
+ | '''Investigators: Sophie'''<br/> | ||
+ | continue from experiment: Cloning (12.8.11)<br/> | ||
+ | Project name: inducible promoter for pbd<br/> | ||
+ | Vector: psb1T3<br/> | ||
+ | Inserts: IPTG-Promoter,Pbd-GFP<br/> | ||
+ | samples stored in Ruediger's box<br/> | ||
+ | |||
+ | ===Transformation=== | ||
+ | |||
+ | '''Investigators: Sophie'''<br/> | ||
+ | continue from experiment: Ligation<br/> | ||
+ | Project name: inducible promoter for pbd<br/> | ||
+ | samples stored in incubator | ||
+ | |||
+ | ===PCR=== | ||
+ | |||
+ | '''Investigators: Rüdiger''' | ||
+ | |||
+ | PCR of precipitator. | ||
+ | |||
+ | Primer: | ||
+ | *p44 | ||
+ | *p45 | ||
+ | *p46 | ||
+ | *p48 | ||
+ | *51 | ||
+ | *52 | ||
+ | *53 | ||
+ | |||
+ | Primer: | ||
+ | *p54 | ||
+ | *p47 | ||
+ | |||
+ | {| cellpadding="10" cellspacing="0" border="1" | ||
+ | |name | ||
+ | |primer | ||
+ | |primer | ||
+ | |- | ||
+ | |44 | ||
+ | |p44 | ||
+ | |p54 | ||
+ | |- | ||
+ | |45 | ||
+ | |p45 | ||
+ | |p54 | ||
+ | |- | ||
+ | |46 | ||
+ | |p46 | ||
+ | |p54 | ||
+ | |- | ||
+ | |48 | ||
+ | |p48 | ||
+ | |p47 | ||
+ | |- | ||
+ | |51 | ||
+ | |p51 | ||
+ | |p54 | ||
+ | |- | ||
+ | |52 | ||
+ | |p52 | ||
+ | |p54 | ||
+ | |- | ||
+ | |53 | ||
+ | |p53 | ||
+ | |p54 | ||
+ | |} | ||
+ | |||
+ | |||
+ | [[File:Freiburg_2011_Testdigest1.jpg|500px]] | ||
+ | |||
+ | [[File:Freiburg_2011_tesdigest2.jpg|500px]] | ||
+ | |||
+ | [[File:Freiburg_2011_testdigest3.jpg|500px]] | ||
- | |||
{{:Team:Freiburg/Templates/footer}} | {{:Team:Freiburg/Templates/footer}} |
Latest revision as of 01:08, 22 September 2011