Reporter: Week 7 June 26-July 1

From 2011.igem.org

(Difference between revisions)
 
(18 intermediate revisions not shown)
Line 6: Line 6:
==Monday, June 27==
==Monday, June 27==
 +
===Insert tev Protease into K3 Vector, Take 8 Day 1===
 +
     The colonies that grew overnight all contained RFP, meaning that the insertion of tev protease into K3 from 6/26 did not work. As a result, we performed the insertion again. We started with the tev protease (K316017) plasmid from the 6/8 miniprep and the K3 vector miniprep.
 +
 +
{|border="1"
 +
!Protocol
 +
|colspan="2" align="center" |'''Part Involved in Protocol'''
 +
|-
 +
|Insert PCR
 +
|colspan="2"|K316017
 +
|-
 +
|rowspan="2"|Restriction Digest
 +
|Insert using XbaI and PstI:
 +
|K316017
 +
|-
 +
|Vector using XbaI and PstI:
 +
|K3
 +
|-
 +
|Ligation
 +
|colspan="2"|K316017+K3
 +
|-
 +
|Transformation/Plating
 +
|colspan="2"|The ligation above was transformed into<br />Escherichia coli cells then plated on a<br />kanamycin resistant plate.
 +
|}
 +
 +
===Cloning of XylE and GFP, Day 1===
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The purified PCR products of the mutated XylE and GFP were digested with XbaI and AgeI. The Imperial Linker + K3 served as the vector and was digested with XbaI and AgeI. The two digests were ligated together, transformed into Escherichia coli cells and plated onto kanamycin resistant plates.
 +
 +
===Catechol Assay to Test K316009, Day 1===
 +
Two 5 ml M9 cultures of K316009 stock were grown up at 37&deg;C with shaking.
 +
 +
==Tuesday, June 28==
 +
===Insert tev Protease into K3 Vector, Take 8 Day 2===
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Only one colony was white on the kanamycin resistant plate, meaning that this colony did not contain RFP. This white colony was amplified through colony PCR. The PCR product was run on an agarose gel, which yielded a band less than 500 base pairs long. The tev Protease should be just under 1000 base pairs, so the cloning attempt did not work. One idea was that the problem existed with the insert PCR products (poor purification or loss of product). The PCR product was run on the gel, and the corresponding (bright) band was just under 1000 base pairs, indication that the PCR products are correct and in ample amount, so the problem lies elsewhere.
 +
 +
===Cloning of XylE and GFP, Day 2: Verification===
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Three colonies of both the XylE + K3 and GFP + K3 and two colonies of RecAI + K3 were amplified through colony PCR. The PCR products were run on an agarose gel, which showed that the constructs contained the correct number of base pairs. The XylE colony B, GFP colony B and RecAI colony A were grown in culture overnight so their plasmids could be extracted for sequencing tomorrow.
 +
 +
===Catechol Assay to Test K316009, Day 2===
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;One of the cultures grown in M9 overnight was induced with 1 &mu;l IPTG (of unknown concentration. Th eother culture was left uninduced. After a one hour incubation at 37&deg;C, 50&mu;l of 10mM catechol was added to each culture. The absorbance (at 380 nm) was recorded over ten minutes. The results were as follows.
 +
{|border="2"
 +
!colspan="16"|Uninduced
 +
|-
 +
|'''Time(min:sec):'''
 +
|0:15
 +
|0:30
 +
|0:45
 +
|1:00
 +
|1:15
 +
|1:30
 +
|2:00
 +
|3:00
 +
|4:00
 +
|5:00
 +
|6:00
 +
|7:00
 +
|8:00
 +
|9:00
 +
|10:00
 +
|-align="center"
 +
|'''Absorbance:'''
 +
|0.544
 +
|1.01
 +
|1.21
 +
|X
 +
|X
 +
|2.84
 +
|1.47
 +
|1.53
 +
|1.67
 +
|1.82
 +
|1.97
 +
|2.186
 +
|2.34
 +
|2.38
 +
|2.615
 +
|}
 +
 +
 +
{|border="2"
 +
!colspan="14"|Induced
 +
|-align="center"
 +
|'''Time(min:sec):'''
 +
|0:15
 +
|0:30
 +
|1:00
 +
|1:30
 +
|2:00
 +
|3:00
 +
|4:00
 +
|5:00
 +
|6:00
 +
|7:00
 +
|8:00
 +
|9:00
 +
|10:00
 +
|-
 +
|'''Absorbance:'''
 +
|0.53
 +
|0.73
 +
|0.949
 +
|1.191
 +
|1.321
 +
|1.460
 +
|1.826
 +
|1.954
 +
|2.197
 +
|2.215
 +
|2.481
 +
|2.636
 +
|2.736
 +
|}
 +
 +
''Conclusions:'' There appears to be no difference between the induced and uninduced cultures. More investigation is necessary.
 +
 +
 +
==Wednesday, June 29==
 +
===Insert tev Protease into K3 Vector, Take 9 Day 1===
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In addition to inserting the tev Protease (K316017) part into the K3 vector through the amplified insert assembly method, which digests the vector with antarctic phosphotase, a second assembly method was used that separates the digested vecot through agarose gel electrohporesis. In the amplified insert assembly method, the vector and the tev protease insert were digested with XbaI and PstI in buffer 3. The digests were ligated together, transformed into Escherichia coli cells and plated onto a kanamycin resistant plate.
 +
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In the second method, both the K3 vector and tev Protease insert were digested with XbaI and PstI, but the vector digest was separated on a gel. The vector was extracted from the gel, then ligated with the insert. The ligation was transformed into Escherichia coli cells, which were then plated onto a kanamycin resistant plate.
 +
 +
===Assembly of Fusion Parts, Day 1===
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The reporter group plans to make fusion reporters. Each fusion will feature one of the reporter genes (XylE, LacZ or GusA), one of the linkers (Imp, small and 10AA), and one of the cleavage sites(cI or tev). Each fusion will be made in the forward and reverse direction to see the effects of attatching the GFP at the N-terminus vs. the C-terminus. Each fusion reporter will have the same constitutive promoter (J23100) and RBS (B0034).
 +
 +
====Assemble Promoter and RBS, Day 1====
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Today, the promoter (J23100) and the RBS (B0034) were assembled together. The purified RBS PCR product was digested with XbaI and PstI as the insert. The J23100 plasmid was digested with SpeI and PstI as the vector. After incubation, the digests were ligated together, transformed into Escherichia coli cells and plated onto an ampicillin resistant plate.
 +
 +
====Assemble GFP and Cleavage Sites, Day 1====
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;GFP was assembled to the two cleavage sites. The GFP was digested with EcoRI and AgeI as the vector. The insert cleavage sites were both digested with EcoRI and NgoMIV. After incubation, the digests were ligated together, transformed into Escherichia coli cells and plated onto kanamycin resistant plates.
 +
 +
==Thursday, June 30==
 +
===Insert tev Protease into K3 Vector, Take 9 Day 2===
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The gel showed a band less than 500 base pairs (just like the last gel on 6/28). After this set back, the reporter group decided to go back to the first tev protease cloning attempt. This plasmid had one base pair different from the desired result. The reporter group plans to perform site mutagenesis according to the Richard Lab protocol to change this base pair. This should result in the tev protease (K316017) part inside the K3 vector. The primer used was:
 +
 +
'''Forward (79.36&deg;C)'''
 +
 +
<blockquote>5’  CCAAAAGATGCCATCAG<span style="color:red">A</span>GCTAGGGAATGTACAGCTAG  3’</blockquote>
 +
 +
'''Reverse (79.93&deg;C)'''
 +
 +
<blockquote>5’  ACATTCCCTAGC<span style="color:red">T</span>CTGATGGCATCTTTTGGAAGCATTG  3’</blockquote>
 +
The red font indicates the nucleotide that will replace the one in the current plasmid, which is G.
 +
 +
===Cloning of XylE and GFP, Day 3===
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The RecAI plasmid was extracted from a new culture of RecAI and of XylE+K3 to send into sequencing with a reverse primer.
 +
 +
===Assembly of Fusion Parts, Day 2===
 +
====Assemble Promoter and RBS, Day 2: Verification====
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The J23100+B0034 colony was amplified through colony PCR, and the product was run on a gel (too long). The gel showed that the part that was constructed 6/29 was not the correct size. Thus, this assembly should be repeated.
 +
 +
====Assemble GFP and Cleavage Sites, Day 2: Verification====
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;A colony of each construct (GFP+tev cleavage and GFP+cI cleavage) was amplified using colony PCR. The PCR products was run on a gel. The gel showed that the two constructs were not the correct size, so the assembly must be repeated.
 +
 +
====Assemble XylE and LacZ&alpha; with the Three Linkers, Day 1====
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The XylE and LacZ&alpha; genes served as the vector for the Imp, small and 10AA linker inserts.
 +
 +
{|border="1"
 +
!Protocol
 +
|colspan="2" align="center"|'''Part Involved in Protocol'''
 +
|-
 +
|Insert PCR
 +
|colspan="2"|Imp linker<br />Small linker<br />10AA linker
 +
|-
 +
|rowspan="2"|Restriction Digest
 +
|Inserts using EcoRI and NgoMIV:
 +
|Imp linker<br />small linker<br />10AA linker
 +
|-
 +
|Vectors using EcoRI and AgeI:
 +
|XylE<br />LacZ&alpha;
 +
|-
 +
|Ligation
 +
|colspan="2" align="center"|XylE+Imp linker<br />XylE+small linker<br />XylE+10AA linker<br />LacZ&alpha;+Imp linker<br />LacZ&alpha;+small linker<br />LacZ&alpha;+10AA linker
 +
|-
 +
|Transformation/Ligation
 +
|colspan="2"|The above ligations were transformed into<br />Escherichia coli cells and plated onto<br />kanamycin resistant plates.
 +
|}
 +
 +
==Friday, July 1==
 +
===Assembly of Fusion Parts, Day 3===
 +
====Assemble Promoter and RBS, Take 2 Day 1====
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The RBS insert (B0034) was digested with XbaI and PstI. The promoter vector (J23100) was digested with SpeI and PstI. The digests were ligated together, transformed into Escherichia coli cells and plated onto kanamycin resistant plates.
 +
 +
====Assemble XylE and LacZ&alpha; with the Three Linkers, Day 2: Verification====
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The XylE+small linker and XylE+Imp linker did not yield colonies, so these assemblies will have to be repeated. The gel showed that the GFP + both cleavage sites did not work (band < 500 base pairs). The three assemblies featuring LacZ&alpha; as well as the XylE+10AA linker assembly seemed to work according to the gel, so these colonies were grown up in culture overnight.
 +
 +
==Saturday, July 2==
 +
===Assembly of Fusion Parts, Day 4===
 +
====Assemble Promoter and RBS, Take 2 Day 2: Verification====
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Nothing grew on the kanamycin resistant plate because J23100 is ampicillin resistant. Thus, the recovery media containing the cells that contain the J23100+B0034 plasmid was plated on an ampicillin resistant plate and left to grow overnight.
 +
 +
====Assemble GFP and Cleavage Sites, Take 2 Day 1====
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The GFP+K3 plasmid was digested with EcoRI and AgeI in buffer 1. The purified PCR products of the two cleavage sites were digested with EcoRI and NgoMIV in buffer 4. The digests were ligated together, transformed into Escherichia coli cells, then plated on kanamycin resistant plates.
 +
 +
====Assemble XylE with Small and Imp Linkers, Take 2 Day 1====
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The linker inserts were digested with EcoRI and NgoMIV in buffer 4. The XylE vector was digested with EcoRI and AgeI in buffer 1. The two digests were ligated together, transformed into Escherichia coli cells and plated onto kanamycin resistant plates.
 +
 +
[[Team:Penn_State/Notebook| Back to Notebook]]

Latest revision as of 17:33, 5 July 2011

Contents

Sunday, June 26

Insert tev Protease into K3 Vector, Take 7 Day 1

     The plates containing the assembly from 6/25 grew colonies that only contained RFP, none of which contained the tev protease. Thus, this assembly must be done again.

     The purified tev protease PCR product from 6/4 and the K3 miniprep from 6/25 were digested with XbaI and PstI in buffer 3. The digests were ligated together, then the ligation was transformed into competent Escherichia coli cells and plated onto kanamycin resistant plates.

Monday, June 27

Insert tev Protease into K3 Vector, Take 8 Day 1

     The colonies that grew overnight all contained RFP, meaning that the insertion of tev protease into K3 from 6/26 did not work. As a result, we performed the insertion again. We started with the tev protease (K316017) plasmid from the 6/8 miniprep and the K3 vector miniprep.

Protocol Part Involved in Protocol
Insert PCR K316017
Restriction Digest Insert using XbaI and PstI: K316017
Vector using XbaI and PstI: K3
Ligation K316017+K3
Transformation/Plating The ligation above was transformed into
Escherichia coli cells then plated on a
kanamycin resistant plate.

Cloning of XylE and GFP, Day 1

     The purified PCR products of the mutated XylE and GFP were digested with XbaI and AgeI. The Imperial Linker + K3 served as the vector and was digested with XbaI and AgeI. The two digests were ligated together, transformed into Escherichia coli cells and plated onto kanamycin resistant plates.

Catechol Assay to Test K316009, Day 1

Two 5 ml M9 cultures of K316009 stock were grown up at 37°C with shaking.

Tuesday, June 28

Insert tev Protease into K3 Vector, Take 8 Day 2

     Only one colony was white on the kanamycin resistant plate, meaning that this colony did not contain RFP. This white colony was amplified through colony PCR. The PCR product was run on an agarose gel, which yielded a band less than 500 base pairs long. The tev Protease should be just under 1000 base pairs, so the cloning attempt did not work. One idea was that the problem existed with the insert PCR products (poor purification or loss of product). The PCR product was run on the gel, and the corresponding (bright) band was just under 1000 base pairs, indication that the PCR products are correct and in ample amount, so the problem lies elsewhere.

Cloning of XylE and GFP, Day 2: Verification

     Three colonies of both the XylE + K3 and GFP + K3 and two colonies of RecAI + K3 were amplified through colony PCR. The PCR products were run on an agarose gel, which showed that the constructs contained the correct number of base pairs. The XylE colony B, GFP colony B and RecAI colony A were grown in culture overnight so their plasmids could be extracted for sequencing tomorrow.

Catechol Assay to Test K316009, Day 2

     One of the cultures grown in M9 overnight was induced with 1 μl IPTG (of unknown concentration. Th eother culture was left uninduced. After a one hour incubation at 37°C, 50μl of 10mM catechol was added to each culture. The absorbance (at 380 nm) was recorded over ten minutes. The results were as follows.

Uninduced
Time(min:sec): 0:15 0:30 0:45 1:00 1:15 1:30 2:00 3:00 4:00 5:00 6:00 7:00 8:00 9:00 10:00
Absorbance: 0.544 1.01 1.21 X X 2.84 1.47 1.53 1.67 1.82 1.97 2.186 2.34 2.38 2.615


Induced
Time(min:sec): 0:15 0:30 1:00 1:30 2:00 3:00 4:00 5:00 6:00 7:00 8:00 9:00 10:00
Absorbance: 0.53 0.73 0.949 1.191 1.321 1.460 1.826 1.954 2.197 2.215 2.481 2.636 2.736

Conclusions: There appears to be no difference between the induced and uninduced cultures. More investigation is necessary.


Wednesday, June 29

Insert tev Protease into K3 Vector, Take 9 Day 1

     In addition to inserting the tev Protease (K316017) part into the K3 vector through the amplified insert assembly method, which digests the vector with antarctic phosphotase, a second assembly method was used that separates the digested vecot through agarose gel electrohporesis. In the amplified insert assembly method, the vector and the tev protease insert were digested with XbaI and PstI in buffer 3. The digests were ligated together, transformed into Escherichia coli cells and plated onto a kanamycin resistant plate.

     In the second method, both the K3 vector and tev Protease insert were digested with XbaI and PstI, but the vector digest was separated on a gel. The vector was extracted from the gel, then ligated with the insert. The ligation was transformed into Escherichia coli cells, which were then plated onto a kanamycin resistant plate.

Assembly of Fusion Parts, Day 1

     The reporter group plans to make fusion reporters. Each fusion will feature one of the reporter genes (XylE, LacZ or GusA), one of the linkers (Imp, small and 10AA), and one of the cleavage sites(cI or tev). Each fusion will be made in the forward and reverse direction to see the effects of attatching the GFP at the N-terminus vs. the C-terminus. Each fusion reporter will have the same constitutive promoter (J23100) and RBS (B0034).

Assemble Promoter and RBS, Day 1

     Today, the promoter (J23100) and the RBS (B0034) were assembled together. The purified RBS PCR product was digested with XbaI and PstI as the insert. The J23100 plasmid was digested with SpeI and PstI as the vector. After incubation, the digests were ligated together, transformed into Escherichia coli cells and plated onto an ampicillin resistant plate.

Assemble GFP and Cleavage Sites, Day 1

     GFP was assembled to the two cleavage sites. The GFP was digested with EcoRI and AgeI as the vector. The insert cleavage sites were both digested with EcoRI and NgoMIV. After incubation, the digests were ligated together, transformed into Escherichia coli cells and plated onto kanamycin resistant plates.

Thursday, June 30

Insert tev Protease into K3 Vector, Take 9 Day 2

     The gel showed a band less than 500 base pairs (just like the last gel on 6/28). After this set back, the reporter group decided to go back to the first tev protease cloning attempt. This plasmid had one base pair different from the desired result. The reporter group plans to perform site mutagenesis according to the Richard Lab protocol to change this base pair. This should result in the tev protease (K316017) part inside the K3 vector. The primer used was:

Forward (79.36°C)

5’ CCAAAAGATGCCATCAGAGCTAGGGAATGTACAGCTAG 3’

Reverse (79.93°C)

5’ ACATTCCCTAGCTCTGATGGCATCTTTTGGAAGCATTG 3’

The red font indicates the nucleotide that will replace the one in the current plasmid, which is G.

Cloning of XylE and GFP, Day 3

     The RecAI plasmid was extracted from a new culture of RecAI and of XylE+K3 to send into sequencing with a reverse primer.

Assembly of Fusion Parts, Day 2

Assemble Promoter and RBS, Day 2: Verification

     The J23100+B0034 colony was amplified through colony PCR, and the product was run on a gel (too long). The gel showed that the part that was constructed 6/29 was not the correct size. Thus, this assembly should be repeated.

Assemble GFP and Cleavage Sites, Day 2: Verification

     A colony of each construct (GFP+tev cleavage and GFP+cI cleavage) was amplified using colony PCR. The PCR products was run on a gel. The gel showed that the two constructs were not the correct size, so the assembly must be repeated.

Assemble XylE and LacZα with the Three Linkers, Day 1

     The XylE and LacZα genes served as the vector for the Imp, small and 10AA linker inserts.

Protocol Part Involved in Protocol
Insert PCR Imp linker
Small linker
10AA linker
Restriction Digest Inserts using EcoRI and NgoMIV: Imp linker
small linker
10AA linker
Vectors using EcoRI and AgeI: XylE
LacZα
Ligation XylE+Imp linker
XylE+small linker
XylE+10AA linker
LacZα+Imp linker
LacZα+small linker
LacZα+10AA linker
Transformation/Ligation The above ligations were transformed into
Escherichia coli cells and plated onto
kanamycin resistant plates.

Friday, July 1

Assembly of Fusion Parts, Day 3

Assemble Promoter and RBS, Take 2 Day 1

     The RBS insert (B0034) was digested with XbaI and PstI. The promoter vector (J23100) was digested with SpeI and PstI. The digests were ligated together, transformed into Escherichia coli cells and plated onto kanamycin resistant plates.

Assemble XylE and LacZα with the Three Linkers, Day 2: Verification

     The XylE+small linker and XylE+Imp linker did not yield colonies, so these assemblies will have to be repeated. The gel showed that the GFP + both cleavage sites did not work (band < 500 base pairs). The three assemblies featuring LacZα as well as the XylE+10AA linker assembly seemed to work according to the gel, so these colonies were grown up in culture overnight.

Saturday, July 2

Assembly of Fusion Parts, Day 4

Assemble Promoter and RBS, Take 2 Day 2: Verification

     Nothing grew on the kanamycin resistant plate because J23100 is ampicillin resistant. Thus, the recovery media containing the cells that contain the J23100+B0034 plasmid was plated on an ampicillin resistant plate and left to grow overnight.

Assemble GFP and Cleavage Sites, Take 2 Day 1

     The GFP+K3 plasmid was digested with EcoRI and AgeI in buffer 1. The purified PCR products of the two cleavage sites were digested with EcoRI and NgoMIV in buffer 4. The digests were ligated together, transformed into Escherichia coli cells, then plated on kanamycin resistant plates.

Assemble XylE with Small and Imp Linkers, Take 2 Day 1

     The linker inserts were digested with EcoRI and NgoMIV in buffer 4. The XylE vector was digested with EcoRI and AgeI in buffer 1. The two digests were ligated together, transformed into Escherichia coli cells and plated onto kanamycin resistant plates.

Back to Notebook

Retrieved from "http://2011.igem.org/Reporter:_Week_7_June_26-July_1"