Team:Tokyo-NoKoGen/metallothionein

Metallothioneins (metal-binding proteins) and metal transporters

1. Background

Heavy metals such as Cd(II) and As(III) used in industry and urban are deposited into the land and ocean. They are taken into our body through drinking water, fish and crops, which are causing serious problem against human health. To get rid of them from contaminated soil and water is a serious issue we need to solve and think about.

Today, proteins called metallothionein that can bind to metal ions are reported. By using such property of metallothionein, we have decided to make a metal ion cleaning device. Our metal cleaning system will work like this – we will make an E.coli that can produce metallothionein inside the cell. It will also synthesize transporters to take in metal ions from its surrounding, to make the metal cleaning faster and more effective. The absorbed metal ions will bind specifically to the metallothionein, which will then be collected inside the BMC (bacterial microcompartment).

What are metallothioneines?

We will focus on two metallothioneins, each paired up with transporters. Team Groningen in iGEM2009 has introduced fMT (an arsenic binding metallothionein) and Glpf (arsenic transporter). We will further use and characterize their parts in our metal cleaning E.coli to collect arsenite. A new metallothionein that we will introduce this year in iGEM, will be SmtA (Cadmium binding metallothionein) and MntH (Cadmium transporter).

SmtA is found in Synechococcus sp. PCC7942 and has been reported that the cyanobacterial strain expressing SmtA reaches a higher OD550 in a cadmium containing medium.

The E.coli K-12 derived MntH (yfep) are transporters that are highly homologous to the Nramp protein family (metal ion transporters), and are known to be able to transport a variety of metal ions including Cd2+ [2]. A study has shown that MntH facilitates transport of Mn2+ in a time-, temperature-, proton-dependent manner.

To make metallothionein be taken into the BMC, we will fuse SmtA and fMT with PduP1-18 - a protein that is recognized and is taken into pdu BMC (propanediol-utilizing BMC).

We will integrate SmtA, MntH, fMT and Glpf into our metal ion collecting E.coli to collect cadmium and arsenic ions.

2. Method

Our aim is to construct a vector with transporter under a constitutive promoter, and the metallothionein under a metal-sensitive promoter as shown on the diagram.

2-1. Cloning SmtA from Synechococcus sp. PCC7942

SmtA sequence shown in red, Restriction sites shown in pink

Primers to clone and add restriction sites EcoRI, XbaI and SpeI.

Fw primer: AGAATTCGCGGCCGCATCTAGATGACCTCAACAACGTTGGTC

Rv primer: GCTACTAGTATTAGCCGTGGCAGTTACAG

2-2. Cloning MntH

MntH sequence shown in green, Restriction sites shown in pink

Primers to clone and add restriction sites EcoRI, XbaI and SpeI.

Fw primer: AGAATTCGCGGCCGCATCTAGAGAATTTTTTTGC

Rv primer: GCTACTAGTAGGAGCACAAT

The cloned products were cut at EcoRI and SpeI and ligated to PSB1C3 vector which was also cut at EcoRI and SpeI.

2-3. Construct PduP1-18 fused to SmtA and fMT

We originally had PduP1-18 fused with GFP, so we carried out inverse PCR to amplify the part without GFP. We then cut the product at EcoRI and SpeI to add them to the vector containing metallothionein which were cut at EcoRI and XbaI.

2-4. Characterize the effect of expressing SmtA and GlpF in E.coli cultured in Cd(II) containing medium.

LB medium with different cadmium concentrations (0, 100, 120, 150, 180, 210, 240, 270, 300, 400 µM) was prepared in a microtiter plate as shown in the diagram below, and observed the change in OD595 and compared the differences between WT E.coli, E.coli expressing PduP1~18-SmtA, and E.coli expressing PduP1~18-fMT.

We will prepare a LB medium with different cadmium concentrations in a microtiter plate as shown in the diagram below, and see the change in OD660 and compare the differences between WT E.coli, E.coli expressing metallothionein, and E.coli expressing transporter.

3. Result

As Cd(II) concentration goes up, growth of E. coli starts to slow down. At 270 µM , 300 µM and 400 µM Cd(II) concentration, there is no difference in the OD595 between E. coli WT and mutant expressing PduP1~18-fMT or PduP1~18-SmtA (Fig.7). However, at 240 µM Cd(II) medium, E. coli expressing PduP1~18-fMT showed a rise in its OD595 at around 6 hours. The difference becomes more significant as the Cd(II) concentration decreases, until it reaches a concentration of 120 µM where the growth between metallothionein expressing E. coli and the wild type becomes very similar. Unfortunately we could not see SmtA to function as a metallothionein, as it showed a similar growth curve to the wild type E. coli. However, looking at the graphs showing growth curves at Cd(II) concentrations 150 µM, 180 mM and 210 mM, cells expressing fMT shows a significant growth when compared to the growth of wild type. This result suggests that fMT bound to Cd(II) taken up by the cell, and allowed them to resist Cd(II) better than the cells without metallothionein. Our PduP1~18 fused fMT showed to maintain its function inside the E. coli.

The graphs in Fig.10 and Fig. 11 show growth of E. coli that makes SmtA in different concentrations of Cd(II). In the previous experiment, we could not observe the tolerance of E. coli expressing PduP1-18-SmtA in Cd(II) containing LB medium, but when we expressed only the SmtA inside the E. coli, we could see that it could tolerate the Cd(II) without the PduP1-18. This could suggest that PduP1-18 fused to SmtA changed the conformation of SmtA protein, and prevented it from binding with Cd(II).

Due to the fact that not much difference could be observed in the OD595 at 300 mM Cd(II) containing medium, we tried changing the promoters for expressing SmtA and PduP1-18-fMT.

Previously , both SmtA and PduP1-18-fMT were expressed under a relatively low constitutive promoter (BBa_J23117). This time, we changed this promoter to a high constitutive promoter (BBa_J23100) and observed the growth in 300 µM Cd(II) medium, where growth of E. coli could not be observed before. However, E. coli with a high constitutive promoter could tolerate the Cd(II) containing medium better than the E. coli with low constitutive promoter (Fig.12, Fig.13). This suggests that the tolerance could be due to the amount of metallothionein being expressed, with a high constitutive promoter, E. coli could produce more metallothioneins and therefore could resist Cd(II) better.

4. Summary

Absorb heavy metal ions from the environment, capture them inside the cell and store them inside the BMC, which will then be collected by collecting the E. coli, is our metal ion collecting system using E. coli. The key features in our system is the use of BMC for storage and metallothioneins for capturing. Metallothioneins, proteins that can bind to metal ions – we have decided to use SmtA and fMT which are known to bind to Cd(II). Having observed the difference in the growth curve of wild type E. coli, E. coli expressing SmtA, and E. coli expressing PduP1-18 fused fMT in different LB medium of different Cd(II) concentrations, we could see the difference that E. coli expressing PduP1-18 fused fMT could resist higher Cd(II) concentration than the wild type. Concluding from this result, fMT could bind to Cd(II) inside the cell, because it helped E. coli resist Cd(II). This result is supported by our experiment of changing the promoter from Pconst(Low) to Pconst(High), where E. coli expressing metallothioein under Pconst(High) could resist Cd(II) concentration better. From the result that E. coli expressing more metallothionein could survive Cd(II), it could be deduced that metallothionein is binds with the metal ion inside the cell preventing E. coli from cytotoxicity.

Matching our purpose of using metallothionein in E. coli for metal collection, we have successfully observed that fMT could still maintain its function even when fused to the PuP1~18 tag protein. The PduP1~18 fused metallothionein that captures metal ions will then become encapsulated inside the BMC and be collected.

We have successfully managed to observe that expressing metallothionein inside the E. coli can help them tolerate Cd(II) containing medium, and that the protein are functioning by binding with Cd(II) inside the bacterial cell and preventing cytotoxicity.

5. Reference

[1] Sode et al. (1998) Construction of a marine cyanobacterial strain with increased heavy metal ion tolerance by introducing exogenic metallothionein gene. J Mar Biotechnol

[2] Makui et al. (2000) Identification of Escherichia coli K-12 Nramp orthologue (MntH) as a selective divalent metal ion transporter. Molecular Microbiology