Team:Potsdam Bioware/Labjournal/June

From 2011.igem.org

(Difference between revisions)

Latest revision as of 01:31, 22 September 2011

1 10th Labday 2011-06-01
- 1.1 Primer design for Phage Display
2 11th Labday 2011-06-07
- 2.1 Design of PCR conditions for amplifying the complete mdn cluster
- 2.2 Design of PCR conditions for amplifying mdnA
3 12th Labday 2011-06-08
4 13th Labday 2011-06-09
- 4.1 Agarose gel electrophoresis of mdn cluster
5 14th Labday 2011-06-10
- 5.1 Amplification of mdnA for phage display
6 15th Labday 2011-06-14
- 6.1 cultivation of cells containing pAK100 from E. coli glycerol stocks
7 16th Labday 2011-06-15
- 7.1 gel electroporesis PCR product(mdnA, 2011-06-10), plasmid preperation und digestion with SfiI of pAK100 bla KDIR
8 17th Labday 2011-06-16
9 18th Labday 2011-06-17
- 9.1 competent cells - E. coli XL1 blue & RV308
- 9.2 primer design for phage display
10 19th Labday 2011-06-20
- 10.1 Preparation of LB-Agarplates
- 10.2 Design of Primers for myc-tagging mdnA
11 20st Labday 2011-06-21
12 21th Labday 2011-06-22
13 22th Labday 2011-06-23
14 23th Labday 2011-06-24
15 24th Labday 2011-06-27
- 15.1 Control experiment fpr error prone PCR and enzyme digestion of mdnA
- 15.2 Midiprep of pJC354_WZA2 (TorA-bla vector) carrying cells
16 25th Labday 2011-06-28
17 26th Labday 2011-06-29
18 27th Labday 2011-06-30

10th Labday 2011-06-01

Primer design for Phage Display

Investigators: Jessica, Sabine, Sandrina, Nadja

Aim: Design primers for PCR of mdnA (from pARW089) to clone into pAK100 with SfiI restriction sites

Time: 2011-06-01,15:30-21:00

Materials:

Geneious Pro 5.1.7

Oligo Calc: Oligonucleotide Properties Calculator (http://www.basic.northwestern.edu/biotools/oligocalc.html)

Method:

Primer design

melting temperature based on 4+2 method (for mdnA-overlapping part)

adding sequences for restriction sites (considering reading frame)

Check self-complementarity and melting temperature using Oligo Calc

Results:

Primer sequences

pf_sfi_mdna_1 TCTAGATGGCGGCCCAGCCGGCCATGGCGATGGCATATCCCAAC

pr_sfi_mdna_1 CCCTTCTGACTGGGAAGATTATGGCCTCGGGGGCCACTAATACTAGTAGCGGCCGCTGCAGGCT

Further tasks:

do PCR of mdnA

11th Labday 2011-06-07

Design of PCR conditions for amplifying the complete mdn cluster

Investigators: Jessica, Nicole, Nadja

Aim: PCR amplification of the mdn cluster

Time: 2011-06-07,18:00-19:30

Materials:

Sequence of vector pARW071, concentration 857.3 ng/ µl

Manual: Fermentas Long PCR Enzyme Mix

Forward primer: sf_bb_4_1

Reverse primer: r_bb_1

Geneious Pro 5.1.7

Method:

Design of a temperature profile based on the manual

Definition of a mastermix based on the manual

Results:

1. Temperature profil

Temperature in °C	Time in s
94		Hold

94	180	Initial denaturation
94	15	Denaturation
46	30	Annealing
68	300	Elongation
--> 10 cycles
94	15	Denaturation
46	30	Annealing
68	300 + 2 per each cycle	Elongation
--> 20 cycles
68	600	Final extension

2. Mastermix

Component	Volume in µl	Final concentration
Buffer Fermentas Long Enzyme Mix (+MgCl2)	5
dNTPs	1	0.2 mM
Primer (each)	3	0.6 µM
DNA (diluted 1:100)	4.08 µl	0.7 ng
Polymerase	0.3 µl	1.5 U
H2O	33.62 µl	(up to 50 µl)

Further tasks:

PCR of the complete mdn cluster

verification using agarose gel electrophoresis

Design of PCR conditions for amplifying mdnA

Investigators: Jessica, Nicole, Nadja

Aim: PCR amplification of mdnA

Time: 2011-06-07,18:00-19:30

Materials:

Sequence of vector pARW089, concentration 626.7 ng/ µl

Manual: NEB OneTaq DNA Polymerase

Forward primer: sf_mdna_1

Reverse primer: r_mdna_1

Geneious Pro 5.1.7

Method:

Design of a temperature profile based on the manual

Definition of a mastermix based on the manual

Results:

1. Temperature profil

Temperature in °C	Time in s
94		Hold

94	30	Initial denaturation
94	15	Denaturation
45	35	Annealing
68	20	Elongation
--> 30 cycles

68	300	Final extension
6		Hold

2. Mastermix

Component	Volume in µl	Final concentration
Buffer NEB OneTaq	10
dNTPs	1	0.2 mM
Primer (each, diluted 1:10)	1	0.2 µM
DNA (diluted 1:100)	5.58	0.7 ng
Polymerase	0.25
H2O	31.17	(up to 50 µl)

Further tasks:

PCR of mdnA

verification using agarose gel electrophoresis

12th Labday 2011-06-08

PCR of the complete mdn cluster

Investigators: Jessica, Nicole

Aim: Testing the possibility of a PCR of the whole mdn cluster and the chosen conditions

Time: 2011-06-08, 9:30-14:00

Materials:

DNA polymerases: Long PCR Enzyme Mix (Fermentas)

Template DNA: pARW071 (vector)

Forward primer: sf_bb_4_1

Reverse Primer: r_bb_1

--> mastermix composition, see 11th labday 'Design of PCR conditions for amplifying the complete mdn cluster'

Eppendorf Mastercycler gradient

used temperature profil

Temperature in °C	Time in s
94		Hold
94	120	Initial denaturation

94	20	Denaturation
56	20	Annealing
68	300	Elongation
--> 10 cycles

94	20	Denaturation
56	20	Annealing
68	300 + 2 per each cycle	Elongation
--> 20 cycles

68	600	Final elongation
6		Hold

Method:

pipetting the mastermix on ice

preheating of the thermocycler: starting the program IGMDN1 (Eppendorf Mastercycler gradient)

finally adding polymerase

start the PCR program (press enter)

Results:

PCR product

Further tasks:

Verification of the PCR product using agarose gel electrophoresis

PCR of mdnA

Investigators: Jessica, Nicole

Aim: Testing the possibility of amplifying mdnA using PCR and the chosen conditions

Time: 2011-06-08,9:30-14:00

Materials:

DNA polymerases: NEB OneTaq DNA Polymerase

Template DNA: pARW089 (vector)

Forward primer: sf_mdna_1

Reverse Primer: r_mdna_1

--> mastermix composition, see 11th labday 'Design of PCR conditions for amplifying mdnA'

Eppendorf Mastercycler personal
used temperature profil

Temperature in °C	Time in s
94		Hold
94	60	Initial denaturation

94	20	Denaturation
56	20	Annealing
68	20	Elongation
--> 30 cycles

68	300	Final elongation
6		Hold

Method:

pipetting the mastermix on ice

preheating of the thermocycler: starting the program IGMDNA1 (Eppendorf Mastercycler personal)

finally adding polymerase

start the PCR program (press enter)

Results:

PCR product

Further tasks:

Verification of the PCR product using agarose gel electrophoresis

Production of agarose gel

Investigators: Jessica, Nicole

Aim: Verification of PCR product, mdnA and whole mdn cluster, by agarose gel electrophoresis

Time: 2011-06-08,9:30-14:00

Materials:

Agarose, type VII, low gelling temperature (Sigma)

1x TAE Buffer (produced by AG Biotechnology)

GelRed

Method:

1. mdn cluster (approx. 6712 bp) --> 0.8 %

0.75 g agarose in 50 ml 1xTAE buffer

dissolving/ boiling up using microwave

after cooling, adding of 2 µl GelRed

2. mdnA (approx. 276 bp) --> 1.5 %

0.4 g agarose in 50 ml 1xTAE buffer

dissolving/ boiling up using microwave

after cooling, adding of 2 µl Gelred

Results

1.5 % agarose gel

0.8 % agarose gel

Further tasks:

Loading gel and performing electrophoresis

Agarose gel electrophoresis of mdnA

Investigators: Jessica, Nicole, Nadja

Aim: Verification of PCR product, mdnA, by agarose gel electrophoresis

Time: 2011-06-08,15:45-18:00

Materials:

1.5 % agarose gel, produced previously

PCR product of mdnA amplification

DNA Ladder Gene Ruler, 100bp plus, DNA Ladder (Fermentas)

6x Loading Dye (Fermentas)

Method:

1. Loading samples

dilution of PCR product: 1 µl DNA and 4 µl water

Adding 1 µl 6x loading dye to diluted PCR product

Positions of samples/ marker

lane	Sample	Sample/[µl]	Expected size (bp)	approx. size
1	marker	2
2	PCR product mdnA	6	276	280
4	PCR product mdnA (dilution)	6	276	280
5	marker (dilution 1:5)	2

2. Run

100 V

time: 1 h

Results:

approx. size: see methods

Design of PCR conditions for amplifying mdnA for Phage display

Investigators: Sandrina, Sabine

Aim: PCR reaction of mdnA with overlapping primers containing SfiI restriction sites for cloning into PAK100, which is needed for phage display

Time: 2011-06-8,12:00-14:00

Materials:

Sequence of vector pARW089

Manual: OneTaq Polymerase (NEB)

Forward primer: pf_mdnA_sfi_1

Reverse primer: pr_mdnA_sfi_1

Geneious

Method:

Design of a temperature profile based on the manual

Results:

1. Temperature profil

Temperature in °C	Time in s
94		Hold

94	60	Initial denaturation
94	20	Denaturation
60	20	Annealing
72	20	Elongation
--> 15 cycles
94	60	Denaturation
70	40	Annealing
72	20	Elongation
--> 15 cycles
70	300	Final extension

Further tasks:
PCR

13th Labday 2011-06-09

Agarose gel electrophoresis of mdn cluster

Investigators: Jessica, Steffi, Nicole

Aim: Verification of amplification of the complete mdn cluster by PCR

Time: 2011-06-09,10:00-17:30

Materials:

0.8 % agarose gel, produced previously

PCR product of mdn amplification

DNA Ladder Gene Ruler, 100bp plus, DNA Ladder (Fermentas)

6x Loading Dye (Fermentas)

Method:

1. Loading samples

dilution of PCR product:

Adding 1 µl 6x loading dye to diluted PCR product

Positions of samples/ marker

lane	Sample	Sample/[µl]	Expected size (bp)		approx. size
1	marker
2	PCR product mdn cluster
4	PCR product mdn cluster (dilution)
5	PCR product mdn cluster (dilution)

2. Run

100 V

time: 1 h

Results:

250px

approx. size: see methods

14th Labday 2011-06-10

Amplification of mdnA for phage display

Investigators: Sandrina, Sabine

Aim: amplificate mdnA of pARW089 with primers pf_mdnA_sfi_1 and pr_mdnA_sfi_1

Time: 2011-06-10,08:00-10:00, 14:00-20:00

Materials/Methods:

1. PCR (see 11th Labday 2011-06-08)

0,75 ng Vector pARW089

Thermo Hybraid Px2

0,25 µl OneTaq DNA Polymerase (NEB)

1 µl dNTPs

1 µl each forward and reverse primer

32,15 µl DNase free water

10 µl 5xOneTaq Standard Reaction Buffer

2. PCR product purification

QIAquick Gel Extraction Kit (250)

3. Digestion with SfiI

50 µl sample

NEB 10x buffer 4

100x BSA

3 µl restriction enzyme SfiI

PCR product (mdnA with SfiI restriction sites)

Further tasks:
gel electrophoresis and gel extraction

15th Labday 2011-06-14

cultivation of cells containing pAK100 from E. coli glycerol stocks

Investigators: Sandrina

Aim: cultivate cells conatining pAK100 (vector) to purify it and use it for phage display.

1.amplificated mdnA should be cloned into pAK100

2. genIII should be amplified from it to clone into pARW089

Time: 2011-06-14,13:45-14:45

Materials/Methods:

glycerol stock nr. 15, pAK100 bla KDIR, XL1-blu, 2003-07-31

LB-medium with chloramphenicol (1:1000)

Further tasks:
plasmid preperation und digestion with SfiI

16th Labday 2011-06-15

gel electroporesis PCR product(mdnA, 2011-06-10), plasmid preperation und digestion with SfiI of pAK100 bla KDIR

Investigators: Sandrina, Sabine, Jessica

Aim: purification of mdnA and pak100 to use it for phage display.

1.amplificated mdnA should be cloned into pAK100

2.genIII should be amplified from it to clone into pARW089

Time: 2011-06-15,12:00-18:00

Materials/Methods:

1. plasmid preparation

GeneJET Plasmid Miniprep Kit (Fermentas, K0509)

2. Digestion with SfiI

50 µl sample

NEB 10x buffer 4

100x BSA

3 µl restriction enzyme SfiI

PCR product (mdnA with SfiI restriction sites)

3. gel electrophoresis

sample preparation: 50 µl PCR product (digested) + 10 µl 6x loading dye solution

0,75 g Agarose, 50 ml TAE (1 x), 2 µl GELRED, at 100 Volt,running time: 45 minutes

marker: GeneRuler ladder 100 Bp plus ladder (Fermentas)

Results:

no results, PCR didn`t work

Further tasks:
repeat PCR, gel electrophoresis of digested pak100

17th Labday 2011-06-16

gel electrophoresis and gel extraction of digested pAK100 bla KDIR

Investigators: Sandrina, Sabine, Anna

Time: 2011-06-16,10:00-12:00

Aim: get a pAK100 plasmid digested with SfiI to clone mdnA into it (phage display, strategy 1)

Materials/Methods:

1.gel electrophoresis sample preparation: 50 µl plasmid product (digested) + 10 µl 6x loading dye solution 0,5 g Agarose, 50 ml TAE (1 x), 2 µl GELRED, at 100 Volt,running time: 45 minutes marker: 1 kb DNA ladder (NEB)

2. gel extraction

QIAquick Gel Extraction Kit (250)

Results:

digestion worked, plasmids were extracted from the gel and stored at -20 °C

Further tasks:

ligation of digested pAK100 with amplified mdnA containing SfiI restriction sites

PCR of mdnA for phage display repeated with modified conditions

Investigators: Sandrina, Sabine, Anna

Time: 2011-06-16,10:00-12:00

Aim: amplification of mdnA with SfiI restriction sites (vector pARW089)

Materials/Methods:

see 2011-06-10

changes:

annealing temperature 56°C (stage 1)

template 65 ng

gel electrophoresis of PCR product

Investigators: Sandrina, Anna, Sabine

Time: 2011-06-16,16:00-18:00

Material and Methods:

see 2011-06-15

Results:

no result

reason: reversed primer was ordered unreversed

Further tasks:

order a new primer

Over night culture of E. coli XL1-blue and RV308

Investigators: Sandrina, Anna, Sabine

Time: 2011-06-16,18:00-19:00

Aim: cultering cells to produce competent cells

Material and Methods:

XL1-blue: 15 ml LB medium with 100 µg/mL tetracycline out of tetracycline stock solution 50 mg/mL

RV308: 15 ml LB medium without streptomycin (not available)

Further tasks:
produce competent cells

18th Labday 2011-06-17

competent cells - E. coli XL1 blue & RV308

Investigator: Niels

Aim: produce competent cells

Time: 2011-06-15,09:00-16:30

Materials/Methods:

Work always sterile and cold and speedy!

All volumes deal with the common cellline!

Prepare 45 Eppis (1,5µl)

get liquid nitrogen

Use Milipore-filter for sterile CaCl2 , keep cool!

prepare 15ml LB-Medium (or DYT) with the specific antibiotic (XL1-blue Tet, BL21 none!), inoculate and incubate over night

prepare 100ml LB-Medium (or DYT) with the specific antibiotic, inoculate with 2ml of the over-night-culture. Nurture the culture until OD600 at 0,35 (0,2-0,5) (if the OD is too high, the cell won’t be competent)

keep cell suspension in sterile falcons (50ml) 20 min on ice, then centrifuge for 20min; 4°C; 2500g

discard supernatant, carefully resuspend on ice with 10ml cold CaCl2-solution (put a little of the 10ml solution in every falcon before!), pool every resuspended aliquot of one cell line and add 40ml CaCl2-solution (total volume 50ml). Keep 30 min on ice, then centrifuge for 20min; 4°C; 2500g

discard supernatant, carefully resuspend pellet in 5,5ml CaCl2(80mM)/Glycerol (4:1), use the pippete boy and a sterile glas pipette to dissolve the pellet

aliquot in Eppis á 150µl and store immediately at liquid nitrogen and afterwards at -80 °C

Results:

22 tubes RV308 for expression(150µl competent cells at -80°C)

22 tubes XL1 blue for transformation(150µl competent cells at -80°C)

Further tasks:
check by transformation

primer design for phage display

Investigators: Jessica, Sabine, Sandrina, Anna

Aim: Design primers for PCR of

genIII (from pak100)

mdnA (from pARW089)

to fuse genIII and mdnA in pARW089

Time: 2011-06-17,14:00-18:00

Materials:

Geneious Pro 5.1.7

Oligo Calc: Oligonucleotide Properties Calculator (http://www.basic.northwestern.edu/biotools/oligocalc.html)

Method:

Primer design

melting temperature based on 4+2 method (for mdnA-overlapping part)

adding sequences for restriction sites (considering reading frame)

Check self-complementarity and melting temperature using Oligo Calc

Results:

Primer sequences (strategy 2)

pf_iGEM_GenIII_NgoMIV TAAGCTGCCGGCGAGCAGAAGCTGATCTCTGAGGAAGACCTGGGTGGTGGCTCTGGTTCC (2nt-NgoMIV-myc-GenIII)

pr_GenIII_iGEM_AatII 5'->3' TGCTTAGACGTCTACTAGTATTAACCGGTAGACTCCTTATTACGCAGTA (GenIII-AgeI-SpeI-AatII-6nt)

pf_mdnA-iGEM_EheI TTCCATGGCGCCAGAGGAATCTAGATGGCATATCCCAACGATC (6nt-EheI-RBS-XbaI-mdnA)

pr_mdnA_iGEM_AAtII 5'->3' GACGTCCTGCAGCGGCCGCTACTAGTATTAACCGGTTATAATCTTCCCAGTCAGAAG (mdnA-AgeI-SpeI-NotI-PstI-AatII-nt)

new ordered primer for amplification of mdnA from pARW089 with SfiI restriction sites (strategy 1)

pr_sfi_mdna_1 5'->3' AGCCTGCAGCGGCCGCTACTAGTATTAGTGGCCCCCGAGGCCATAATCTTCCCAGTCAGAAGGG

Further tasks:

PCR

19th Labday 2011-06-20

Preparation of LB-Agarplates

Investigators: Nadine, Katharina, Steffi, Nicole, Jessica

Time: 2011-06-09,13:45-19:00

Aim: Preparation of LB-Agarplates

Recipe:

10 g/l Yeast-Tryptone

10 g/l NaCl

5 g/l Yeast-Extract

15 g Agar-Agar

fill up to 1000 ml with Millipore H2O and autoclave

Further tasks:
add antibiotics (Ampicillin, Kanamycin) to LB-Medium and prepare plates

Design of Primers for myc-tagging mdnA

Investigators: Nicole, Nadine, Katharina, Steffi

Aim: Design primers for mdnA (from pARW089) in order to tag it w/ myc (+ Factor XA Protease restriction site) to clone into vector from Sven (iGEM vector from 2010)

Time: 2011-06-01,16:00-19:00

Materials:

Geneious Pro 5.1.7

Oligo Calc: Oligonucleotide Properties Calculator (http://www.basic.northwestern.edu/biotools/oligocalc.html)

Method:

Primer design

- melting temperature based on 4+2 method (for mdnA-overlapping part)

- adding sequences for restriction sites (considering reading frame)

- Check self-complementarity and melting temperature using Oligo Calc

Myc-tag

- Media: UP_sequence_myc_withoutamber.png

- why?: purification by affinity chromatography (using antybodies against myc-tag)

Factor XA Protease

- why?: to be able to cleave myc tag after mdnA expression and purification

- restriction site: I E/D G R

- used sequence (forward): ATT GAA GGC CGT

Results:

Primer sequences

Further tasks:

do PCR of mdnA

20st Labday 2011-06-21

Error prone PCR (varied MnCl2 and MgCl2 concentration) of mdnA

Investigators: Nadine, Steffi, Nicole

Time: 2011-06-21,9:00-14:00

Aim: Random mutation of mdnA gene based on increased MnCl2 and MgCl2 concentration

Materials:

Marcus Schicklberger's (trainee, August 2005) protocol performing several error prone PCRs

Manual Supplement of Cadwell and Joyce 2009 [[Media:

Genaxxon Bioscience Taq S Polymerase, manufacturer's protocol Media: UP_Genaxxon_Taq_Polymerase_Protocol.pdf

Genaxxon Bioscience taq Polymerase

10x Genaxxon Bioscience taq Polymerase buffer containing 15 mM MgCl2

dNTPs (10 mM)

forward primer: sf_mdnA_1 (10 µM)

reverse primer: r_mdnA_1 (10 µM)

template DNA pARW089 (857,3 ng/ µl measured by nanotrop a second time)

Genaxxon Bioscience MgCl2 stock solution (50 mM)

Manganese(II) chloride (Merck)

MnCl2

sterile filter

Eppendorf Mastercycler personal, program IGMDNA1

Method:

Production of 50 mM Manganese(II) chloride stock solution

MMnCl2 = 161.81 g/ mol

50 mM in 1 ml needed --> mMnCl2 = 8.1 mg

sterile filtration: pore size of filter: 0.2 µm

Error prone PCR of mdnA

increasing MnCl2 concentration beginning with 0 mM in 0.05 mM steps, ending with 0.15 mM (--> sample 1-4)

increasing MgCl2 concentration beginning with 1.5 mM, in 5 mM steps, ending with 15 mM (--> sample 5-8)

1. Mix for error prone PCR with increasing MnCl2 concentration

Component	Stock concentration	Volume in µl	Final concentration
Genaxxon Bioscience Taq Polymerase buffer containing MgCl2)	15 mM (MgCl2)	5	1.5 mM MgCL2
MgCl2	50 mM	5.5	5.5 mM
dNTPs	10 mM	2.0	0.4 mM
Primer (each)	10 µM	2.5	0.5 µM
DNA (diluted 1:100)	8.57 ng/ µl	5.58	0.7 ng
Polymerase		1	5 U

in addition MnCl2 and H2O as shown following

Sample number	MnCl2 in µl	Final concentration MnCl2	H₂O in µl
1	0	0	25.52
2	0.5	0.05 mM	23.02
3	1.0	0.1 mM	22.52
4	1.5	0.15 mM	22.02

2. Mix for error prone PCR with increasing MgCl2 concentration

Component	Stock concentration	Volume in µl	Final concentration
Genaxxon Bioscience Taq Polymerase buffer containing MgCl2)	15 mM (MgCl2)	5	1.5 mM MgCL2
dNTPs	10 mM	2.0	0.4 mM
Primer (each)	10 µM	2.5	0.5 µM
DNA (diluted 1:100)	8.57 ng/ µl	8.0	5 ng
Polymerase		1	5 U

in addition MgCl2 and H2O as shown following

Sample number	MnCl2 in µl	Final concentration MnCl2	H₂O in µl
5	0	1.5 mM	29.0 µl
6	3.5	5 mM	17.5 µl
7	7.0	10 mM	14.0 µl
8	10.0	15 mM	10.5 µl

3. Complete pipet scheme

Component in µl	1	2	3	4	5	6	7	8
Template DNA	8	8	8	8	8	8	8	8
dNTPs	2	2	2	2	2	2	2	2
10x Genaxxon polymerase buffer (with MgCl2)	5	5	5	5	5	5	5	5
MgCl2 (50 mM)	5.5	5.5	5.5	5.5	0	3.5	7.0	10.5
MnCl2 (5 mM)	0	0.5	1	1.5	0	0	0	0
Forward primer (sf_mdnA_1)	2.5	2.5	2.5	2.5	2.5	2.5	2.5	2.5
Reverse primer (r_mdnA_1)	2.5	2.5	2.5	2.5	2.5	2.5	2.5	2.5
H2O	23.5	23.0	22.5	22.0	29.0	25.5	22.0	18.5

4. Temperature profile

see 12th labday

Eppendorf Mastercycler personal, program IGMDNA1

Results:

8 PCR products containing mutated mdnA

Further tasks:

Verification of these PCR products by agarose gel electrophoresis

Purification and cloning of positive samples

Sequencing

Agarose gel electrophoresis of mutated mdnA

Investigators: Nadine, Jessica, Steffi, Nicole

Time: 2011-06-21,14:00-17:00

Aim: Verification of random mutated mdnA (mutations are based on increased MnCl2 and MgCl2 concentration)

Materials:

Agarose broad range (Roth)

1x TAE buffer

Gel Red

8 PCR products of mutated mdnA, see

DNA Ladder Gene Ruler, 100bp plus, DNA Ladder (Fermentas)

6x Loading Dye (Fermentas)

Method:

1. Production of two 1 % agarose gel

For each gel:

mAgarose = 0.5 g in 50 ml 1x TAE

adding 2 µl gel red

2. Loading samples

30 µl PCR product and 6x loading dye

2 µl DNA ladder gene ruler

Positions of marker and sample

Gel 1

lane	Sample	Volume in µl	Expected size in bp
1	marker	2
2	mdnA 1	36	276
3	mdnA 2	36	276
4	mdnA 3	36	276
5	mdnA 4	36	276

Gel 2

lane	Sample	Volume in µl	Expected size in bp
1	marker	2
2	mdnA 5	36	276
3	mdnA 6	36	276
4	mdnA 7	36	276
5	mdnA 8	36	276

3. Run

100 V

time: 1 h

Results:

Gel Extraction DNA excision: lane 1-4, 5,7: ~ 276 bp band

stored at -20°C in orange box (iGEM 2011 UP DNA)

Further tasks:

DNA extraction

Cloning

Sequencing

Over night culture of E. coli BL21 containing BBa_K404304_pSB1C3 (biobrick iGEM Freiburg 2010) from Sven

Investigators: Jessica, Nadine, Stefan, Steffi

Aim: Culturing E. coli containing BBa_K404304_pSB1C3 biobrick for midi-prep and using for cloning afterwards

Time: 2011-06-21,16:50-17:00

Materials:

cells: E. coli BL21 containing BBa_K404304_pSB1C3 (biobrick iGEM Freiburg 2010) from Sven

50 ml LB media

50 µl Chloramphenicol (100 mg/ml)

Method:

add antibiotic to LB

inoculation of cells

37 °C, 250 rpm, 17 hours

Results:

Further tasks:

remove cells from shaker at 10:00 (Nici :D)

do midi-prep

Transformation of E. coli XL 1 blu and RV 308 + puK

Investigators: Niels

Aim: Check the quality of competent cells

Time: 2011-06-21,10:00-12:30

Materials:

cells: E. coli XL 1 blu and RV 308

50 ml LB media

50 µl ampicillin (100 mg/ml)

Method:

protocol: addition of 1 µl plasmid (puK) to cells in 1.5 ml Eppi,

incubation 30 min on ice,

heat shock 90 sec at 42°C,

addition of 750 µl LB medium,

incubation at 37 °C for 60 min in Eppendorf thermomixer at 450 rpm,

centrifugation at 2000xg; for 5 min,

decandation of supernatant,

resuspension of pellet in approx. 100 µl,

plating on LB medium with 1,5 % agar and LB medium with 1,5 % agar, 100 µg/ml ampicillin,

storage over night at 37°C

Results:

negative

Further tasks:

repeat

21th Labday 2011-06-22

Gel extraction of mutated mdnA

Investigators: Katharina, Nicole

Aim: Extraction of mdnA, which was amplified and mutated (using error prone PCR)

Time: 2011-06-22,12:15-13:30

Materials:

Qiagen QIAquick Gel extraction Kit

PCR products 1-5 and 7 containing mutated mdnA

Method:

performing gel extraction based on manufacturer's protocol, Media: UP_Qiagen_QIAquick_Gel_Extraction_kit.pdf

elute in 30 µl buffer EB

Results:

purified PCR products of mutated mdnA (1-5, 7)

Further tasks:

restriction enzyme digestion with purified mdnA and pARW089 using AatII/ NarI

Verification by agarose gel electrophoresis

Ligation

Midiprep of pSB1C3 carrying cells

Investigators: Nadine, Vanessa

Aim:

Midiprep of pSB1C3

vector for biobricks (RFC25)

Time: 2011-06-22, 14:00-16:00

Materials:

Qiagen Plasmid Plus Midi Kit

over night cultures: E. coli BL21 containing BBa_K404304_pSB1C3 (biobrick iGEM Freiburg 2010) from Sven

NanoDrop

Method:

Midiprep

using Qiagen Plasmid Plus Midi Kit Quick-Start Protocol, Media: UP_QIAGEN_Plasmid_Plus_Midi_Kit.pdf

Output: 4 x DNA Eppi Tubes: pSB1C3, 22.06.2011, storage: orange box (iGEM DNA, -20°C)

Results:

concentration:

- tube 1: 284.6 ng/µl, 260/280 = 1.90, 260/230 = 2.32

- tube 2: 252.6 ng/µl, 260/280 = 1.91, 260/230 = 2.34

- tube 3: 235.0 ng/µl, 260/280 = 1.89, 260/230 = 2.01

- tube 4: 238.4 ng/µl, 260/280 = 1.9, 260/230 = 2.32

Further tasks:

Restriction enzyme digestion and agarose gel electrophoresis of mutated mdnA

Investigators: Katharina, Nicole

Time: 2011-06-22,14:00-18:00

Aim: Restriction enzyme digestion of random mutated mdnA and pARW089 (vector) and verification using gel electrophoresis

Materials:

Restriction enzymes: AatII, NarI

NEB Buffer 4

PCR products of random mutated mdnA(1-5, 7), purified from gel

vector pARW089

Agarose broad range (Roth)

1x TAE buffer

Gel Red

DNA Ladder Gene Ruler, 100bp plus, DNA Ladder (Fermentas)

6x Loading Dye (Fermentas)

1kb DNA ladder (NEB)

Method:

1. Restriction enzyme digestion

components	volume of PCR products /µl	volume of pARW089 /µl
DNA	30	6
NEB Buffer 4(10x)	4	1
Enzyme AatII	1	1
Enzyme NarI	1	1
H₂O	4	1
Total volume	40	10

2. Production of two 1 % agarose gels

mAgarose = 1.0 g in 100 ml 1x TAE

adding 4 µl gel red

3. Loading samples

a. restriction enzyme digestion products of random mutated mdnA

30 µl PCR product and 6 µl 6x loading dye

b. restriction enzyme digestion product of vector pARW089

10 µl PCR product and 6x loading dye

2 µl DNA ladder gene ruler, 100bp plus (Fermentas)

2 µl 1 kb DNA ladder (NEB)

Positions of marker and sample

Gel 1

lane	Sample	Volume in µl
1	marker	2
2	mdnA 1	36
3	mdnA 2	36
4	mdnA 3	36
5	mdnA 4	36
6	mdnA 5	36

Gel 2

lane	Sample	Volume in µl
1	marker	2
2	mdnA 7	36
5	pARW089
6	marker, 1kb DNA ladder (NEB)	2

4. Run

100 V

time: 1 - 1.5 h

Results:

300px

stored in freezer

Further tasks:

DNA extraction

Cloning

Sequencing

Over night culture of E. coli containing pEX respectively pBAD from Tobias

Investigators: Jessica, Nadine, Nicole

Aim: Culturing E. coli containing PEX respectively pBAD for midi-prep

Time: 2011-06-22,16:50-17:00

Materials:

cells: E. coli containing pEX respectively pBAD from Tobias

50 ml LB media

50 µl Ampicillin (100? mg/ml)

Method:

add antibiotic to LB

inoculation of cells

37 °C, 250 rpm, 17 hours

Results:

Further tasks:

remove cells from shaker at 10:00

do midi-prep

22th Labday 2011-06-23

Midiprep of pEX respectively pBAD carrying cells

Investigators: Jessica

Aim:

Midiprep of pEX respectively pBAD

expression vectors

Time: 2011-06-23, 10:30-12:30

Materials:

Qiagen Plasmid Plus Midi Kit

over night cultures: E. coli containing pEX respectively pBAD

NanoDrop

Method:

Midiprep

using Qiagen Plasmid Plus Midi Kit Quick-Start Protocol, Media: UP_QIAGEN_Plasmid_Plus_Midi_Kit.pdf

Results:

concentration:

- pEX tube 1: 36.4 ng/µl

- pEX tube 2: 62.4 ng/µl

- pBAD tube 1: 71.6 ng/µl

- pBAD tube 2: 94.6 ng/µl

Output:

2 x DNA Eppi Tubes: pBAD, 23.06.2011, storage: orange box (iGEM DNA, -20°C)

- concentration may be okay as pBAD is a low-copy plasmid

pEX tubes thrown away because of low concentration

Further tasks:

redo culturing and midiprep for pEX

Over night culture of E. coli XL1-Blue and RV308 for competent cells

Investigators: Stefan

Aim: Culturing cells to produce competent cells

Time: 2011-06-23,15:30-16:00

Materials:

XL1-Blue: 15 ml LB medium with 100 µg/mL tetracycline out of tetracycline stock solution 50 mg/mL

RV308: 15 ml LB medium without streptomycin (not available)

Method:

add antibiotic to LB

inoculation of cells

30 °C, 250 rpm, 18 hours

37 °C, 250 rpm, 5 hours

inoculate 200 mL fresh culture with 2 mL from starter culture

Results:

Further tasks:

produce competent cells

Over night culture of E. coli containing vector pBAD resp. pEX for midiprep resp. glycerol stocks

Investigators: Nicole

Aim: Culturing cells to do midiprep and to produce glycerol stocks

Time: 2011-06-23,17:30-18:00

Materials:

E. coli containing expression vector pBAD: 5 ml LB medium with 5 µl ampicilin

E. coli containing expression vector pEX: 50 ml LB medium with 50 µl ampicilin

Method:

add antibiotic to LB

inoculation of cells

37 °C, over night

Results:

Over night culture of

E. coli containing expression vector pBAD

E. coli containing expression vector pEX

Further tasks:

Midiprep for E. coli containg vector pEX

glycerol stocks of E. coli containg vector pEX as well as fpr E. coli containg vector pBAD

Amplification of mdnA and GeneIII for phage display

Investigators: Sandrina, Sabine

Aim:

amplificate mdnA of pARW089 with primers pf_mdnA_sfi_1 and pr_mdnA_sfi_1 (phage display strategy 1)

amplificate mdnA of pARW089 with primers pf_mdnA_iGEM_EheI and pr_mdnA_iGEM_AatII (phage display strategy 2)

amplificate GeneIII of pak100 with primers pf_iGEM_GenIII_NgoMIV and pr_GenIII_iGEM_AatII (phage display strategy 2)

Time: 2011-06-23, 10:00-12:00, 15:00-17:00

Materials/Methods:

1. PCR

0,8 ng Vector pARW089

Thermo Hybraid Px2 (conditions see 2011-06-08, changes: extension time 40 s)

0,25 µl OneTaq DNA Polymerase (NEB)

1 µl dNTPs

1 µl per primer

31,75 µl DNase free water

10 µl 5xOneTaq Standard Reaction Buffer

2. gel electrophoresis (analytic)

5 µl PCR product, agarose gel: 1%)

DNA Ladder Gene Ruler, 100bp plus, DNA Ladder (Fermentas)

Positions of marker and sample

Gel

lane	Sample	Volume in µl	Expected size in bp
M	marker	2
1	mdnA with SfiI	7	224
2	mdnA iGEM	7	ca. 230
3	geneIII iGEM	7	ca. 520

Results:

File:UP PCR sfi mdna,mdna rfc25,genIII.png

PCR for strategy 1 (lane number 1) probably did not work because the annealing temperature of the forward primer is located at 42°C (not 60 °C)

Furter tasks:

purification of PCR products

order new forward primer for strategy 1 with higher annealing temperature

Design of primers and planing of further experiments

Investigators: Nadine, Nicole

Time: 2011-06-23, 15:00-18:00

Aim: Design of primers and detailed planing of further experiment

Materials:

1. Primer design

Geneious Pro 5.1.7

Oligo Calc: Oligonucleotide Properties Calculator (http://www.basic.northwestern.edu/biotools/oligocalc.html)

Method:

1. Primer Design

add an start codon (ATG) to the previously designed primer pf_mdnA_mycN_xbal

2. Detailed planing of further experiments

A. Control experiment of error prone PCR of mdnA and subsequent restriction enzyme digestion using NarI and AatII

Aim: Analysis of three lines after agarose gel electrophoresis after restriction enzyme digestion of mdnA using NarI and AatII; see

Idea: DNA is not completly single stranded; would be avoid by heating mixture after restriction enzyme digestion for 10-20 min at 65°C

B. Random mutagenesis of mdnA and determination of mutation rate

Idea: using an increased MnCl2 concentration to mutate mdnA and finally sequencing of mdnA to determine the mutation rate

C. mdnA as iGEM expression part in vector pEX or pBAD

D. mdnA as biobrick

Idea: Cloning of mdnA in iGEM cloning vector to submit as biobrick

E. Repetition of Elke's experiments as control for further experiments

Idea: Further, purify mdnA with the use of antibodies (anti myc-tag) and without HPLC. To compare which strategy is more efficient (myc-tag or HPLC) HPLC experiment as control is necessary.

F. mdnA with myc-tag (N- and C-terminal) in iGEM expression vector pEX or pBAD

Idea: myc-tagging of mdnA to purify it with antibodies (without use of HPLC)

G. Expression and purification of mdnA (with myc-tag)

Idea: Determine the efficiency of myc-tag/ antibody to purify mdnA.

To do	Experimental tasks
A.	Control experiment for error prone PCR (increased MnCl2 concentration) of mdnA (vector pARW089)
	Preparative agarose gel electrophoresis
	DNA extraction and purification of (positive) samples
	Restriction enzyme digestion of mdnA using NarI and AatII; Splitting the samples fifty-fifty, heat one half of each sample 10-20 min at 65°C
	Analytic agarose gel electrophoresis of each sample (heated and non-heated)

B.	Random mutagenesis of mdnA and determination of mutation rate
	Error prone PCR of mdnA (in vector pARW089) using increased MnCl2 concentration
	Preparative agarose gel electrophoresis
	DNA extraction and purification of the positive samples
	Restriction enzyme digestion of mdnA and pARW089 using NarI and AatII
	Preparative agarose gel electrophoresis of each sample
	DNA extraction and purification of the positive samples
	Ligation
	Transformation
	DNA isolation of one clone using midiprep/ miniprep
	Sequencing

C.	mdnA as expression part
	PCR of mdnA in pARW089 using pf_mdnA_iGEM_EheI and pr_mdnA_iGEM_AatII (primer designed by phage display group)
	Preparative agarose gel electrophoresis
	DNA extraction and purification of the positive sample
	Restriction enzyme digestion of mdnA and iGEM expression vector pEX or pBAD
	Preparative agarose gel electrophoresis
	DNA extraction and purification of the samples
	Ligation
	Transformation
	DNA isolation of one clone using midiprep/ miniprep
	Sequencing

D.	mdnA in cloning vector
	PCR of mdnA in pARW089 using pf_mdnA_iGEM_EheI and pr_mdnA_iGEM_AatII (primer designed by phage display group)
	Preparative agarose gel electrophoresis
	DNA extraction and purification of the positive sample
	Restriction enzyme digestion of mdnA and iGEM expression vector pEX or pBAD
	Preparative agarose gel electrophoresis
	DNA extraction and purification of the samples
	Ligation
	Transformation
	DNA isolation of one clone using midiprep/ miniprep
	Sequencing

E.	Repetition of Elke's experiments as control for further experiments
	Expression and purification (HPLC; without myc-tag) of mdnA x mdnA in pARW089 x mdnA in iGEM expression vector pEX or pBAD

F.	mdnA with myc-tag (N- and C-terminal) in iGEM expression vector pEX or pBAD
	PCR of mdnA in pARW089 using x C-terminal: pf_mdnA_mycC_Xbal (forward) and pr_mdnA_mycC_PstI_NotI_SpeI (reverse) x N-terminal: pf_mdnA_mycN_Xbal_1 (forward) and pr_mdnA_mycN_PstI_NotI_SpeI (reverse)
	Preparative agarose gel electrophoresis
	DNA extraction and purification of the positive samples
	Restriction enzyme digestion of mdnA and iGEM expression vector pEX or pBAD
	Preparative agarose gel electrophoresis
	DNA extraction and purification of the samples
	Ligation

G.	Expression and purification of mdnA (with myc-tag) x N-terminal myc-tag x C-terminal myc-tag
	Transformation of E. coli with pEX/ pBAD containing mdnA with myc-tag and with pARW089

23th Labday 2011-06-24

purification of PCR products 2011-06-23

Investigators: Sandrina

Aim:

purification of PCR products mdnA iGEM and geneIII iGEM (lanes number 2 + 3) for phage display (strategy 2)

Time: 2011-06-24, 14:30-15:30

Materials/Methods:

QIAquick Gel Extraction Kit (250)

Further tasks:

digestion of the two fragments with EheI and AgeI (mdnA iGem) and AatII and NgoMIV (geneIII iGEM)

digestion of vector pARW089 with EheI and AatII

preparation of competent E. coli XL1 and RV 308

Investigators: Stefan

Aim:

get competent cells of E. coli XL 1 blue and RV 308

Time: 2011-06-24, 14:00-19:30

Materials:

over night cultures: E. coli XL 1 blu and RV 308

Method:

Work always sterile and cold and speedy!

All volumes deal with the common cellline!

The cooling-centrifuge is in the tool shed, cool down to 4°C early enough, close the lid correctly!

Prepare early enough min. 100 Eppis (1,5µl) (per cellline) and cool down to -80°C before using

Use Milipore-filter for sterile CaCl2 , keep cool!

prepare 15ml LB-Medium (or DYT) with the specific antibiotic (XL1-blue Tet, BL21 none!), inoculate and incubate over night

prepare 200ml LB-Medium (or DYT) with the specific antibiotic, inoculate with 2ml of the over-night-culture. Nurture the culture until OD600 at 0,35 (0,2-0,5) (if the OD is too high, the cell won’t be competent)

keep cell suspension in sterile falcons (50ml) 20 min on ice, then centrifuge for 20min; 4°C; 2500g

discard supernatant, carefully resuspend on ice with 10ml cold CaCl2-solution (put a little of the 10ml solution in every falcon before!), pool every resuspended aliquot of one cell line and add 40ml CaCl2-solution (total volume 50ml). Keep 30 min on ice, then centrifuge for 20min; 4°C; 2500g

discard supernatant, carefully resuspend pellet in 5,5ml CaCl2(80mM)/Glycerol (4:1), use the pippete boy and a sterile glas pipette to dissolve the pellet

aliquot in Eppis á 60µl and store immediately at - 80 °C

Results:

91 aliquots a 60 µL of XL1 and RF

Output:

Further tasks:

test the cells

Eppis in - 80°C in Boxen geräumt, aber noch nicht umbeschriftet

Midiprep of pEX carrying cells

Investigators: Nadine

Aim:

Midiprep of pEX

Time: 2011-06-24, 10:00-12:00

Materials:

Qiagen Plasmid Plus Midi Kit

over night cultures: 50 ml E. coli containing pEX from Tobi

NanoDrop

Method:

Midiprep

using Qiagen Plasmid Plus Midi Kit Quick-Start Protocol, Media: UP_QIAGEN_Plasmid_Plus_Midi_Kit.pdf

Output: 1x DNA Eppi Tubes: #5 pEX, 24.06.2011, storage: orange box (iGEM DNA, -20°C)

Results:

concentration:

- tube 1: 248.4 ng/µl

Further tasks:

Glycerol stocks of E. coli cells carrying pEX and pBAD plasmids

Investigators: Nadine

Aim: Generating stocks for further research

Time: 2011-06-24,10:00-10:15

Materials:

Glycerol

5 ml over-night culter of E. coli pBAD

50 ml over-night culter of E. coli pEX (also for midi-prep)

Method:

700 µl of cell suspension

300 µl glycerol

mixed gently and frozen by -80°C

24th Labday 2011-06-27

Control experiment fpr error prone PCR and enzyme digestion of mdnA

Investigators: Nadine, Steffi, Katharina, Nicole

Time: 2011-06-27, 14:30-16:30

Aim: control experiment to verify error prone PCR and enzyme digestion of mdnA, which experiment was done previously

--> error prone PCR using increased MnCl2 concentration

Materials:

protocol of experiment, which was done previously; see2011-06-22

Genaxxon Bioscience taq Polymerase

10x Genaxxon Bioscience taq Polymerase buffer containing 15 mM MgCl2

dNTPs (10 mM)

forward primer: sf_mdnA_1 (10 µM)

reverse primer: r_mdnA_1 (10 µM)

template DNA pARW089 (857,3 ng/ µl)

Genaxxon Bioscience MgCl2 stock solution (50 mM)

MnCl2

MnCl2 stock solution (50 mM)

Method:

1. Mix for error prone PCR with increasing MnCl2 concentration

Component	Stock concentration	Volume in µl	Final concentration
Genaxxon Bioscience Taq Polymerase buffer containing MgCl2)	15 mM (MgCl2)	5	1.5 mM MgCL2
MgCl2	50 mM	5.5	5.5 mM
dNTPs	10 mM	2.0	0.4 mM
Primer (sf_mdnA_1)	10 µM	2.5	0.5 µM
Primer (r_mdnA_1)	10 µM	2.5	0.5 µM
DNA (diluted 1:100)	8.57 ng/ µl	8.0	0.7 ng
Polymerase		1	5 U

in addition MnCl2 and H2O as shown following

Sample number	MnCl2 in µl	Final concentration MnCl2	H₂O in µl
1	0	0	23.5
2	0.5	0.05 mM	23.0
3	1.0	0.1 mM	22.5

2. Temperature profile

see 12th labday

Eppendorf Mastercycler personal, program IGMDNA1

Results:

3 PCR products containing random mutated mdnA

Further tasks:

Verification of these PCR products by agarose gel electrophoresis

Extraction and purification these (positive) samples

Enzyme digestion using NarI and AatII

Heating the half of each samples 10-20 min by 65°C and the other half not

Verification using agrose gel electrophoresis

Midiprep of pJC354_WZA2 (TorA-bla vector) carrying cells

Investigators: Sebastian, Paul

Aim:

Midiprep of pJC354_WZA2 carrying cells using Quiagen Plasmid Plus Midi Kit

Materials:

Qiagen Plasmid Plus Midi Kit

over night cultures ###

Output: DNA Eppi Tube label (-20°C), Concentration: ~1mg/ml

Further tasks:

Annealing of oligos for cleavage sites

Digest of vector with XhoI and NheI

Ligation of annealed oligos into the vector

25th Labday 2011-06-28

Agarose gel electrophoresis of mutated mdnA

Investigators: Katharina

Aim: Verification of random mutated mdnA

Time: 2011-06-26,12:45-13:30

Materials:

Agarose broad range (Roth)

1x TAE buffer

Gel Red

3 PCR products of mutated mdnA

DNA Ladder Gene Ruler, 100bp plus, DNA Ladder (Fermentas)

6x Loading Dye (Fermentas)

Method:

1. Production of a 1 % agarose gel

mAgarose = 0.5 g in 50 ml 1x TAE

adding 2 µl gel red

2. Loading samples

30 µl PCR product and 6x loading dye

2 µl DNA ladder gene ruler

3. Run

100 V

time: 1 h

Results:

300px

lane	Sample	Volume in µl
1	marker	2
2	PCR sample 1	50
3	PCR sample 2	50
4	PCR sample 3	50

Gel extraction of mutated mdnA

Investigators: Katharina

Aim: Extraction of mdnA, which was amplified and mutated (using error prone PCR)

Time: 2011-06-26,13:00-14:00

Materials:

NucleoSpin Extract II (Macherey-Nagel) extraction Kit

PCR products 1 and 2 containing mutated mdnA

Method:

performing gel extraction based on manufacturer's protocol

elute in 30 µl buffer NE

Results:

purified PCR products of mutated mdnA (1 and 2)

Further tasks:

restriction enzyme digestion with purified mdnA using AatII/ NarI

Verification by agarose gel electrophoresis

Restriction enzyme digestion and agarose gel electrophoresis of mutated mdnA

Investigators: Katharina

Time: 2011-06-28,14:00-17:00

Aim: Restriction enzyme digestion of random mutated mdnA and verification using gel electrophoresis

Materials:

Restriction enzymes: AatII, NarI

NEB Buffer 4

PCR products of random mutated mdnA(1 and 2), purified from gel

Agarose broad range (Roth)

1x TAE buffer

Gel Red

DNA Ladder Gene Ruler, 100bp plus, DNA Ladder (Fermentas)

6x Loading Dye (Fermentas)

Method:

1. Restriction enzyme digestion

5 µl of purified PCR product were left undigested

components	volume of PCR products /µl\|
DNA	25
NEB Buffer 4(10x)	4
Enzyme AatII	1
Enzyme NarI	1
H₂O	9
Total volume	40

digestion for 1 h

after digestion 17.5 µl of digested PCR product were taken for heat inactivation of the restriction enzyme (60°C for 20 min)

2. Production of 1 % agarose gels

mAgarose = 0.5 g in 50 ml 1x TAE

adding 2 µl gel red

3. Loading samples

a. restriction enzyme digestion products of random mutated mdnA

35 µl PCR product and 5 µl 6x loading dye

2 µl DNA ladder gene ruler, 100bp plus (Fermentas)

4. Run

120 V

time: 45 min

Results:

File:UP Digestion Error Prone 2010-28-06.png

lane	Sample	Volume in µl
1	marker	2
2	undigested mutated mdnA sample 1	5
3	digested mutated mdnA sample 1	17.5
4	digested and heat inactivated enzyme after digestion of mutaded mdnA sample 1	17.5
5	undigested mutated mdnA sample 2	5
6	digested mutated mdnA sample 2	17.5
7	digested and heat inactivated enzyme after digestion of mutaded mdnA sample 2	17.5

Error prone PCR (varied MnCl2 concentration) of mdnA

Investigators: Steffi

Time: 2011-06-28,15:00-15:50

Aim: Random mutation of mdnA gene based on increased MnCl2 concentration

Materials:

Genaxxon Bioscience Taq Polymerase

10x Genaxxon Bioscience Taq Polymerase buffer containing 15 mM MgCl2

dNTPs (10 mM)

forward primer: sf_mdnA_1 (10 µM)

reverse primer: r_mdnA_1 (10 µM)

template DNA pARW089 (857,3 ng/ µl measured by Nanodrop a second time)

Genaxxon Bioscience MgCl2 stock solution (50 mM)

MnCl2

Eppendorf Mastercycler personal, program IGMDNA1

Error prone PCR of mdnA

increasing MnCl2 concentration

1. Mix for error prone PCR with increasing MnCl2 concentration

Component	Stock concentration	Volume in µl	Final concentration
Genaxxon Bioscience Taq Polymerase buffer containing MgCl2)	15 mM (MgCl2)	5	1.5 mM MgCL2
MgCl2	50 mM	5.5	5.5 mM
dNTPs	10 mM	2.0	0.4 mM
Primer (each)	10 µM	2.5	0.5 µM
DNA (diluted 1:100)	8.57 ng/ µl	5.58	0.7 ng
Polymerase		1	5 U

2. Complete pipet scheme

Component in µl	1	2	3	4	5	6
Template DNA	8	8	8	8	8	8
dNTPs	2	2	2	2	2	2
10x Genaxxon polymerase buffer (with MgCl2)	5	5	5	5	5	5
MgCl2 (50 mM)	5.5	5.5	5.5	5.5	5.5	5.5
MnCl2 (5 mM)	0	0.5	1	1.25	1.5	2
Forward primer (sf_mdnA_1)	2.5	2.5	2.5	2.5	2.5	2.5
Reverse primer (r_mdnA_1)	2.5	2.5	2.5	2.5	2.5	2.5
H2O	23.5	23.0	22.5	22.25	22.0	21.5

3. Temperature profile

see 12th labday

Eppendorf Mastercycler personal, program IGMDNA1

Results:

6 PCR products containing mutated mdnA

Further tasks:

Verification of these PCR products by agarose gel electrophoresis

Purification and cloning of positive samples

Sequencing

26th Labday 2011-06-29

5l LB Media (liquid)

Investigators: Sebastian, Niels

Aim: Generating media for further research

Materials:

Yeast (5 g/l)

Tryptone (10 g/l)

NaCl (10 g/l)

autoclaved

oligo hybridization for TEV and 14_3C protease cleavage sites

Investigators: Sebastian, Paul

Materials:

2 reaction batches: of_NheI_CS-TEV_XhoI (Cleavage site for TEV) and of_NheI_143C-cleavage_XhoI (Cleavage site for 14_3C)

1 µl Oligo 1(of_NheI_CS-TEV_XhoI or of_NheI_143C-cleavage_XhoI forward)

1 µl Oligo 2(of_NheI_CS-TEV_XhoI or of_NheI_143C-cleavage_XhoI reverse)

4 µl 100mM TrisHCl pH 8

8 µl 5 mM MgCl2

26 µl H2O

Eppendorf Mastercycler personal, program ORIGAMI:

1 96°C 7 min

2 96°C 1 min

-1°C R=0,3°/s

goto 2 rep 70

hold 4°C

Restriction of pJC354_WZA2-vector

Investigators: Sebastian, Paul, Sascha

Materials:

XhoI (NEB), NheI (NEB)

100x BSA (NEB), 10x buffer 4 (NEB)

pJC354_WZA2-vector

Protocol:

1µl XhoI

1µl NheI

5µl 10x buffer 4

0,5 µl vector [~500ng]

0,5 µl 100x BSA

42 µl pure H2O

Reaction for 2h at 37°C

Further tasks:

preparative agarose electrophoresis

Ligation of digested vector with annealed oligos (over night, 18°C)

preparative agarose electrophoresis

Investigators: Sebastian, Paul, Sascha

Method:

Samples digested with NheI and XhoI

vector: digested pJC354_WZA2 source: Janina; prep-type: midi-prep ; prep-date:24.06.11 ; clone-no: 6

control undigested pJC354_WZA2 source: Janina; prep-type: midi-prep ; prep-date:24.06.11 ; clone-no: 6

Electrophoresis

sample preparation: 50 µl pJC354_WZA2 (digested) + 10 µl 6x loading dye solution, 1 µl pJC354_WZA2 (undigested) + 1 µl 6x loading dye + 4 µl dest. water

0,5 g Agarose, 50 ml TAE (1%), 2 µl GELRED, at 115 Volt,running time:_?___ minutes

marker: GeneRuler ladder mix (Fermentas)

lane	Sample	Sample/µl	Expected size (bp)	approx. size
1	marker	6 µl
2	pJC354_WZA2 (digested)	~40 µl	130, 4700	130, 8000, 2400
3	pJC354_WZA2 (digested)	~20 µl	130, 4700	130, 8000, 2400
5	pJC354_WZA2 (undigested)	6 µl	4000 for supercoiled, 4700 for not supercoiled plasmid	2400,2400-3000, 7500

300px

Gel Extraction

DNA excision: lane 2 and 3: 8000 bp band;

DNA purification: with QIAquick Gel Extraction Kit according to Qiagen manual (incl. isopropanol step)(done by Tobias)

Result: size estimation by eye;

lanes 2+3: plasmid was digested, small band has the expected size, two upper bands with unexpected size;

lanes 5: plasmid was undigested; 7500 bp unexpected; 3000 bp band might be undigested supercoiled plasmid

Conclusions:

exact vector fragment unknown, therefore 8000 bp band was
because of unexpected sizes marker should be compared with another marker, plasmids should be digested to yield several fragments for size control, maybe heat inactivation might help to resolve higher bands

Output: one plasmid fragments with 8000 bp in 1,5 ml eppis,

stored at -20 °C, box with fragments

PCR for amplification of mdnA with C-terminal myc-tag

Investigators: Jessica

Aim: amplificate mdnA of pARW089 and add C-terminal myc-tag with primers pf_mdnA_mycC_XbaI and pr_mdnA_mycC_PstI_NotI_SpeI

Time: 2011-06-29, 14:00-18:00

Materials:

NEB OneTaq DNA Polymerase

5x Buffer NEB OneTaq

dNTPs (10 mM)

forward primer: pf_mdnA_mycC_XbaI (10 µM)

reverse primer: pr_mdnA_mycC_PstI_NotI_SpeI (10 µM)

template DNA pARW089

Eppendorf Mastercycler gradient, program SABRINA

50 µl reaction

Component	Stock concentration	Volume in µl	Final concentration
5x Buffer NEB OneTaq	5x	10	1x
dNTPs	10 mM	1	0.2 mM
Primer (each)	10 µM	1	0.2 µM
DNA (diluted 1:100)	8.57 ng/ µl	5	~0.7 ng
NEB OneTaq DNA Polymerase		0.25	1.5 U
H2O		31.75

Temperature profil

Temperature in °C	Time in s
94		Hold

94	60	Initial denaturation
94	20	Denaturation
60	20	Annealing
72	20	Elongation
--> 15 cycles
94	60	Denaturation
70	40	Annealing
72	20	Elongation
--> 15 cycles
70	300	Final extension
6		Hold

Further tasks:
do gel electrophoresis

PCR of mdnA for phage display (strategy 1) repeated with new ordered forward primer

Investigators: Sandrina

Time: 2011-06-29,14:00-18:00

Aim: amplification of mdnA with SfiI restriction sites (vector pARW089) to clone it into pAk100 bla KDIR

Materials/Methods:

see 2011-06-10

changes:

elongation time 40 s

template 5 µl

program: Sabrina, eppendorf master cycler gradient

further tasks:

gel electrophoresis with PCR product

Error prone PCR (varied MnCl2 concentration) of mdnA

Investigators: Katharina

Time: 2011-06-29,12:00-13:00

Aim: Random mutation of mdnA gene based on increased MnCl2 concentration

Materials:

Genaxxon Bioscience Taq Polymerase

10x Genaxxon Bioscience Taq Polymerase buffer containing 15 mM MgCl2

dNTPs (10 mM)

forward primer: sf_mdnA_1 (10 µM)

reverse primer: r_mdnA_1 (10 µM)

template DNA pARW089 (857,3 ng/ µl measured by Nanodrop a second time)

Genaxxon Bioscience MgCl2 stock solution (50 mM)

MnCl2

Eppendorf Mastercycler personal, program IGMDNA1

Error prone PCR of mdnA

increasing MnCl2 concentration

1. Mix for error prone PCR with increasing MnCl2 concentration

Component	Stock concentration	Volume in µl	Final concentration
Genaxxon Bioscience Taq Polymerase buffer containing MgCl2)	15 mM (MgCl2)	5	1.5 mM MgCL2
MgCl2	50 mM	5.5	5.5 mM
dNTPs	10 mM	2.0	0.4 mM
Primer (each)	10 µM	2.5	0.5 µM
DNA (diluted 1:100)	8.57 ng/ µl	5.58	0.7 ng
Polymerase		1	5 U

2. Complete pipet scheme

Component in µl	1	2	3	4	5	6
Template DNA	8	8	8	8	8	8
dNTPs	2	2	2	2	2	2
10x Genaxxon polymerase buffer (with MgCl2)	5	5	5	5	5	5
MgCl2 (50 mM)	5.5	5.5	5.5	5.5	5.5	5.5
MnCl2 (5 mM)	0	0.5	1	1.25	1.5	2
Forward primer (sf_mdnA_1)	2.5	2.5	2.5	2.5	2.5	2.5
Reverse primer (r_mdnA_1)	2.5	2.5	2.5	2.5	2.5	2.5
H2O	23.5	23.0	22.5	22.25	22.0	21.5

3. Temperature profile

see 12th labday

Eppendorf Mastercycler personal, program IGMDNA1

Results:

12 PCR products (each sample was prepared twice) containing mutated mdnA

Further tasks:

Verification of these PCR products by agarose gel electrophoresis

Purification, digestion and cloning of positive samples

Sequencing

27th Labday 2011-06-30

Agarose gel electrophoresis of myc-tagged mdnA and mdnA for phage display

Investigators: Nadja, Jessica, Sandrina

Aim: Verification of myc-tagged mdnA and mdnA for phage display (strategy 1)

Time: 2011-06-30,10:00-12:00

Materials:

Agarose broad range (Roth)

1x TAE buffer

Gel Red

PCR products: myc-tagged mdnA, mdnA for phage display (strategy 1) from 2011-06-29

DNA Ladder Gene Ruler, 100bp plus (Fermentas)

6x Loading Dye (Fermentas)

Method:

1. Production of a 1 % agarose gel

mAgarose = 0.5 g in 50 ml 1x TAE

adding 2 µl gel red

2. Loading samples

5 µl PCR product and 6x loading dye

2 µl DNA ladder gene ruler (1:10)

3. Run

115 V

time: 1 h

Results:

lane	Sample	Volume in µl	Expected size in bp
M	marker	2
1	myc-tagged mdnA	6	233
2	mdnA with SfiI	6

Agarose gel electrophoresis of error prone PCR of mdnA from 2011-06-29 and gel extraction

Investigators: Nadja, Jessica

Aim: Verification of random mutated mdnA

Time: 2011-06-30, 12:00-17:00

Materials:

Agarose broad range (Roth)

1x TAE buffer

Gel Red

12 PCR products: sample 1a to 6b from 2011-06-29

DNA Ladder Gene Ruler, 100bp plus (Fermentas)

6x Loading Dye (Fermentas)

Method:

1. Production of a 1 % agarose gel

mAgarose = 0.5 g in 50 ml 1x TAE

adding 2 µl gel red
2. Loading samples

30 µl PCR product and 6x loading dye

2 µl DNA ladder gene ruler (1:10)

3. Run

115 V

time: 1 h

Results:

	gel 1			gel 2
lane	Sample	Volume in µl	Expected size in bp	Sample	Volume in µl	Expected size in bp
M	marker	2		marker	2
1	PCR sample 1a	36	276	PCR sample 4a	36	276
2	PCR sample 1b	36	276	PCR sample 4b	36	276
3	PCR sample 2a	36	276	PCR sample 5a	36	276
4	PCR sample 2b	36	276	PCR sample 5b	36	276
5	PCR sample 3a	36	276	PCR sample 6a	36	276
6	PCR sample 3b	36	276	PCR sample 6b	36	276

Gel Extraction

DNA excision: PCR products 1a to 6b

DNA purification: with Qiagen Gel Extraction Kit according to Qiagen manual (incl. isopropanol step, elute in 30 µl H2O)

Results:

DNA concentrations measured with Nanodrop were lower than 10 ng/µl

Further tasks:

repeat with remaining PCR samples?

Repeated PCR of mdnA for phage display (strategy 1) repeated with new ordered forward primer

Investigators: Sandrina, Sabine

Time: 2011-06-30,15:00-18:00

Aim: amplification of mdnA with SfiI restriction sites (vector pARW089) to clone it into pAk100 bla KDIR

Materials/Methods:

see 2011-06-10

changes:

elongation time 40 s

template 5 µl

program: Sabrina, eppendorf master cycler gradient

further tasks:

gel electrophoresis with PCR product

@@ Line 16: / Line 16: @@
 * Oligo Calc: Oligonucleotide Properties Calculator (http://www.basic.northwestern.edu/biotools/oligocalc.html)<br>
-<br>
 <b>Method:</b><br>
@@ Line 28: / Line 26: @@
 * Check self-complementarity and melting temperature using Oligo Calc
-<br>
 <b>Results:</b><br>
@@ Line 38: / Line 34: @@
 * pr_sfi_mdna_1 CCCTTCTGACTGGGAAGATTATGGCCTCGGGGGCCACTAATACTAGTAGCGGCCGCTGCAGGCT
-<br>
 <b>Further tasks:</b><br>
 * do PCR of mdnA
+<br>
 <h2 style="background-color: rgb(240, 20, 70);">11th Labday 2011-06-07</h2>
@@ Line 50: / Line 46: @@
 <b>Investigators:</b> Jessica, Nicole, Nadja <br>
-<br>
 <b>Aim:</b> PCR amplification of the mdn cluster <br>
-<br>
 <b>Time:</b> 2011-06-07,18:00-19:30<br>
-<br>
 <b>Materials:</b><br>
@@ Line 65: / Line 55: @@
 * Sequence of vector pARW071, concentration 857.3 ng/ µl
-* Manual: Fermentas Long PCR Enzyme Mix [[Media: UP_Fermentas_Long_PCR_Enzyme_Mix.pdf]]
+* Manual: Fermentas Long PCR Enzyme Mix
 * Forward primer: sf_bb_4_1
@@ Line 72: / Line 62: @@
 * Geneious Pro 5.1.7
-<br>
 <b>Method:</b><br>
@@ Line 80: / Line 68: @@
 * Definition of a mastermix based on the manual
-<br>
 <b>Results:</b><br>
@@ Line 87: / Line 73: @@
 . Temperature profil
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! Temperature in °C !! Time in s !!
@@ Line 140: / Line 126: @@
 |}
-<br>
 . Mastermix
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! Component !! Volume in µl !! Final concentration
@@ Line 175: / Line 159: @@
 |}
-<br>
 <b>Further tasks:</b><br>
@@ Line 182: / Line 165: @@
 * verification using agarose gel electrophoresis
-<br>
 <h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">Design of PCR conditions for amplifying mdnA</h3>
 <b>Investigators:</b> Jessica, Nicole, Nadja <br>
-<br>
 <b>Aim:</b> PCR amplification of mdnA <br>
-<br>
 <b>Time:</b> 2011-06-07,18:00-19:30<br>
-<br>
 <b>Materials:</b><br>
@@ Line 203: / Line 178: @@
 * Sequence of vector pARW089, concentration 626.7 ng/ µl
-* Manual: NEB OneTaq DNA Polymerase [[Media: UP_NEB_Protocol_OneTaq_DNA_Polymerase.pdf]]
+* Manual: NEB OneTaq DNA Polymerase
 * Forward primer: sf_mdna_1
@@ Line 210: / Line 185: @@
 * Geneious Pro 5.1.7
-<br>
 <b>Method:</b><br>
@@ Line 218: / Line 191: @@
 * Definition of a mastermix based on the manual
-<br>
 <b>Results:</b><br>
@@ Line 225: / Line 196: @@
 . Temperature profil
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! Temperature in °C !! Time in s !!
@@ Line 270: / Line 241: @@
 |}
-<br>
 . Mastermix
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! Component !! Volume in µl !! Final concentration
@@ Line 304: / Line 273: @@
 |}
-<br>
 <b>Further tasks:</b><br>
@@ Line 312: / Line 279: @@
 * verification using agarose gel electrophoresis
+<br>
 <h2 style="background-color: rgb(240, 20, 70);">12th Labday 2011-06-08</h2>
@@ Line 318: / Line 287: @@
 <b>Investigators:</b> Jessica, Nicole <br>
-<br>
 <b>Aim:</b> Testing the possibility of a PCR of the whole mdn cluster and the chosen conditions <br>
-<br>
 <b>Time:</b> 2011-06-08, 9:30-14:00<br>
-<br>
 <b>Materials:</b><br>
@@ Line 345: / Line 308: @@
 * used temperature profil
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! Temperature in °C !! Time in s !!
@@ Line 410: / Line 373: @@
 |}
-<br>
 <b>Method:</b><br>
@@ Line 422: / Line 383: @@
 * start the PCR program (press enter)
-<br>
 <b>Results:</b><br>
 * PCR product
-<br>
 <b>Further tasks:</b><br>
@@ Line 440: / Line 397: @@
 <b>Investigators:</b> Jessica, Nicole <br>
-<br>
 <b>Aim:</b> Testing the possibility of amplifying mdnA using PCR and the chosen conditions <br>
-<br>
 <b>Time:</b> 2011-06-08,9:30-14:00<br>
-<br>
 <b>Materials:</b><br>
@@ Line 466: / Line 417: @@
 * used temperature profil
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! Temperature in °C !! Time in s !!
@@ Line 511: / Line 462: @@
 |}
-<br>
 <b>Method:</b><br>
@@ Line 523: / Line 472: @@
 * start the PCR program (press enter)
-<br>
 <b>Results:</b><br>
 * PCR product
-<br>
 <b>Further tasks:</b><br>
 * Verification of the PCR product using agarose gel electrophoresis
+<br>
 <h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">Production of agarose gel</h3>
 <b>Investigators:</b> Jessica, Nicole <br>
-<br>
 <b>Aim:</b> Verification of PCR product, mdnA and whole mdn cluster, by agarose gel electrophoresis <br>
-<br>
 <b>Time:</b> 2011-06-08,9:30-14:00<br>
-<br>
 <b>Materials:</b><br>
@@ Line 557: / Line 498: @@
 * GelRed
-<br>
 <b>Method:</b><br>
@@ Line 569: / Line 508: @@
 * after cooling, adding of 2 µl GelRed
-<br>
 . mdnA (approx. 276 bp) --> 1.5 %
@@ Line 579: / Line 516: @@
 * after cooling, adding of 2 µl Gelred
-<br>
 <b>Results</b><br>
@@ Line 587: / Line 522: @@
 * 0.8 % agarose gel
-<br>
 <b>Further tasks:</b><br>
@@ Line 599: / Line 532: @@
 <b>Investigators:</b> Jessica, Nicole, Nadja <br>
-<br>
 <b>Aim:</b> Verification of PCR product, mdnA, by agarose gel electrophoresis<br>
-<br>
 <b>Time:</b> 2011-06-08,15:45-18:00<br>
-<br>
 <b>Materials:</b><br>
@@ Line 619: / Line 546: @@
 * 6x Loading Dye (Fermentas)<br>
-<br>
 <b>Method:</b><br>
@@ Line 629: / Line 554: @@
 * Adding 1 µl 6x loading dye to diluted PCR product
-<br>
 Positions of samples/ marker
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! lane !! Sample !! Sample/[µl] !! Expected size (bp) !! !!approx. size
@@ Line 655: / Line 578: @@
 |}
-<br>
 . Run
@@ Line 663: / Line 584: @@
 * time: 1 h
-<br>
 <b>Results:</b><br>
 [[File: UP_AG_PCR_mdnA_2011-06-08_JE_001.jpg|300px]]
-<br>
 <br>
@@ Line 681: / Line 598: @@
 <b>Investigators:</b> Sandrina, Sabine <br>
-<br>
 <b>Aim:</b> PCR reaction of mdnA with overlapping primers containing SfiI restriction sites for cloning into PAK100, which is needed for phage display <br>
-<br>
 <b>Time:</b> 2011-06-8,12:00-14:00 <br>
-<br>
 <b>Materials:</b><br>
@@ Line 703: / Line 614: @@
 * Geneious
-<br>
 <b>Method:</b><br>
 * Design of a temperature profile based on the manual
-<br>
 <b>Results:</b><br>
@@ Line 716: / Line 623: @@
 . Temperature profil
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! Temperature in °C !! Time in s !!
@@ Line 769: / Line 676: @@
 |}
+<b>Further tasks:</b><br> PCR
 <br>
-<b>Further tasks:</b><br> PCR
 <h2 style="background-color: rgb(240, 20, 70);">13th Labday 2011-06-09</h2>
@@ Line 779: / Line 686: @@
 <b>Investigators:</b> Jessica, Steffi, Nicole <br>
-<br>
 <b>Aim:</b> Verification of amplification of the complete mdn cluster by PCR<br>
-<br>
 <b>Time:</b> 2011-06-09,10:00-17:30 <br>
-<br>
 <b>Materials:</b><br>
@@ Line 799: / Line 700: @@
 * 6x Loading Dye (Fermentas)<br>
-<br>
 <b>Method:</b><br>
@@ Line 809: / Line 708: @@
 * Adding 1 µl 6x loading dye to diluted PCR product
-<br>
 Positions of samples/ marker
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! lane !! Sample !! Sample/[µl] !! Expected size (bp) !! !!approx. size
@@ Line 835: / Line 732: @@
 |}
-<br>
 . Run
@@ Line 843: / Line 738: @@
 * time: 1 h
-<br>
 <b>Results:</b><br>
 [[File: UP_AG_PCR_mdn_cluster_2011-06-11_JE_001.jpg|250px]]
-<br>
 <br>
@@ Line 863: / Line 754: @@
 <b>Investigators:</b> Sandrina, Sabine <br>
-<br>
 <b>Aim:</b> amplificate mdnA of pARW089 with primers pf_mdnA_sfi_1 and pr_mdnA_sfi_1<br>
-<br>
 <b>Time:</b> 2011-06-10,08:00-10:00, 14:00-20:00<br>
-<br>
 <b>Materials/Methods:</b><br>
@@ Line 909: / Line 794: @@
 <b>Further tasks:</b><br> gel electrophoresis and gel extraction
+<br>
 <h2 style="background-color: rgb(240, 20, 70);">15th Labday 2011-06-14</h2>
-<h3 style="background-color: rgb(238, 221, 130); font-weight: bold;">cultivation of cells containing pAK100 from ''E.coli'' glycerol stocks</h3>
+<h3 style="background-color: rgb(238, 221, 130); font-weight: bold;">cultivation of cells containing pAK100 from ''E. coli'' glycerol stocks</h3>
 <b>Investigators:</b> Sandrina <br>
-<br>
 <b>Aim:</b> cultivate cells conatining pAK100 (vector) to purify it and use it for phage display.
@@ Line 923: / Line 808: @@
 . genIII should be amplified from it to clone into pARW089 <br>
-<br>
 <b>Time:</b> 2011-06-14,13:45-14:45<br>
-<br>
 <b>Materials/Methods:</b><br>
@@ Line 937: / Line 818: @@
 <b>Further tasks:</b><br> plasmid preperation und digestion with SfiI
+<br>
 <h2 style="background-color: rgb(240, 20, 70);">16th Labday 2011-06-15</h2>
@@ Line 943: / Line 826: @@
 <b>Investigators:</b> Sandrina, Sabine, Jessica <br>
-<br>
 <b>Aim:</b> purification of mdnA and pak100 to use it for phage display.
@@ Line 951: / Line 832: @@
 .genIII should be amplified from it to clone into pARW089 <br>
-<br>
 <b>Time:</b> 2011-06-15,12:00-18:00<br>
-<br>
 <b>Materials/Methods:</b><br>
@@ Line 989: / Line 866: @@
 <b>Further tasks:</b><br> repeat PCR, gel electrophoresis of digested pak100
+<br>
 <h2 style="background-color: rgb(240, 20, 70);">17th Labday 2011-06-16</h2>
@@ Line 995: / Line 874: @@
 <b>Investigators:</b> Sandrina, Sabine, Anna <br>
-<br>
 <b>Time:</b> 2011-06-16,10:00-12:00 <br>
-<br>
+<b>Aim:</b> get a pAK100 plasmid digested with SfiI to clone mdnA into it (phage display, strategy 1) <br>
-<b>Aim:</b> get a pAK100 plasmid digested with sfiI to clone mdnA into it (phage display, strategy 1) <br>
-<br>
 <b>Materials/Methods:</b><br>
@@ Line 1,013: / Line 886: @@
 QIAquick Gel Extraction Kit (250)
-<br>
 <b>Results:</b><br>
 digestion worked, plasmids were extracted from the gel and stored at -20 °C
-<br>
 <b>Further tasks:</b><br>
-ligation of digested pAK100 with amplified mdnA containing sfiI restriction sites
+ligation of digested pAK100 with amplified mdnA containing SfiI restriction sites
 <h3 style="background-color: rgb(238, 221, 130); font-weight: bold;">PCR of mdnA for phage display repeated with modified conditions</h3>
 <b>Investigators:</b> Sandrina, Sabine, Anna <br>
-<br>
 <b>Time:</b> 2011-06-16,10:00-12:00 <br>
-<br>
 <b>Aim:</b> amplification of mdnA with SfiI restriction sites (vector pARW089) <br>
-<br>
 <b>Materials/Methods:</b><br>
@@ Line 1,049: / Line 912: @@
 * template 65 ng
+<br>
 <h3 style="background-color: rgb(238, 221, 130); font-weight: bold;">gel electrophoresis of PCR product</h3>
 <b>Investigators:</b> Sandrina, Anna, Sabine <br>
-<br>
 <b>Time:</b> 2011-06-16,16:00-18:00 <br>
-<br>
 <b>Material and Methods:</b><br>
 see 2011-06-15
-<br>
 <b>Results:</b><br>
@@ Line 1,071: / Line 930: @@
 reason: reversed primer was ordered unreversed <br>
-<br>
 <b>Further tasks:</b><br>
@@ Line 1,078: / Line 935: @@
 order a new primer
-<h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">Over night culture of ''E. coli'' XL1-blue and RF308</h3>
+<br>
+<h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">Over night culture of ''E. coli'' XL1-blue and RV308</h3>
 <b>Investigators:</b> Sandrina, Anna, Sabine <br>
-<br>
 <b>Time:</b> 2011-06-16,18:00-19:00 <br>
-<br>
 <b>Aim:</b> cultering cells to produce competent cells <br>
-<br>
 <b>Material and Methods:</b><br>
@@ Line 1,096: / Line 949: @@
 * XL1-blue: 15 ml LB medium with 100 µg/mL tetracycline out of tetracycline stock solution 50 mg/mL
-* RF308: 15 ml LB medium without streptomycin (not available)
+* RV308: 15 ml LB medium without streptomycin (not available)
-<br>
 <b>Further tasks:</b><br> produce competent cells
@@ Line 1,106: / Line 957: @@
 <h2 style="background-color: rgb(240, 20, 70);">18th Labday 2011-06-17</h2>
-<h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">competent cells - E.coli XL1 blue & RF308 </h3>
+<h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">competent cells - ''E. coli'' XL1 blue & RV308 </h3>
 <b>Investigator:</b> Niels <br>
-<br>
 <b>Aim:</b> produce competent cells
-<br>
 <b>Time:</b> 2011-06-15,09:00-16:30<br>
-<br>
 <b>Materials/Methods:</b><br>
@@ Line 1,132: / Line 977: @@
 * Use Milipore-filter for sterile CaCl2 , keep cool!
-* prepare 15ml LB-Medium (or DYT) with the specific antibiotic (XL1-blue ? Tet, BL21 ? none!), inoculate and incubate over night
+* prepare 15ml LB-Medium (or DYT) with the specific antibiotic (XL1-blue Tet, BL21 none!), inoculate and incubate over night
 * prepare 100ml LB-Medium (or DYT) with the specific antibiotic, inoculate with 2ml of the over-night-culture. Nurture the culture until OD600 at 0,35 (0,2-0,5) (if the OD is too high, the cell won’t be competent)
@@ Line 1,146: / Line 991: @@
 <b>Results:</b><br>
-* 22 tubes RF308 for expression(150µl competent cells at -80°C)
+* 22 tubes RV308 for expression(150µl competent cells at -80°C)
 * 22 tubes XL1 blue for transformation(150µl competent cells at -80°C)
-<br>
 <b>Further tasks:</b><br> check by transformation
+<br>
 <h3 style="background-color: rgb(238, 221, 130); font-weight: bold;">primer design for phage display </h3>
 <b>Investigators:</b> Jessica, Sabine, Sandrina, Anna <br>
-<br>
 <b>Aim:</b> Design primers for PCR of
@@ Line 1,167: / Line 1,010: @@
 to fuse genIII and mdnA in pARW089
-<br>
 <b>Time:</b> 2011-06-17,14:00-18:00<br>
-<br>
 <b>Materials:</b><br>
@@ Line 1,179: / Line 1,018: @@
 * Oligo Calc: Oligonucleotide Properties Calculator (http://www.basic.northwestern.edu/biotools/oligocalc.html)<br>
-<br>
 <b>Method:</b><br>
@@ Line 1,191: / Line 1,028: @@
 * Check self-complementarity and melting temperature using Oligo Calc
-<br>
 <b>Results:</b><br>
@@ Line 1,206: / Line 1,041: @@
 * pr_mdnA_iGEM_AAtII 5'->3' GACGTCCTGCAGCGGCCGCTACTAGTATTAACCGGTTATAATCTTCCCAGTCAGAAG (mdnA-AgeI-SpeI-NotI-PstI-AatII-nt)
-new ordered primer for amplification of mdnA from pARW089 with sfiI restriction sites (strategy 1)
+new ordered primer for amplification of mdnA from pARW089 with SfiI restriction sites (strategy 1)
 * pr_sfi_mdna_1 5'->3' AGCCTGCAGCGGCCGCTACTAGTATTAGTGGCCCCCGAGGCCATAATCTTCCCAGTCAGAAGGG
-<br>
 <b>Further tasks:</b><br>
 PCR
+<br>
 <h2 style="background-color: rgb(240, 20, 70);">19th Labday 2011-06-20</h2>
@@ Line 1,221: / Line 1,056: @@
 <b>Investigators:</b> Nadine, Katharina, Steffi, Nicole, Jessica <br>
-<br>
 <b>Time:</b> 2011-06-09,13:45-19:00 <br>
-<br>
 <b>Aim:</b> Preparation of LB-Agarplates <br>
-<br>
 <b>Recipe:</b><br>
@@ Line 1,243: / Line 1,072: @@
 * fill up to 1000 ml with Millipore H2O and autoclave
-<br>
 <b>Further tasks:</b><br> add antibiotics (Ampicillin, Kanamycin) to LB-Medium and prepare plates
@@ Line 1,253: / Line 1,080: @@
 <b>Investigators:</b> Nicole, Nadine, Katharina, Steffi <br>
-<br>
 <b>Aim:</b> Design primers for mdnA (from pARW089) in order to tag it w/ myc (+ Factor XA Protease restriction site) to clone into vector from Sven (iGEM vector from 2010)<br>
-<br>
 <b>Time:</b> 2011-06-01,16:00-19:00<br>
-<br>
 <b>Materials:</b><br>
@@ Line 1,269: / Line 1,090: @@
 * Oligo Calc: Oligonucleotide Properties Calculator (http://www.basic.northwestern.edu/biotools/oligocalc.html)<br>
-<br>
 <b>Method:</b><br>
@@ Line 1,295: / Line 1,114: @@
 ** used sequence (forward): ATT GAA GGC CGT
-<br>
 <b>Results:</b><br>
@@ Line 1,303: / Line 1,120: @@
 [[File: UP_Primer_design_myc_mdnA_2011-06-20.png|600px]]
-<br>
 <b>Further tasks:</b><br>
 * do PCR of mdnA
+<br>
 <h2 style="background-color: rgb(240, 20, 70);">20st Labday 2011-06-21</h2>
@@ Line 1,315: / Line 1,132: @@
 <b>Investigators:</b> Nadine, Steffi, Nicole <br>
-<br>
 <b>Time:</b> 2011-06-21,9:00-14:00 <br>
-<br>
 <b>Aim:</b> Random mutation of mdnA gene based on increased MnCl<small>2</small> and MgCl<small>2</small> concentration <br>
-<br>
 <b>Materials:</b><br>
@@ Line 1,373: / Line 1,184: @@
 * sterile filtration: pore size of filter: 0.2 µm
-<br>
-<br>
 <b>''Error prone PCR of mdnA''</b>
@@ Line 1,383: / Line 1,190: @@
 * increasing MgCl<small>2</small> concentration beginning with 1.5 mM, in 5 mM steps, ending with 15 mM (--> sample 5-8)
-<br>
 <b>1. Mix for error prone PCR with increasing MnCl<small>2</small> concentration</b><br>
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! Component !! Stock concentration !! Volume in µl !! Final concentration
@@ Line 1,417: / Line 1,222: @@
 |}
-<br>
 in addition MnCl<small>2</small> and H<small>2</small>O as shown following
-<br>
+{| border="1" class="wikitable"
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
 ! Sample number !! MnCl<small>2</small> in µl !! Final concentration MnCl<small>2</small> !! H<sub>2</sub>O in µl
@@ Line 1,445: / Line 1,246: @@
 |}
-<br>
-<br>
 <b>2. Mix for error prone PCR with increasing MgCl<small>2</small> concentration</b><br>
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! Component !! Stock concentration !! Volume in µl !! Final concentration
@@ Line 1,477: / Line 1,274: @@
 |}
-<br>
 in addition MgCl<small>2</small> and H<small>2</small>O as shown following
-<br>
+{| border="1" class="wikitable"
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
 ! Sample number !! MnCl<small>2</small> in µl !! Final concentration MnCl<small>2</small> !! H<sub>2</sub>O in µl
@@ Line 1,505: / Line 1,298: @@
 |}
-<br>
-<br>
 <b>3. Complete pipet scheme</b><br>
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! Component in µl !! 1 !! 2 !! 3 !! 4 !! 5 !! 6 !! 7 !! 8
@@ Line 1,549: / Line 1,338: @@
 |}
-<br>
-<br>
 <b>4. Temperature profile</b>
@@ Line 1,559: / Line 1,344: @@
 * Eppendorf Mastercycler personal, program IGMDNA1
-<br>
-<br>
 <b>Results:</b>
 * 8 PCR products containing mutated mdnA
-<br>
 <b>Further tasks:</b><br>
@@ Line 1,583: / Line 1,362: @@
 <b>Investigators:</b> Nadine, Jessica, Steffi, Nicole <br>
-<br>
 <b>Time:</b> 2011-06-21,14:00-17:00 <br>
-<br>
 <b>Aim:</b> Verification of random mutated mdnA (mutations are based on increased MnCl<small>2</small> and MgCl<small>2</small> concentration) <br>
-<br>
 <b>Materials:</b><br>
@@ Line 1,601: / Line 1,374: @@
 * Gel Red
-<br>
 * 8 PCR products of mutated mdnA, see
@@ Line 1,609: / Line 1,380: @@
 * 6x Loading Dye (Fermentas)<br>
-<br>
-<br>
 <b>Method:</b><br>
@@ Line 1,623: / Line 1,390: @@
 * adding 2 µl gel red
-<br>
 <b>2. Loading samples</b>
@@ Line 1,631: / Line 1,396: @@
 * 2 µl DNA ladder gene ruler
-<br>
-<br>
 <b>Positions of marker and sample</b><br>
@@ Line 1,640: / Line 1,401: @@
 ''Gel 1''
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! lane !! Sample !! Volume in µl !! Expected size in bp
@@ Line 1,665: / Line 1,426: @@
 |}
-<br>
 ''Gel 2''<br>
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! lane !! Sample !! Volume in µl !! Expected size in bp
@@ Line 1,695: / Line 1,454: @@
 |}
-<br>
 . Run
@@ Line 1,703: / Line 1,460: @@
 * time: 1 h
-<br>
 <b>Results:</b><br>
@@ Line 1,711: / Line 1,466: @@
 [[File: UP_AG_EPPCR_mdnA_sample5to8_labeled_2011-06-21_16- 11.jpg|300px]]<br>
-<br>
 * Gel Extraction DNA excision: lane 1-4, 5,7: ~ 276 bp band
 * stored at -20°C in orange box (iGEM 2011 UP DNA)
-<br>
-<br>
 <b>Further tasks:</b>
@@ Line 1,732: / Line 1,481: @@
 <br>
-<h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">Over night culture of E.coli BL21 containing BBa_K404304_pSB1C3 (biobrick iGEM Freiburg 2010) from Sven</h3>
+<h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">Over night culture of ''E. coli'' BL21 containing BBa_K404304_pSB1C3 (biobrick iGEM Freiburg 2010) from Sven</h3>
 <b>Investigators:</b> Jessica, Nadine, Stefan, Steffi <br>
-<br>
 <b>Aim:</b> Culturing ''E. coli'' containing BBa_K404304_pSB1C3 biobrick for midi-prep and using for cloning afterwards<br>
-<br>
 <b>Time:</b> 2011-06-21,16:50-17:00<br>
-<br>
 <b>Materials:</b><br>
-* cells: E.coli BL21 containing BBa_K404304_pSB1C3 (biobrick iGEM Freiburg 2010) from Sven (amount?)
+* cells: ''E. coli'' BL21 containing BBa_K404304_pSB1C3 (biobrick iGEM Freiburg 2010) from Sven
 * 50 ml LB media
 * 50 µl Chloramphenicol (100 mg/ml)<br>
-<br>
 <b>Method:</b><br>
@@ Line 1,763: / Line 1,504: @@
 * 37 °C, 250 rpm, 17 hours
-<br>
 <b>Results:</b><br>
-<br>
 <b>Further tasks:</b><br>
@@ Line 1,778: / Line 1,515: @@
 <br>
-<h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">Transformation of E.coli XL 1 blu and RV 308 + puK </h3>
+<h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">Transformation of ''E. coli'' XL 1 blu and RV 308 + puK </h3>
 <b>Investigators:</b> Niels <br>
-<br>
 <b>Aim:</b> Check the quality of competent cells<br>
-<br>
 <b>Time:</b> 2011-06-21,10:00-12:30<br>
-<br>
 <b>Materials:</b><br>
-* cells: E.coli XL 1 blu and RV 308
+* cells: ''E. coli'' XL 1 blu and RV 308
 * 50 ml LB media
 * 50 µl ampicillin (100 mg/ml)<br>
-<br>
 <b>Method:</b><br>
@@ Line 1,823: / Line 1,552: @@
 * storage over night at 37°C
-<br>
 <b>Results:</b><br>
 * negative
-<br>
 <b>Further tasks:</b><br>
@@ Line 1,843: / Line 1,568: @@
 <b>Investigators:</b> Katharina, Nicole <br>
-<br>
 <b>Aim:</b> Extraction of mdnA, which was amplified and mutated (using error prone PCR)<br>
-<br>
 <b>Time:</b> 2011-06-22,12:15-13:30<br>
-<br>
 <b>Materials:</b><br>
@@ Line 1,859: / Line 1,578: @@
 * PCR products 1-5 and 7 containing mutated mdnA
-<br>
 <b>Method:</b><br>
@@ Line 1,867: / Line 1,584: @@
 * elute in 30 µl buffer EB
-<br>
 <b>Results:</b><br>
 * purified PCR products of mutated mdnA (1-5, 7)
-<br>
 <b>Further tasks:</b><br>
@@ Line 1,883: / Line 1,596: @@
 * Ligation
+<br>
 <h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">Midiprep of pSB1C3 carrying cells</h3>
 <b>Investigators:</b> Nadine, Vanessa <br>
-<br>
 <b>Aim:</b><br>
@@ Line 1,895: / Line 1,608: @@
 * vector for biobricks (RFC25)
-<br>
 <b>Time:</b> 2011-06-22, 14:00-16:00 <br>
-<br>
 <b>Materials:</b><br>
@@ Line 1,906: / Line 1,615: @@
 * Qiagen Plasmid Plus Midi Kit <br>
-* over night cultures: E.coli BL21 containing BBa_K404304_pSB1C3 (biobrick iGEM Freiburg 2010) from Sven
+* over night cultures: ''E. coli'' BL21 containing BBa_K404304_pSB1C3 (biobrick iGEM Freiburg 2010) from Sven
 * NanoDrop
@@ Line 1,915: / Line 1,624: @@
 * using Qiagen Plasmid Plus Midi Kit Quick-Start Protocol, [[Media: UP_QIAGEN_Plasmid_Plus_Midi_Kit.pdf]] <br>
-<br>
 '''Output:''' 4 x DNA Eppi Tubes: pSB1C3, 22.06.2011, storage: orange box (iGEM DNA, -20°C)<br>
@@ Line 1,939: / Line 1,646: @@
 <b>Investigators:</b> Katharina, Nicole <br>
-<br>
 <b>Time:</b> 2011-06-22,14:00-18:00 <br>
-<br>
 <b>Aim:</b> Restriction enzyme digestion of random mutated mdnA and pARW089 (vector) and verification using gel electrophoresis<br>
-<br>
 <b>Materials:</b><br>
@@ Line 1,973: / Line 1,674: @@
 * 1kb DNA ladder (NEB)<br>
-<br>
-<br>
 <b>Method:</b><br>
@@ Line 1,982: / Line 1,679: @@
 <b>1. Restriction enzyme digestion</b> <br>
-{| border="1"
+{| border="1" class="wikitable"
 | components || align="right" |volume of PCR products /µl|| align="right" |volume of pARW089 /µl
@@ Line 2,017: / Line 1,714: @@
 * adding 4 µl gel red
-<br>
 <b>3. Loading samples</b>
@@ Line 2,025: / Line 1,720: @@
 * 30 µl PCR product and 6 µl 6x loading dye
-<br>
 b. restriction enzyme digestion product of vector pARW089
 * 10 µl PCR product and 6x loading dye
-<br>
 * 2 µl DNA ladder gene ruler, 100bp plus (Fermentas)
 * 2 µl 1 kb DNA ladder (NEB)
-<br>
-<br>
 <b>Positions of marker and sample</b><br>
@@ Line 2,046: / Line 1,733: @@
 ''Gel 1''
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! lane !! Sample !! Volume in µl !! Expected size in bp
@@ Line 2,075: / Line 1,762: @@
 |}
-<br>
 ''Gel 2''<br>
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! lane !! Sample !! Volume in µl !! Expected size in bp
@@ Line 2,101: / Line 1,786: @@
 |}
-<br>
 . Run
@@ Line 2,109: / Line 1,792: @@
 * time: 1 - 1.5 h
-<br>
 <b>Results:</b><br>
@@ Line 2,117: / Line 1,798: @@
 [[File: UP_AG_EPPCR_mdna7_pARW089_KB_2011-06-22.jpg|300px]]<br>
-<br>
 * stored in freezer
-<br>
-<br>
 <b>Further tasks:</b>
@@ Line 2,136: / Line 1,811: @@
 <br>
-<h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">Over night culture of E.coli ?? containing pEX respectively pBAD from Tobias</h3>
+<h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">Over night culture of ''E. coli'' containing pEX respectively pBAD from Tobias</h3>
 <b>Investigators:</b> Jessica, Nadine, Nicole <br>
-<br>
 <b>Aim:</b> Culturing ''E. coli'' containing PEX respectively pBAD for midi-prep<br>
-<br>
 <b>Time:</b> 2011-06-22,16:50-17:00<br>
-<br>
 <b>Materials:</b><br>
-* cells: E.coli ?? containing pEX respectively pBAD from Tobias (amount?)
+* cells: ''E. coli'' containing pEX respectively pBAD from Tobias
 * 50 ml LB media
 * 50 µl Ampicillin (100? mg/ml)<br>
-<br>
 <b>Method:</b><br>
@@ Line 2,167: / Line 1,834: @@
 * 37 °C, 250 rpm, 17 hours
-<br>
 <b>Results:</b><br>
-<br>
 <b>Further tasks:</b><br>
@@ Line 2,187: / Line 1,850: @@
 <b>Investigators:</b> Jessica <br>
-<br>
 <b>Aim:</b><br>
@@ Line 2,195: / Line 1,856: @@
 * expression vectors
-<br>
 <b>Time:</b> 2011-06-23, 10:30-12:30 <br>
-<br>
 <b>Materials:</b><br>
@@ Line 2,206: / Line 1,863: @@
 * Qiagen Plasmid Plus Midi Kit <br>
-* over night cultures: E.coli ?? containing pEX respectively pBAD
+* over night cultures: ''E. coli'' containing pEX respectively pBAD
 * NanoDrop
@@ Line 2,215: / Line 1,872: @@
 * using Qiagen Plasmid Plus Midi Kit Quick-Start Protocol, [[Media: UP_QIAGEN_Plasmid_Plus_Midi_Kit.pdf]] <br>
-<br>
 <b>Results:</b><br>
@@ Line 2,237: / Line 1,892: @@
 * pEX tubes thrown away because of low concentration
-<br>
 <b>Further tasks:</b><br>
@@ Line 2,246: / Line 1,899: @@
 <br>
-<h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">Over night culture of E.coli XL1-Blue and RF308 for competent cells</h3>
+<h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">Over night culture of ''E. coli'' XL1-Blue and RV308 for competent cells</h3>
 <b>Investigators:</b> Stefan <br>
-<br>
 <b>Aim:</b> Culturing cells to produce competent cells<br>
-<br>
 <b>Time:</b> 2011-06-23,15:30-16:00<br>
-<br>
 <b>Materials:</b><br>
@@ Line 2,264: / Line 1,911: @@
 * XL1-Blue: 15 ml LB medium with 100 µg/mL tetracycline out of tetracycline stock solution 50 mg/mL
-* RF308: 15 ml LB medium without streptomycin (not available)
+* RV308: 15 ml LB medium without streptomycin (not available)
-<br>
 <b>Method:</b><br>
@@ Line 2,279: / Line 1,924: @@
 * inoculate 200 mL fresh culture with 2 mL from starter culture
-<br>
 <b>Results:</b><br>
-<br>
 <b>Further tasks:</b><br>
@@ Line 2,292: / Line 1,933: @@
 <br>
-<h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">Over night culture of E.coli containing vector pBAD resp. pEX for midiprep resp. glycerol stocks</h3>
+<h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">Over night culture of ''E. coli'' containing vector pBAD resp. pEX for midiprep resp. glycerol stocks</h3>
-<b>Investigators:</b> Nicole <br><br>
+<b>Investigators:</b> Nicole <br>
-<b>Aim:</b> Culturing cells to do midiprep and to produce glycerol stocks<br><br>
+<b>Aim:</b> Culturing cells to do midiprep and to produce glycerol stocks<br>
-<b>Time:</b> 2011-06-23,17:30-18:00<br><br>
+<b>Time:</b> 2011-06-23,17:30-18:00<br>
 <b>Materials:</b><br>
@@ Line 2,333: / Line 1,974: @@
 <b>Investigators:</b> Sandrina, Sabine <br>
-<br>
 <b>Aim:</b><br>
@@ Line 2,343: / Line 1,982: @@
 amplificate GeneIII of pak100 with primers pf_iGEM_GenIII_NgoMIV and pr_GenIII_iGEM_AatII (phage display strategy 2)<br>
-<br>
 <b>Time:</b> 2011-06-23, 10:00-12:00, 15:00-17:00<br>
-<br>
 <b>Materials/Methods:</b><br>
@@ Line 2,378: / Line 2,013: @@
 ''Gel ''
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! lane !! Sample !! Volume in µl !! Expected size in bp
@@ Line 2,388: / Line 2,023: @@
 |-
-| 1 || mdnA with sfiI || 7 || 224
+| 1 || mdnA with SfiI || 7 || 224
 |-
@@ Line 2,401: / Line 2,036: @@
 |}
-<br>
 <b>Results:</b><br>
@@ Line 2,409: / Line 2,042: @@
 PCR for strategy 1 (lane number 1) probably did not work because the annealing temperature of the forward primer is located at 42°C (not 60 °C)
-<br>
 <b>Furter tasks:</b><br>
-* purification of pcr products
+* purification of PCR products
 * order new forward primer for strategy 1 with higher annealing temperature
@@ Line 2,423: / Line 2,054: @@
 <b>Investigators:</b> Nadine, Nicole <br>
-<br>
 <b>Time:</b> 2011-06-23, 15:00-18:00 <br>
-<br>
 <b>Aim:</b> Design of primers and detailed planing of further experiment
-<br>
 <b>Materials:</b><br>
@@ Line 2,441: / Line 2,066: @@
 * Oligo Calc: Oligonucleotide Properties Calculator (http://www.basic.northwestern.edu/biotools/oligocalc.html)<br>
-<br>
 <b>Method:</b><br>
@@ Line 2,449: / Line 2,072: @@
 * add an start codon (ATG) to the previously designed primer pf_mdnA_mycN_xbal
-<br>
 <b>2. Detailed planing of further experiments</b><br>
@@ Line 2,459: / Line 2,080: @@
 Idea: DNA is not completly single stranded; would be avoid by heating mixture after restriction enzyme digestion for 10-20 min at 65°C<br>
-<br>
 <b>B. Random mutagenesis of mdnA and determination of mutation rate</b><br>
 Idea: using an increased MnCl<small>2</small> concentration to mutate mdnA and finally sequencing of mdnA to determine the mutation rate<br>
-<br>
 <b>C. mdnA as iGEM expression part in vector pEX or pBAD</b><br>
-<br>
 <b>D. mdnA as biobrick </b><br>
 Idea: Cloning of mdnA in iGEM cloning vector to submit as biobrick<br>
-<br>
 <b>E. Repetition of Elke's experiments as control for further experiments</b><br>
 Idea: Further, purify mdnA with the use of antibodies (anti myc-tag) and without HPLC. To compare which strategy is more efficient (myc-tag or HPLC) HPLC experiment as control is necessary.<br>
-<br>
 <b>F. mdnA with myc-tag (N- and C-terminal) in iGEM expression vector pEX or pBAD</b><br>
 Idea: myc-tagging of mdnA to purify it with antibodies (without use of HPLC)<br>
-<br>
 <b>G. Expression and purification of mdnA (with myc-tag)</b><br>
@@ Line 2,494: / Line 2,103: @@
 Idea: Determine the efficiency of myc-tag/ antibody to purify mdnA.<br>
-<br>
+{| border="1" class="wikitable"
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
 ! To do !! Experimental tasks
@@ Line 2,727: / Line 2,334: @@
 |}
+<br>
 <h2 style="background-color: rgb(240, 20, 70);">23th Labday 2011-06-24</h2>
-<h3 style="background-color: rgb(238, 221, 130); font-weight: bold;">purification of pcr products 2011-06-23</h3>
+<h3 style="background-color: rgb(238, 221, 130); font-weight: bold;">purification of PCR products 2011-06-23</h3>
 <b>Investigators:</b> Sandrina<br>
-<br>
 <b>Aim:</b><br>
-* purification of pcr products mdnA iGEM and geneIII iGEM (lanes number 2 + 3) for phage display (strategy 2)<br>
+* purification of PCR products mdnA iGEM and geneIII iGEM (lanes number 2 + 3) for phage display (strategy 2)<br>
-<br>
 <b>Time:</b> 2011-06-24, 14:30-15:30 <br>
-<br>
 <b>Materials/Methods:</b><br>
 * QIAquick Gel Extraction Kit (250)
-<br>
 <b>Further tasks:</b><br>
@@ Line 2,758: / Line 2,359: @@
 * digestion of vector pARW089 with EheI and AatII
-<h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">preparation of competent E.coli XL1 and RV 308</h3>
+<br>
+<h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">preparation of competent ''E. coli'' XL1 and RV 308</h3>
 <b>Investigators:</b> Stefan<br>
-<br>
 <b>Aim:</b><br>
 *get competent cells of ''E. coli'' XL 1 blue and RV 308<br>
-<br>
 <b>Time:</b> 2011-06-24, 14:00-19:30 <br>
-<br>
 <b>Materials:</b><br>
-* over night cultures: E.coli XL 1 blu and RV 308<br>
+* over night cultures: ''E. coli'' XL 1 blu and RV 308<br>
 <b>Method:</b><br>
@@ Line 2,784: / Line 2,381: @@
 * All volumes deal with the common cellline!
-* The cooling-centrifuge is in the tool shed (Geräteraum), cool down to 4°C early enough (Schalter hinten rechts), close the lid correctly!
+* The cooling-centrifuge is in the tool shed, cool down to 4°C early enough, close the lid correctly!
 * Prepare early enough min. 100 Eppis (1,5µl) (per cellline) and cool down to -80°C before using
@@ Line 2,790: / Line 2,387: @@
 * Use Milipore-filter for sterile CaCl2 , keep cool!
-*prepare 15ml LB-Medium (or DYT) with the specific antibiotic (XL1-blue ? Tet, BL21 ? none!), inoculate and incubate over night
+*prepare 15ml LB-Medium (or DYT) with the specific antibiotic (XL1-blue Tet, BL21 none!), inoculate and incubate over night
 * prepare 200ml LB-Medium (or DYT) with the specific antibiotic, inoculate with 2ml of the over-night-culture. Nurture the culture until OD600 at 0,35 (0,2-0,5) (if the OD is too high, the cell won’t be competent)
@@ Line 2,807: / Line 2,404: @@
 '''Output:'''
-<br>
 <b>Further tasks:</b><br>
 test the cells
-<br>
-<br>
 Eppis in - 80°C in Boxen geräumt, aber noch nicht umbeschriftet<br>
@@ Line 2,823: / Line 2,414: @@
 <b>Investigators:</b> Nadine <br>
-<br>
 <b>Aim:</b><br>
 * Midiprep of pEX<br>
-<br>
 <b>Time:</b> 2011-06-24, 10:00-12:00 <br>
-<br>
 <b>Materials:</b><br>
@@ Line 2,840: / Line 2,425: @@
 * Qiagen Plasmid Plus Midi Kit <br>
-* over night cultures: 50 ml E.coli containing pEX from Tobi
+* over night cultures: 50 ml ''E. coli'' containing pEX from Tobi
 * NanoDrop
@@ Line 2,849: / Line 2,434: @@
 * using Qiagen Plasmid Plus Midi Kit Quick-Start Protocol, [[Media: UP_QIAGEN_Plasmid_Plus_Midi_Kit.pdf]] <br>
-<br>
 '''Output:''' 1x DNA Eppi Tubes: '''#5 pEX, 24.06.2011''', storage: orange box (iGEM DNA, -20°C)<br>
@@ Line 2,864: / Line 2,447: @@
 <br>
-<h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">Glycerol stocks of E.coli cells carrying pEX and pBAD plasmids </h3>
+<h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">Glycerol stocks of ''E. coli'' cells carrying pEX and pBAD plasmids </h3>
 <b>Investigators:</b> Nadine <br>
-<br>
 <b>Aim:</b> Generating stocks for further research<br>
-<br>
 <b>Time:</b> 2011-06-24,10:00-10:15<br>
-<br>
 <b>Materials:</b><br>
@@ Line 2,882: / Line 2,459: @@
 * Glycerol <br>
-* 5 ml over-night culter of E.coli pBAD <br>
+* 5 ml over-night culter of ''E. coli'' pBAD <br>
-* 50 ml over-night culter of E.coli pEX (also for midi-prep)<br>
+* 50 ml over-night culter of ''E. coli'' pEX (also for midi-prep)<br>
-<br>
 <b>Method:</b><br>
@@ Line 2,903: / Line 2,478: @@
 <b>Investigators:</b> Nadine, Steffi, Katharina, Nicole <br>
-<br>
 <b>Time:</b> 2011-06-27, 14:30-16:30 <br>
-<br>
 <b>Aim:</b> control experiment to verify error prone PCR and enzyme digestion of mdnA, which experiment was done previously
 --> error prone PCR using increased MnCl<small>2</small> concentration
-<br>
 <b>Materials:</b><br>
 * protocol of experiment, which was done previously; see[[#Restriction enzyme digestion and agarose gel electrophoresis of mutated mdnA|2011-06-22]]
-<br>
 * Genaxxon Bioscience taq Polymerase
@@ Line 2,939: / Line 2,506: @@
 * MnCl<small>2</small> stock solution (50 mM)
-<br>
 <b>Method:</b><br>
@@ Line 2,946: / Line 2,511: @@
 <b>1. Mix for error prone PCR with increasing MnCl<small>2</small> concentration</b><br>
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! Component !! Stock concentration !! Volume in µl !! Final concentration
@@ Line 2,979: / Line 2,544: @@
 |}
-<br>
 in addition MnCl<small>2</small> and H<small>2</small>O as shown following
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! Sample number !! MnCl<small>2</small> in µl !! Final concentration MnCl<small>2</small> !! H<sub>2</sub>O in µl
@@ Line 3,001: / Line 2,564: @@
 |}
-<br>
 <b>2. Temperature profile</b>
@@ Line 3,009: / Line 2,570: @@
 * Eppendorf Mastercycler personal, program IGMDNA1
-<br>
 <b>Results:</b>
 * 3 PCR products containing random mutated mdnA
-<br>
 <b>Further tasks:</b><br>
@@ Line 3,035: / Line 2,592: @@
 <b>Investigators:</b> Sebastian, Paul <br>
-<br>
 <b>Aim:</b><br>
 * Midiprep of pJC354_WZA2 carrying cells using Quiagen Plasmid Plus Midi Kit <br>
-<br>
 <b>Materials:</b><br>
@@ Line 3,067: / Line 2,620: @@
 <b>Investigators:</b> Katharina <br>
-<br>
 <b>Aim:</b> Verification of random mutated mdnA<br>
 <b>Time:</b> 2011-06-26,12:45-13:30<br>
-<br>
 <b>Materials:</b><br>
@@ Line 3,091: / Line 2,640: @@
 * 6x Loading Dye (Fermentas)<br>
-<br>
 <b>Method:</b><br>
@@ Line 3,101: / Line 2,648: @@
 * adding 2 µl gel red
-<br>
 <b>2. Loading samples</b>
@@ Line 3,109: / Line 2,654: @@
 * 2 µl DNA ladder gene ruler
-<br>
 <b>3. Run</b>
@@ Line 3,117: / Line 2,660: @@
 * time: 1 h
-<br>
 <b>Results:</b><br>
@@ Line 3,124: / Line 2,665: @@
 [[File: UP_Error_Prone_PCR_2010-06-28.png|300px]]
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! lane !! Sample !! Volume in µl !! Expected size in bp
@@ Line 3,147: / Line 2,688: @@
 |}
+<br>
 <h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">Gel extraction of mutated mdnA </h3>
 <b>Investigators:</b> Katharina <br>
-<br>
 <b>Aim:</b> Extraction of mdnA, which was amplified and mutated (using error prone PCR)<br>
-<br>
 <b>Time:</b> 2011-06-26,13:00-14:00<br>
-<br>
 <b>Materials:</b><br>
@@ Line 3,167: / Line 2,704: @@
 * PCR products 1 and 2 containing mutated mdnA
-<br>
 <b>Method:</b><br>
@@ Line 3,175: / Line 2,710: @@
 * elute in 30 µl buffer NE
-<br>
 <b>Results:</b><br>
 * purified PCR products of mutated mdnA (1 and 2)
-<br>
 <b>Further tasks:</b><br>
@@ Line 3,189: / Line 2,720: @@
 * Verification by agarose gel electrophoresis
+<br>
 <h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">Restriction enzyme digestion and agarose gel electrophoresis of mutated mdnA</h3>
 <b>Investigators:</b> Katharina<br>
-<br>
 <b>Time:</b> 2011-06-28,14:00-17:00 <br>
-<br>
 <b>Aim:</b> Restriction enzyme digestion of random mutated mdnA and verification using gel electrophoresis<br>
-<br>
 <b>Materials:</b><br>
@@ Line 3,223: / Line 2,750: @@
 * 6x Loading Dye (Fermentas)
-<br>
-<br>
-<br>
 <b>Method:</b><br>
@@ Line 3,236: / Line 2,757: @@
 * 5 µl of purified PCR product were left undigested<br>
-{| border="1"
+{| border="1" class="wikitable"
 | components || align="right" |volume of PCR products /µl|
@@ Line 3,275: / Line 2,796: @@
 * adding 2 µl gel red
-<br>
 <b>3. Loading samples</b>
@@ Line 3,285: / Line 2,804: @@
 * 2 µl DNA ladder gene ruler, 100bp plus (Fermentas)
-<br>
 . Run
@@ Line 3,293: / Line 2,810: @@
 * time: 45 min
-<br>
 <b>Results:</b><br>
@@ Line 3,300: / Line 2,815: @@
 [[File: UP_Digestion_Error_Prone_2010-28-06.png]]
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! lane !! Sample !! Volume in µl !! Expected size in bp
@@ Line 3,335: / Line 2,850: @@
 |}
+<br>
 <h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">Error prone PCR (varied MnCl<small>2</small> concentration) of mdnA</h3>
 <b>Investigators:</b> Steffi <br>
-<br>
 <b>Time:</b> 2011-06-28,15:00-15:50 <br>
-<br>
 <b>Aim:</b> Random mutation of mdnA gene based on increased MnCl<small>2</small> concentration <br>
-<br>
 <b>Materials:</b><br>
@@ Line 3,369: / Line 2,880: @@
 * Eppendorf Mastercycler personal, program IGMDNA1
-<br>
 <b>''Error prone PCR of mdnA''</b>
@@ Line 3,378: / Line 2,887: @@
 <b>1. Mix for error prone PCR with increasing MnCl<small>2</small> concentration</b><br>
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! Component !! Stock concentration !! Volume in µl !! Final concentration
@@ Line 3,407: / Line 2,916: @@
 |}
-<br>
 <b>2. Complete pipet scheme</b><br>
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! Component in µl !! 1 !! 2 !! 3 !! 4 !! 5 !! 6
@@ Line 3,449: / Line 2,956: @@
 |}
-<br>
-<br>
 <b>3. Temperature profile</b>
@@ Line 3,459: / Line 2,962: @@
 * Eppendorf Mastercycler personal, program IGMDNA1
-<br>
-<br>
 <b>Results:</b>
@@ Line 3,468: / Line 2,967: @@
 * 6 PCR products containing mutated mdnA
-<br>
 <b>Further tasks:</b><br>
@@ Line 3,485: / Line 2,983: @@
 <b>Investigators:</b> Sebastian, Niels <br>
-<br>
 <b>Aim:</b> Generating media for further research<br>
-<br>
 <b>Materials:</b><br>
@@ Line 3,504: / Line 2,998: @@
 <br>
-<h3 style="background-color: rgb(100, 150, 100); font-weight: bold;">oligo hybridization for TEV and Precission protease cleavage sites</h3>
+<h3 style="background-color: rgb(100, 150, 100); font-weight: bold;">oligo hybridization for TEV and 14_3C protease cleavage sites</h3>
 <b>Investigators:</b> Sebastian, Paul<br>
@@ Line 3,510: / Line 3,004: @@
 <b>Materials:</b><br>
-reaction batches: of_NheI_CS-TEV_XhoI (Cleavage site for TEV) and of_NheI_143C-cleavage_XhoI (Cleavage site for Precission)
+reaction batches: of_NheI_CS-TEV_XhoI (Cleavage site for TEV) and of_NheI_143C-cleavage_XhoI (Cleavage site for 14_3C)
 * 1 µl Oligo 1(of_NheI_CS-TEV_XhoI or of_NheI_143C-cleavage_XhoI forward)
@@ Line 3,567: / Line 3,061: @@
 * Ligation of digested vector with annealed oligos (over night, 18°C)
+<br>
 <h3 style="background-color: rgb(100, 150, 100); font-weight: bold;">preparative agarose electrophoresis</h3>
@@ Line 3,590: / Line 3,086: @@
 <br>
-<table border="1" cellpadding="2" cellspacing="0">
+<table border="1" class="wikitable">
 <tr>
@@ Line 3,693: / Line 3,189: @@
 </table>
-<br>
 &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;
@@ Line 3,705: / Line 3,199: @@
 DNA purification: with QIAquick Gel Extraction Kit according to Qiagen manual (incl. isopropanol step)(done by Tobias)<br>
-<br>
 <b>Result:</b> size estimation by eye;<br>
@@ Line 3,737: / Line 3,229: @@
 <b>Investigators:</b> Jessica <br>
-<br>
 <b>Aim:</b> amplificate mdnA of pARW089 and add C-terminal myc-tag with primers pf_mdnA_mycC_XbaI and pr_mdnA_mycC_PstI_NotI_SpeI<br>
-<br>
 <b>Time:</b> 2011-06-29, 14:00-18:00<br>
-<br>
 <b>Materials:</b><br>
@@ Line 3,766: / Line 3,252: @@
 <b>50 µl reaction</b><br>
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! Component !! Stock concentration !! Volume in µl !! Final concentration
@@ Line 3,795: / Line 3,281: @@
 |}
-<br>
 '''Temperature profil'''
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! Temperature in °C !! Time in s !!
@@ Line 3,858: / Line 3,342: @@
 |}
-<br>
 <b>Further tasks:</b><br> do gel electrophoresis
+<br>
 <h3 style="background-color: rgb(238, 221, 130); font-weight: bold;">PCR of mdnA for phage display (strategy 1) repeated with new ordered forward primer</h3>
 <b>Investigators:</b> Sandrina <br>
-<br>
 <b>Time:</b> 2011-06-29,14:00-18:00 <br>
-<br>
 <b>Aim:</b> amplification of mdnA with SfiI restriction sites (vector pARW089) to clone it into pAk100 bla KDIR <br>
-<br>
 <b>Materials/Methods:</b><br>
@@ Line 3,887: / Line 3,366: @@
 * program: Sabrina, eppendorf master cycler gradient
-<br>
 <b>further tasks:</b><br>
-gel electrophoresis with pcr product
+gel electrophoresis with PCR product
+<br>
 <h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">Error prone PCR (varied MnCl<small>2</small> concentration) of mdnA</h3>
 <b>Investigators:</b> Katharina <br>
-<br>
 <b>Time:</b> 2011-06-29,12:00-13:00 <br>
-<br>
 <b>Aim:</b> Random mutation of mdnA gene based on increased MnCl<small>2</small> concentration <br>
-<br>
 <b>Materials:</b><br>
@@ Line 3,927: / Line 3,400: @@
 * Eppendorf Mastercycler personal, program IGMDNA1
-<br>
 <b>''Error prone PCR of mdnA''</b>
@@ Line 3,936: / Line 3,407: @@
 <b>1. Mix for error prone PCR with increasing MnCl<small>2</small> concentration</b><br>
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! Component !! Stock concentration !! Volume in µl !! Final concentration
@@ Line 3,965: / Line 3,436: @@
 |}
-<br>
 <b>2. Complete pipet scheme</b><br>
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! Component in µl !! 1 !! 2 !! 3 !! 4 !! 5 !! 6
@@ Line 4,007: / Line 3,476: @@
 |}
-<br>
-<br>
 <b>3. Temperature profile</b>
@@ Line 4,017: / Line 3,482: @@
 * Eppendorf Mastercycler personal, program IGMDNA1
-<br>
-<br>
 <b>Results:</b>
 * 12 PCR products (each sample was prepared twice) containing mutated mdnA
-<br>
 <b>Further tasks:</b><br>
@@ Line 4,043: / Line 3,502: @@
 <b>Investigators:</b> Nadja, Jessica, Sandrina <br>
-<br>
 <b>Aim:</b> Verification of myc-tagged mdnA and mdnA for phage display (strategy 1)<br>
-<br>
+<b>Time:</b> 2011-06-30,10:00-12:00<br>
-<b>Time:</b> 2011-06-30,10:00-12:00<br> <br>
 <b>Materials:</b><br>
@@ Line 4,065: / Line 3,520: @@
 * 6x Loading Dye (Fermentas) <br>
-<br>
 <b>Method:</b><br>
@@ Line 4,087: / Line 3,540: @@
 * time: 1 h <br>
-<br>
 <b>Results:</b><br>
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! lane !! Sample !! Volume in µl !! Expected size in bp
@@ Line 4,111: / Line 3,562: @@
 |}
-<br>
 [[File: UP_AG_PCR_mdna_2011-06-30_JE_001.jpg |125 px]] <br>
@@ Line 4,118: / Line 3,567: @@
 <h3 style="background-color: rgb(254, 122, 122); font-weight: bold;">Agarose gel electrophoresis of error prone PCR of mdnA from 2011-06-29 and gel extraction </h3>
-<b>Investigators:</b> Nadja, Jessica<br> <br>
+<b>Investigators:</b> Nadja, Jessica<br>
-<b>Aim:</b> Verification of random mutated mdnA<br> <br>
+<b>Aim:</b> Verification of random mutated mdnA<br>
-<b>Time:</b> 2011-06-30, 12:00-17:00<br> <br>
+<b>Time:</b> 2011-06-30, 12:00-17:00<br>
 <b>Materials:</b><br>
@@ Line 4,136: / Line 3,585: @@
 * DNA Ladder Gene Ruler, 100bp plus (Fermentas)
-* 6x Loading Dye (Fermentas) <br> <br>
+* 6x Loading Dye (Fermentas) <br>
 <b>Method:</b><br>
@@ Line 4,154: / Line 3,603: @@
 * 115 V
-* time: 1 h <br> <br>
+* time: 1 h <br>
 <b>Results:</b><br>
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+{| border="1" class="wikitable"
 ! !! colspan="3" | gel 1 !! !! colspan="3" | gel 2
@@ Line 4,197: / Line 3,646: @@
 |}
-<br>
 [[File: UP_AG_EPPCR_mdnA_2011-06-30_JE_001.jpg |300px]] [[File: UP_AG_EPPCR_mdnA_2011-06-30_JE_002.jpg |300px]] <br>
-<br>
 <b>Gel Extraction</b>
@@ Line 4,208: / Line 3,653: @@
 *DNA excision: PCR products 1a to 6b
-*DNA purification: with Qiagen Gel Extraction Kit according to Qiagen manual (incl. isopropanol step, elute in 30 µl H<small>2</small>O)<br> <br>
+*DNA purification: with Qiagen Gel Extraction Kit according to Qiagen manual (incl. isopropanol step, elute in 30 µl H<small>2</small>O)<br>
 <b>Results:</b><br>
@@ Line 4,214: / Line 3,659: @@
 *DNA concentrations measured with Nanodrop were lower than 10 ng/µl
-<br>
 <b>Further tasks:</b><br>
 *repeat with remaining PCR samples?
+<br>
 <h3 style="background-color: rgb(238, 221, 130); font-weight: bold;">Repeated PCR of mdnA for phage display (strategy 1) repeated with new ordered forward primer</h3>
 <b>Investigators:</b> Sandrina, Sabine <br>
-<br>
 <b>Time:</b> 2011-06-30,15:00-18:00 <br>
-<br>
 <b>Aim:</b> amplification of mdnA with SfiI restriction sites (vector pARW089) to clone it into pAk100 bla KDIR <br>
-<br>
 <b>Materials/Methods:</b><br>
@@ Line 4,245: / Line 3,685: @@
 * program: Sabrina, eppendorf master cycler gradient
-<br>
 <b>further tasks:</b><br>
-gel electrophoresis with pcr product
+gel electrophoresis with PCR product

Team:Potsdam Bioware/Labjournal/June

From 2011.igem.org

Latest revision as of 01:31, 22 September 2011

Contents

10th Labday 2011-06-01

Primer design for Phage Display

11th Labday 2011-06-07

Design of PCR conditions for amplifying the complete mdn cluster

Design of PCR conditions for amplifying mdnA

12th Labday 2011-06-08

PCR of the complete mdn cluster

PCR of mdnA

Production of agarose gel

Agarose gel electrophoresis of mdnA

Design of PCR conditions for amplifying mdnA for Phage display

13th Labday 2011-06-09

Agarose gel electrophoresis of mdn cluster

14th Labday 2011-06-10

Amplification of mdnA for phage display

15th Labday 2011-06-14

cultivation of cells containing pAK100 from E. coli glycerol stocks

16th Labday 2011-06-15

gel electroporesis PCR product(mdnA, 2011-06-10), plasmid preperation und digestion with SfiI of pAK100 bla KDIR

17th Labday 2011-06-16

gel electrophoresis and gel extraction of digested pAK100 bla KDIR

PCR of mdnA for phage display repeated with modified conditions

gel electrophoresis of PCR product

Over night culture of E. coli XL1-blue and RV308

18th Labday 2011-06-17

competent cells - E. coli XL1 blue & RV308

primer design for phage display

19th Labday 2011-06-20

Preparation of LB-Agarplates

Design of Primers for myc-tagging mdnA

20st Labday 2011-06-21

Error prone PCR (varied MnCl2 and MgCl2 concentration) of mdnA

Agarose gel electrophoresis of mutated mdnA

Over night culture of E. coli BL21 containing BBa_K404304_pSB1C3 (biobrick iGEM Freiburg 2010) from Sven

Transformation of E. coli XL 1 blu and RV 308 + puK

21th Labday 2011-06-22

Gel extraction of mutated mdnA

Midiprep of pSB1C3 carrying cells

Restriction enzyme digestion and agarose gel electrophoresis of mutated mdnA

Over night culture of E. coli containing pEX respectively pBAD from Tobias

22th Labday 2011-06-23

Midiprep of pEX respectively pBAD carrying cells

Over night culture of E. coli XL1-Blue and RV308 for competent cells

Over night culture of E. coli containing vector pBAD resp. pEX for midiprep resp. glycerol stocks

Amplification of mdnA and GeneIII for phage display

Design of primers and planing of further experiments

23th Labday 2011-06-24

purification of PCR products 2011-06-23

preparation of competent E. coli XL1 and RV 308

Midiprep of pEX carrying cells

Glycerol stocks of E. coli cells carrying pEX and pBAD plasmids

24th Labday 2011-06-27

Control experiment fpr error prone PCR and enzyme digestion of mdnA

Midiprep of pJC354_WZA2 (TorA-bla vector) carrying cells

25th Labday 2011-06-28

Agarose gel electrophoresis of mutated mdnA

Gel extraction of mutated mdnA

Restriction enzyme digestion and agarose gel electrophoresis of mutated mdnA

Error prone PCR (varied MnCl2 concentration) of mdnA

26th Labday 2011-06-29

5l LB Media (liquid)

oligo hybridization for TEV and 14_3C protease cleavage sites

Restriction of pJC354_WZA2-vector

preparative agarose electrophoresis

PCR for amplification of mdnA with C-terminal myc-tag

PCR of mdnA for phage display (strategy 1) repeated with new ordered forward primer

Error prone PCR (varied MnCl2 concentration) of mdnA

27th Labday 2011-06-30

Agarose gel electrophoresis of myc-tagged mdnA and mdnA for phage display

Agarose gel electrophoresis of error prone PCR of mdnA from 2011-06-29 and gel extraction

Repeated PCR of mdnA for phage display (strategy 1) repeated with new ordered forward primer