green light receptor
second quickchange of CcaS
Investigators:Julia
| Name: Julia
| Date: 22.08.11
|
|
|
| Project Name: second quickchange of CcaS
|
PCR-Mixture for one Reaction:
For a 50 µl reaction use
| 32,5µl
| H20
|
|
| 10µl
| 5x Phusion Buffer
|
|
| 2.5µl
| Primer fw
| CGGATCATCAATGGGCTCC (P64)
|
| 2.5µl
| Primer dw
| GGTCCGCGCATTCTCTATGTCAATGAAGCAT (P65)
|
| 1µl
| dNTPs
|
|
| 1µl
| DNA-Template
| qS50 and qS51 (5ng/ µl)
|
| 0.5 µl
| Phusion (add in the end)
|
|
What program do you use?
| Temperature
| time (min)
| No. of cycles
|
|
| 95
| 5:00
| 1
|
|
| 95
| 0:15
|
|
|
| 60
| 0:15
| 20
|
|
| 72
| 1:15
|
|
|
| 72
| 5:00
| 1
|
|
| 4
| 60:00:00
| 1
|
|
|
|
|
|
|
|
|
|
|
|
After PCR: Digestion with DpnI in order to get of the old plasmids :
5 µl NEB buffer 4
5 µl BSA (10x)
2 µl DpnI
38 µl of PCR Product
Incubation for 1,5h, deactivation at 80°C for 20 min.
Transformation with 10 µl of the digested PCR product. Cells were plated out on Kanamycin plates( at 23:00 o’clock ).
blue light receptor
Sequencing
Investigators: Sandra
The sequencing showed that the 3A-assembly did not work.
We will send the LovTap PCR product to get sequenced. May be the PCR did not work.
PCR
Investigators: Sandra
PCR of Not-Gate.
P 74:
P 24:
PCR product was loaded onto a gel. Expected lane: 900bp
PCR worked and we got Not-Gate with NEHI and PstI.
Cloning
Investigators: Sophie
new 3A assembly with Sandra's NOT-gate-PCR-product, our LOV-Tap-pcr-product (both mutated with NEH1 restriction sites) and an amp-vector
The digested samples were loaded to a gel. They showed clear bands in the right size. Only the band of the vector was not intense enough, so the vector has to be digested again.
red light receptor
NAME OF YOUR EXPERIMENT
Investigators:NAME
Lysis cassette
NAME OF YOUR EXPERIMENT
Investigators:NAME
Precipitator
Transformation
| Name:Rüdiger
| Date:22.08
|
| Continue from Date 19.08. Name Rüdiger
Experiment Ligation
|
| Project Name: Precipitator
|
Procedure
- take cells from -80°C freezer and put them on ice! (every eppi contains about 400 μl cells)
- thaw cells on ice 20 minutes
- pipette 50 μl cells and 2 μl DNA into eppi still on ice!
- Incubate for 30 minutes on ice
- Heat at 42°C for 60 sec
- Incubate on ice for 5 minutes
- Add 200 μl LB Broth
- Incubate for 2 hours at 37°C (cells with lysis cassette at 30°C!!)
- Plate 50 μl and 200μl on two different LB/Agar plates with appropriate antibiotic resistance
Documentation:
Why are you doing this experiment? Name of the sample? Where are they stored? Name the vector with inserts, antibiotika resistance etc.
| pSB1C3
61a,b
62a.,b
64a,b
repetition from 20.08.
Miniprep: Julia 24.05.
|
Transformation
Investigators: Rüdiger, Sandra
Transformation of:
61 a,b
62 a,b
63 a,b.
Vector:pSB1C3
Incubation over night.
Cloning for GFP-pbd with IPTG-inucible promoter
Investigator: Sophie
as cloning from 18.08.11 did not work I try it again with longer digestion times.
PCR
| Name:Rüdiger
| Date: 22.08
|
| Continue from Experiment (Date)-
(Name)
|
| Project Name: Precipitator
|
PCR-Mixture for one Reaction:
For a 50 µl reaction use
| 32,5µl
| H20
| Name
|
| 10µl
| 5x Phusion Buffer
| of Primer
|
| 2.5µl
| Primer fw
|
|
| 2.5µl
| Primer dw
|
|
| 1µl
| dNTPs
| of Template DNA
|
| 1µl
| DNA-Template
|
|
| 0.5 µl
| Phusion (add in the end)
|
|
What program do you use?
Anneal Gradient from 61-72°c, 15sec.
To confirm the PCR-Product has the correct size, load 2 µl of the sample onto an agarose-gel.
How did you label the PCR-Product, where is it stored and what do you do next?
| Name
| Template
| Primer
| Temperature
|
| 1
| Precipitator 2
| p44+p73
| 85/69>72
|
| 2
| Precipitator 4_2
| p45+p71
| 89/68>72
|
| 3
| Precipitator 4
| p46+p72
| 72
|
| 4
| pgEX-6-p-1a 1:10
| p67+p69
| 58>61
|
| 5
| pgEX-6-p-1a 1:10
| p67+p70
| 58>61
|
| 6
| pgEX-6-p-1a 1:10
| p68+p69
| 62>65
|
| 7
| pgEX-6-p-1a 1:10
| p69+p70
| 58>61
|
| C
| Lambda DNA
| Primers
| 1,4kb
|
Investiagators: Rüdiger
"
Contact 
