"
Team:Freiburg/Notebook/15 August
From 2011.igem.org
(→green light receptor) |
|||
| (One intermediate revision not shown) | |||
| Line 1: | Line 1: | ||
{{:Team:Freiburg/Templates/header}} | {{:Team:Freiburg/Templates/header}} | ||
| + | <html> | ||
| + | <div id="notebook-page-header"> | ||
| + | <div id="notebook-back" width="100px" > | ||
| + | <a href="https://2011.igem.org/Team:Freiburg/Notebook/14_August">Previous entry</a> | ||
| + | </div> | ||
| + | <div id="notebook-title"> | ||
| + | <a href="https://2011.igem.org/Team:Freiburg/Notebook"> 15 August </a> | ||
| + | </div> | ||
| + | <div id="notebook-next"> | ||
| + | <a href="https://2011.igem.org/Team:Freiburg/Notebook/16_August">Next entry</a> | ||
| + | </div> | ||
| + | </div> | ||
| + | </html> | ||
| + | |||
==<span style="color:green;">green light receptor</span>== | ==<span style="color:green;">green light receptor</span>== | ||
| Line 99: | Line 113: | ||
==<span style="color:orange;">Lysis cassette</span>== | ==<span style="color:orange;">Lysis cassette</span>== | ||
| - | === | + | ===2A Assembly of the Lysis Cassette (S4+S15)=== |
| + | |||
| + | '''Investigators:Theo''' | ||
| + | |||
| - | ' | + | Since 3A assemly doesn't want to help us, we are going to try a 2A Assembly of S4 with S15.<br> |
| + | S4 is cut with SpeI and PstI.<br> | ||
| + | S15 is cut with XbaI and PstI, and is to be run on a gel, cut, isolated, ligated with S4 and finally transformed in competent cells.<br> | ||
| + | After the gel with S15 was run, I noticed there was no band to be seen and our instructor told me it was because I had not used a lot of DNA (500ng). | ||
| + | <br> | ||
| + | I am going to repeat this tomorrow. | ||
==<span style="color:grey;">Precipitator</span>== | ==<span style="color:grey;">Precipitator</span>== | ||
Latest revision as of 01:08, 22 September 2011
Contact 
Contents |
green light receptor
Order primers
Investigators: Jakob
- Order new primers for the quickchange of CcaS and CcaR
- I got the sequence from the iGEM-Team Uppsala THX again!
blue light receptor
Transformation
Investigators: Sophie
Transformation of ligated parts:
- LovTAP
- Not-Gate
- T3 vector
stored in incubator at 37°C.
red light receptor
PCR for Cph8
Investigators:Julia
after protocol from Uppsala.
PCR-Mixture for one Reaction:
For a 50 µl reaction use
| 32,5µl | H20 | |
| 10µl | 5x Phusion Buffer | |
| 2.5µl | Primer fw | |
| 2.5µl | Primer dw | |
| 1µl | dNTPs | |
| 1µl | DNA-Template | |
| 0.5 µl | Phusion (add in the end) |
Primer used:
cph8 Prefix: TTCGAATTCGCGGCCGCTTCTAGATGGCCACCACCGTACAA
cph8 Suffix: CCGCTACTAGTATTATTACCCTTCTTTTGTCATGCCCT
PCR program:
Temp. Time,Nr of cycles
98° 5' 1x
98° 30 10x
65° 30
72° 1'15
98° 30 20x
72° 1'15
72° 7' 1x
4° ∞
Template: Voights plasmid (10x dilution)
Amplicon: 2235 bp
Elongation time Phusion 67,05 sec
Lysis cassette
2A Assembly of the Lysis Cassette (S4+S15)
Investigators:Theo
Since 3A assemly doesn't want to help us, we are going to try a 2A Assembly of S4 with S15.
S4 is cut with SpeI and PstI.
S15 is cut with XbaI and PstI, and is to be run on a gel, cut, isolated, ligated with S4 and finally transformed in competent cells.
After the gel with S15 was run, I noticed there was no band to be seen and our instructor told me it was because I had not used a lot of DNA (500ng).
I am going to repeat this tomorrow.
Precipitator
Ligation
Investigators: Sophie
continue from experiment: Cloning (12.8.11)
Project name: inducible promoter for pbd
Vector: psb1T3
Inserts: IPTG-Promoter,Pbd-GFP
samples stored in Ruediger's box
Transformation
Investigators: Sophie
continue from experiment: Ligation
Project name: inducible promoter for pbd
samples stored in incubator
PCR
Investigators: Rüdiger
PCR of precipitator.
Primer:
- p44
- p45
- p46
- p48
- 51
- 52
- 53
Primer:
- p54
- p47
| name | primer | primer |
| 44 | p44 | p54 |
| 45 | p45 | p54 |
| 46 | p46 | p54 |
| 48 | p48 | p47 |
| 51 | p51 | p54 |
| 52 | p52 | p54 |
| 53 | p53 | p54 |
