PARTS OVERVIEW

<groupparts>iGEM011 UNITS_Trieste</groupparts>

Name	Seq 5' --> 3'	Notes
TraI rev	GTTTCTTCCTGCAGCGGCCGCTACTAGTATCACGCCGCACTCCTCAACG	95° 5' | 10x (93° 30" | 56° 30" | 72° 40") | 23x ( (93° 30" | 65° 30" | 72° 40") | 72° 7' | 4° ∞
TraI fw	GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCTGATTCTGACCGTCTCGCC	95° 5' | 10x (93° 30" | 56° 30" | 72° 40") | 23x ( (93° 30" | 65° 30" | 72° 40") | 72° 7' | 4° ∞
TraR rev	GTTTCTTCCTGCAGCGGCCGCTACTAGTATCAGATGAGTTTCCGCCGGATG	95° 5' | 10x (93° 30" | 56° 30" | 72° 40") | 23x ( (93° 30" | 65° 30" | 72° 40") | 72° 7' | 4° ∞
TraR fw	GTTTCTTCGAATTCGCGGCCGCTTCTAGATCGACGACTGGCTGGACAAGC	95° 5' | 10x (93° 30" | 56° 30" | 72° 40") | 23x ( (93° 30" | 65° 30" | 72° 40") | 72° 7' | 4° ∞
PromTraFw	GTTTCTCGAATTCGCGGCCGCTTCTAGAGAAGTGCAGATTTGCACATGAAATCAACG	95° 5' | 10x (93° 30" | 56° 30" | 72° 40") | 23x ( (93° 30" | 65° 30" | 72° 40") | 72° 7' | 4° ∞
PromTra rev	GTTTCTTCCTGCAGCGGCCGCTACTAGTATAGCGGAGAGAAAACATCTCATTCAGG	95° 5' | 10x (93° 30" | 56° 30" | 72° 40") | 23x ( (93° 30" | 65° 30" | 72° 40") | 72° 7' | 4° ∞
Vf2	TGCCACCTGACGTCTAAGAA	95° 5' | 30x ( 93° 30" | 50° 30" | 72° 30-120") | 72° 7' | 4° ∞
Vr	ATTACCGCCTTTGAGTGAGC	95° 5' | 30x ( 93° 30" | 50° 30" | 72° 30-120") | 72° 7' | 4° ∞
RB Fv	CCGCTCTAGAGAAAGAGGAGAAA	95° 5' | 30x ( 93° 30" | 50° 30" | 72° 30-120") | 72° 7' | 4° ∞

Overview on Synbiome's results

At the beginning of the summer we aimed at having the whole consortium ready before the regional jamboree and probably we undertook too hard a challenge.
We believed that engaging a tough challenge would definitely be a good way to prompt us to do our best, and so it was.
Synbiome was not perfectly tuned for the regional jamboree in Amsterdam but the original idea and the extensive validation of the submitted biobricks have earned our team the access to the final jamboree in Boston.
Considerable work has been done during this month after the regional jamboree and at the end, looking at our BioBricks and results, you will appreciate the validation (PDF BoBricks DataSheet) of all the BioBricks that we submitted and that will guarantee the proper function of the 3-cell consortium.
In particular we would like to focus your attention on:

BBa_K553001
BBa_K553003
BBa_K553006
BBa_K553008
BBa_K553009
BBa_K553010
BBa_K553020
BBa_K553021
BBa_K553022
BBa_K553023

The part BBa_K553020 presents the coding sequence for a mammalian secreted beta-lactamase (sBLA). We've used it associated to BBa_K553021 and BBa_K553022 that represent the core element of the DNA sequence recognized by P65-TraR (BBa_K553023) and a minimal CMV promoter, respectively. In a mammalian system these three elements plus a BBa_K553023 the mammalian TraR-based trans-activator represent an OXOC8-inducible expression system for the production of sBLA.
Inside the bacterial strain B the part BBa_K553008 guarantees the production of OXOC8 under the stimulation of OXOC12, while BBa_K553006 produces the C. firmi-derived beta-glucosidase upon OXOC12 stimulation.

BBa_K553008 and BBa_K553023 are the core elements of the communication between the two kingdoms. The first one produces signal molecules (AHL OXO-C8) and the second one produces P65-TraR a fusion protein, composed by a portion of the p65 a NLS signal and the whole TraR. This guarantees an appropriate response to OXOC8 in the eukaryotic system.

BBa_K553010 guarantees the constitutive production of OXOC12 in order to make the system self sustainable avoiding the need of a starting induction.
All these parts have been qualitatively tested and will guarantee the communication and the inter-independence between the two kingdoms. If bacteria and eukaryotes will communicate using OXOC8, they will cooperate for the survival of the whole consortium: eukaryotes will produce beta-lactamase, vital for bacterial survival in an ampicillin-added medium, while bacteria will produce the glucosidase needed for the conversion of cellobiose (the sole - but unusable - carbon source) into glucose available for eukaryotes and bacterial consumption and consequent growth.