Team:DTU-Denmark-2/Team/Protocols

From 2011.igem.org

(Difference between revisions)

Latest revision as of 09:05, 4 October 2011

Protocols

Amplification of biobricks by PCR

List of primers for fungi and for mammalian cells

Fungal primers
Primer name	Sequence
pgpd FW	ACGTCGCUATTCCCTTGTATCTCTACACACAGG
pgpd RV	ATCGCACUGCGGTAGTGATGTCTGCTCAA
pAlc FW	ACGTCGCUCTCCCCGATGACATACAGGAGG
pAlc RV	ATCGCACUTTTGAGGCGAGGTGATAGGATTG
DMKP-P6 FW	ACGTCGCUATCTCACTCCACTAGAATTCCTGTC
DMKP-P6 RV	ATCGCACUAAATGAGTCGAGAATGGCGG
GFP-module FW	AGTGCGAUATGGTGAGCAAGGGCGAG
GFP-module RV	ATCGGAAUTTACTTGTACAGCTCGTCCATGC
GFP-GOI FW	AGTGCGAUATGGTGAGCAAGGGCGAG
GFP-GOI RV	ATCGCTCUTTACTTGTACAGCTCGTCCATGC
GFP-TS FW	AGCGCTGGUATGGTGAGCAAGGGCGAG
GFP-TS RV	ATCGGAAUTTACTTGTACAGCTCGTCCATGC
GFP-PTS1_module RV	ATCGGAAU TTACAGCTTGGA CCTTGTACAGCTCGTCCATGCC
RFP-module FW	AGTGCGAUATGGCCTCCTCCGAGGAC
RFP-module RV	ATCGGAAUTTAGGCGCCGGTGGAGTG
RFP-GOI FW	AGTGCGAUATGGCCTCCTCCGAGGAC
RFP-GOI RV	ATCGCTCUTTAGGCGCCGGTGGAGTG
RFP-TS FW	AGCGCTGGUATGGCCTCCTCCGAGGAC
RFP-TS RV	ATCGGAAUTTACTTGTACAGCTCGTCCATGC
RFP-NLS_module RV	ATCGGAAU TTAGACCTTGCGCTTTTTCTTGGG GGCGCCGGTGGAGTGG
LacZ FW	AGTGCGAUATGACCATGATTACGGATTCACT
LacZ RV	ATCGGAAUTTATTTTTGACACCAGACCAACT
trpC FW	ATTCCGAUGATCCACTTAACGTTACTGAAATCA
trpC RV	ACGCAAGUGGGCGCTTACACAGTACACGAG
PyrG FW	ACTTGCGUCGTGGAGTTACCAGTGATTGACC
PyrG RV	AGCTTAAUCTTGCTAGATGACTGGTAGGAATCT
bleR FW	ACTTGCGUATGGCCAAGTTGACCAGTG
bleR RV	AGCTTAAUTCAGTCCTGCTCCTCGGCC
hyrR FW	ACTTGCGU GCTAGTGGAGGTCAACACATCAAT
hyrR RV	AGCTTAAUCGGTCGGCATCTACTCTATTCC
argB FW	ACTTGCGUCGCGGTTTTTTGGGGTAGT
argB RV	AGCTTAAUGCCACCTACAGCCATTGCGAA
PyrG-DR FW	ACTTGCGUTGGATAACCGTATTACCGCCT
PyrG-DR RV	AGCTTAAUTGCCAAGCTTAACGCGTACC
ptrA FW	ACTTGCGUGGAGATCGTCCGCCGATG
ptrA RV	AGCTTAAUCTAGAATGCCCCACCGTTACATAC
Amp-cas FW	AGCTTAAUTTACCAATGCTTAATCAGTGAGGC
Amp-cas RV	ACTTGCGUGACGTCAGGTGGCACTTTTCG
yA FW	AGTGCGAUATGTACCTCTCCACGGTCCTCT
yA RV	ATCGCTCUCTAAGAATCCCAAACATCAACCC
MTS FW	AGTGCGAUATGTTTACAGCGGCAGCTCG
MTS RV	ACCAGCGCUCTTGCGCCGCGGAGC
T1-motni FW	ATTCCGAUGGCTCCGAGGCTACTGGAGT
T1-motni FW	ACGCAAGUGCGACGTCTGATGCCAATAT
T2-motni FW	ATTCCGAUGCGGTTTTCAAGGATAACAGAT
T2-motni RV	ACGCAAGUCATGACCCCGGATAACTTTAAAA
T3 motni FW	ATTCCGAUAAGTCTTCCGTTACCCTTGCA
T3-motni RV	ACGCAAGUTGTAATTCCTACCTACCTACCTCTT

Mammalian primers
Primer name	Sequence
PGK FW	ACGTCGCUCCGGTAGGCGCCAACCG
PGK RV	ATCGCACUGGCTGCAGGTCGAAAGGCC
SV40 (+ori) FW	ACGTCGCUCTGTGGAATGTGTGTCAGTTAGG
SV40 (+ori) RV	ATCGCACUAGCTTTTTGCAAAAGCCTAGG
CMV FW	ACGTCGCUCGATGTACGGGCCAGATATAC
CMV-RV	ATCGCACUATTTCGATAAGCCAGTAAGCAGT
eGFP+K_GOI FW	AGTGCGAUCGCCACCATGGTGAGCAA
eGFP+K_GOI RV	ATCGCTCUTTACTTGTACAGCTCGTCCATGC
Mammalian backbone pU0020 FW	ATTAAGCUAGTGAGTCGAATAAGGGCGACA
Mammalian backbone pU0020 RV	AGCGACGUGAGTCGAATAAGGGCGACACC
eGFP_module FW	AGTGCGAUCGCCACCATGGTGAGCAA
eGFP_module RV	ATCGGAAUTTACTTGTACAGCTCGTCCATGCC
eGFP+K GOI FW	AGTGCGAUCGCCACCATGGTGAGCAA
eGFP+K GOI-stop RV	ACCAGCGCUCTTGTACAGCTCGTCCATGCC
eGFP_TS FW	AGAGCGAUCGCCACCATGGTGAGCAA
eGFP_TS RV	ATCGGAAUTTACTTGTACAGCTCGTCCATGCC
YFP_module FW	AGTGCGAUCGCCACCATGGTGAGCAA
YFP_module RV	ATCGGAAUTTATCTAGATCCGGTGGATCCC
YFP+K GOI FW	AGTGCGAUCGCCACCATGGTGAGCAA
YFP+K GOI RV	ACCAGCGCU TCTAGATCCGGTGGATCCCG
YFP_TS FW	AGCGCTGGUCGCCACCATGGTGAGCAA
YFP_TS RV	ATCGGAAUTTATCTAGATCCGGTGGATCCC
CFP_module FW	AGTGCGAUCGCCACCATGGTGAGCAA
CFP_module RV	ATCGGAAUTTATCTAGATCCGGTGGATCCC
CFP+K GOI FW	AGTGCGAUCGCCACCATGGTGAGCAA
CFP+K GOI-stop RV	ACCAGCGCUTCTAGATCCGGTGGATCCCG
CFP_TS FW	AGCGCTGGUCGCCACCATGGTGAGCAA
CFP_TS RV	ATCGGAAUTTATCTAGATCCGGTGGATCCC
mCherry module FW	AGTGCGAUCGCCACCATGGTGAGCAA
mCherry module RW	ATCGGAAUCTACTTGTACAGCTCGTCCATGC
mCherry+K GOI FW	AGTGCGAUCGCCACCATGGTGAGCAA
mCherry GOI-stop RV	ACCAGCGCUCTTGTACAGCTCGTCCATGCC
mCherry_TS FW	AGCGCTGGUCGCCACCATGGTGAGCAA
mCherry_TS RV	ATCGGAAUCTACTTGTACAGCTCGTCCATGC
BGH poly A FW	ATTCCGAUCTGTGCCTTCTAGTTGCCAGC
BGA poly A RV	ACGCAAGUCCATAGAGCCCACCGCATC
SV40 pA FW	ATTCCGAUAACTTGTTTATTGCAGCTTATAATGGTTAC
SV40 pA RV	ACGCAAGUCAGACATGATAAGATACATTGATGAGTTTG
Hygromycin FW	ACTTGCGUCCAGCAGGCAGAAGTATGCA
Hygromycin RV	AGCTTAAUCAGGCTTTACACTTTATGCTTCC
Neomycin FW	ACTTGCGUCTGTGGAATGTGTGTCAGTTAGG
Neomycin RV	AGCTTAAUCAGACATGATAAGATACATTGATGAGTTTG

Copenhagen primers
Primer name	Sequence
pIPTG FW	ACGTCGCUCAATACGCAAACCGCCTCTC
pIPTG RV	ATCGCACUTGTGTGAAATTGTTATCCGCTCA
CYP79A1 FW	AGTGCGAUaaagaggagaaaATGGCTCTGTTATTAGCAGTTTTT
CYP79A1 RV	ATCGGAAUTTAGATGGAGATGGACGGGTA
CYP79B1 FW	AGTGCGAUaaagaggagaaaATGTATTTACTTACAACGCTTCAAG
CYP79B1 RV	ATCGGAAUTACTTCACTGTAGGGTAAAGATGT
2C9 FW	AGTGCGAUaaagaggagaaaATGGCTCGACAATCTTCTGGA
2C9 RV	ATCGGAAUTTAATGGTGATGGTGATGGACAG
Terminator FW	ATTCCGAUCCAGGCATCAAATAAAACGAAA
Terminator RV	ACGCAAGUTATAAACGCAGAAAGGCCCAC
Amp-cas FW	AGCTTAAUTTACCAATGCTTAATCAGTGAGGC
Amp-cas RV	ACTTGCGUGACGTCAGGTGGCACTTTTCG

PCR

PCR mix	1 x PCR mix á 50 µl
5 x HF PCR buffer	10 µl
dNTP’s 2mM	5 µl
Primer forward 10 µM	5 µl
Primer reverse 10 µM	5 µl
Phusion DNA polymerase 5u/µl	0.5 µl
DNA template	1 µl
MilliQ water	23.5 µl

Procedure

The following PCR mix components are mixed together: HF Buffer, dNTP, Phusion DNA polymerase, and MilliQ water. The DNA template and the corresponding primers are added subsequently (see Materials). Remember to multiply by the amount of PCR reactions.

50 µl PCR mix is added to each tube, and afterwards the DNA template and the corresponding primers are added to each PCR tubes. The solution is mixed well.

Often it can be advantageous to add 1 µl MgCl2 (50mM) to the reaction and reduce the volume of MilliQ water to 22.5 µl.

The following PCR program is applied, and the PCR samples are run.

PCR Programs

Temperature [°C]	Time [min]	Cycles
98	15:00
98	0:20	35
62	0:30	-
72	1:00	-
72	5:00
12	Store

For each PCR product a gel electrophoresis is made to make sure that the PCR product has the correct size. 7-10µl loading buffer is added to each 50µl PCR product and the samples are run in 2% agarose. The Gel electrophoresis were set on 75V for 30-60 minutes (according to the length of the product).

Purification of PCR Product

Materials
GFX PCR DNA and Gel band purification Kit from GE healthcare is used to purify the PCR product after gel electrophoresis.

Preparations

Ethanol is added to the Wash Buffer 1 and the label is marked. Store in airtight container.

Procedures - GE healthcare protocol

Sample Capture

A DNase-free 1,5 ml eppendorf tube is weighed, and the weight is noted.

By using long wavelength (365 nm) ultraviolet light and minimal exposure time, the sample in the gel is visualized. A clean scalpel is used to cut out an the sample from the agarose gel. The agarose gel band is placed into a DNase-free 1,5 ml eppendorf tube and weighed. The weight of the agarose band is calculated.

10 μl Capture buffer type 3 is added for each 10 mg of gel slice. Never use less than 300 μl Capture buffer type 3.

The Capture buffer type 3-sample mix is mixed by inversion and incubated at 60°C for 15–30 minutes until the agarose is completely dissolved. The sample is mixed by inversion every 3 minutes

For each purification a GFX MicroSpin column is placed into a Collection tube.

Sample Binding

The Capture buffer type 3-sample mix is centrifuged briefly to collect the liquid at the bottom of the DNase-free 1,5 ml microcentrifuge tube.

Up to 800 μl Capture buffer type 3- sample mix is transferred to the assembled GFX MicroSpin column.

The sample is incubated at room temperature for 1 minute.

The sample is centrifuged for 30 s at 16 000 × g. The flow-through is discarded.

Repeat the sample binding until all sample is loaded.

Wash and Dry

500 μl Wash buffer type 1 is added to the GFX MicroSpin column.

The sample is centrifuged at 16 000 × g for 30 seconds.

Discard the Collection tube and transfer the GFX MicroSpin column to a new DNase-free 1.5 ml eppendorf tube (supplied by user).

Elution

10–50 μl MilliQ water is added to the center of the membrane in the GFX MicroSpin column placed in a Collection tube. The sample is incubated at room temperature for 1 minute.

The GFX MicroSpin column placed in the Collection tube is centrifuged for 1 minute at 16 000 × g to recover the purified DNA.

The purified DNA is stored at -20°C.

Gel electrophoresis

Materials
Agarose
TAE Buffer (1L): ^{4.84 g Tris Base, 1.14 ml Glacial Acetic Acid, 2 ml 0.5M EDTA (pH 8.0), add water until volume is 1L}
10X Loading Buffer
DNA ladder standard
Electrophoresis chamber
Gel casting tray and combs

Procedures

1.25 g Agarose powder is measured and added to a 500 ml flask

125 ml TAE Buffer is added to the flask.

The agarose is melted in a microwave or hot water bath until the solution becomes clear.

The solution is cooled down to 50-55°C. A trick is to swirl the flask lightly to cool evenly.

20 µl of cybrsafe is added in 4-5 drops on the casting tray. The agarose gel is added and mixed evenly. The gel is left to cure, which takes 30-45 min.

The gel is placed in a electrophoresis chamber. Make sure the TAE buffer in the chamber is 2-3mm above the agarose gel.

The gel is loaded with the samples, a negative sample, and the DNA ladder.

The gel is run at 70V. The time depends on the bp length, but 30-60 min are usually good for 1000-3000bp.

The gel is visualized in a -GEL EXPOSER!-.

USER cloning

Materials

Procedures

The USER mix components are mixed (Table in materials). The PCR product must be purified before used in USER cloning

2 µl of the USER mix is transferred to PCR tubes.

The PCR products is added in equal amounts of each to a total volume of 8 µl and incubated for 40 minutes at 37°C and for 30 min at 25°C.

USER mix	1 x USER mix á 10µl
USER enzyme	1 µl
NEB (10 x diluted)	0,5 µl
BSA	0,5 µl
PCR product(s)	8 µl

Tranformation in E. coli

The preparations for the transformation can preferably be done, while the USER cloning is incubating.

Materials LB-plates with antibiotic resistance.
E. coli DHα5 cells"
Grigalsky spartula
Ethanol
USER reaction Bunsen burner

Procedures

LB- plates are taken out of the refrigerator and marked. Remember to use LB-plates with the right antibiotics.

50 µl competent E. coli DHα5 cells per USER reaction is taken from the -80C freezer and place on ice. Additionally, 1,5 ml tubes are placed on ice.

The USER reaction mix is added to the 50 µl competent E. coli cells. Mix well by pipetting.

The cells are kept on ice for 30 min.

The hot plate is set on 60C, and each transformation is heat shocked for 90 sec. The cells are put directly on ice for 2 min afterwards

Plating on LB plates.

With ampicillin resistence gene.

A Drigalski spartula is sterilized in 90% ethanol and flamed between each transformation.

The transformation mix is transferred to an LB-amp plate containing ampicillin and dispersed with the cooled drigalski.

The transformated cells are incubated over night at 37°C.

Next day; the plates are checked for visual colonies. These are used for cultivating.

Without ampicillin resistence gene

500 µl LB is added to the transformation mix and incubated for 30-60 min at RT.

The transformation mix is centrifuged for 1 min at 8000g.

The supernantant is removed except for approximately 50 µl.

The pellet is resuspended in the remaining LB.

The 50 µl of tranformatin mix is plated on the LB plate.

The transformated cells are incubated over night at 37°C.

Next day; the plates are checked for visual colonies. These are used for cultivating.

Cultivation of transformed cells

Material Liquid LB with resistance marker
tooth pick

Procedure

A couple of colonies are chosen from the LB-plate.

Each colony are transferred to 5 ml LB + resistance marker with a pipet tip.

Incubate over night at 37°C in the shaking incubator.

Purification of plasmids for fungi

Materials
The GenElute Plasmid Miniprep Kit from Sigma-Aldrich is used to isolate our plasmids to use in fungi. QIAGENs EndoFree Plasmid Maxi kit is used to purify plasmids for use in mammalian cells.

Preparation

The agents are thoroughly mixed. If any reagent forms a precipitate, warm at 55–65 °C until the precipitate dissolves. Cool to room temperature before use.

The solution is resuspended. Spin the tube of the RNase A Solution briefly to collect the solution in the bottom of the tube. Add 13 μl (for 10 prep package), 78 μl (for 70 prep package) or 500 μl (for 350 prep package) of the RNase A Solution to the Resuspension Solution prior to initial use. Store at 4 °C.

Wash solution; Dilute with 95-100% ethanol prior to initial use.

Procedure - according to the manufactures protocol.

Harvest cells by centrifugation of 5 ml of an overnight recombinant E. coli culture. The optimal volume of culture to use depends upon the plasmid and culture density. For best yields, follow the instructions in the note below. Transfer the appropriate volume of the recombinant E. coli culture to a microcentrifuge tube and pellet cells at ≥12,000 3 g for 1 minute. Discard the supernatant.

Completely resuspend the bacterial pellet with 200 μl of the Resuspension Solution. Vortex or pipette up and down to thoroughly resuspend the cells until homogeneous. Incomplete resuspension will result in poor recovery.

Lyse the resuspended cells by adding 200 μl of the Lysis Solution. Immediately mix the contents by gentle inversion (6–8 times) until the mixture becomes clear and viscous. The lyse reaction must not exceed 5 min.

Precipitate the cell debris by adding 350 μl of the Neutralization/Binding Solution. Gently invert the tube 4–6 times. Pellet the cell debris by centrifuging at ≥12,000*3 g or maximum speed for 10 minutes. Cell debris, proteins, lipids, SDS, and chromosomal DNA should fall out of solution as a cloudy, viscous precipitate.

Prepare columns
Insert a GenElute Miniprep Binding Column into a provided microcentrifuge tube, if not already assembled. Add 500 μl of the Column Preparation Solution to each miniprep column and centrifuge at ≥12,000*3 g for 30 seconds to 1 minute. Discard the flow-through liquid.

Transfer the cleared lysate from step 3 to the column prepared in step 4 and centrifuge at ≥12,000*3 g for 30 seconds to 1 minute. Discard the flow-through liquid.

Add 750 μl of the diluted Wash Solution to the column. Centrifuge at ≥12,000*3 g for 30 seconds to 1 minute. The column wash step removes residual salt and other contaminants introduced during the column load. Discard the flow-through liquid and centrifuge again at maximum speed for 1 to 2 minutes without any additional Wash Solution to remove excess ethanol.

Transfer the column to a fresh collection tube. Add 100 μl of MilliQ water to the column. Centrifuge at ≥12,000*3 g for 1 minute.
The DNA is now present in the eluate and is ready for immediate use or storage at –20 °C.

Purification of plasmids for mammalian cells

Materials
EndoFree Plasmid Maxi kit from QIAGEN was used to purify plasmids for use in mammalian cells.

Procedure (according to manufactures protocol)

Pick a single colony from a freshly streaked selective plate and inoculate a starter culture of 2–5 ml LB medium containing the appropriate selective antibiotic. Incubate for ~8 h at 37°C with vigorous shaking (~300 rpm).

Dilute the starter culture 1/500 to 1/1000 into selective LB medium. For high-copy plasmids inoculate 100 ml medium, and for low-copy plasmids, inoculate 250 ml medium. Grow at 37°C for 12–16 h with vigorous shaking (~300 rpm).

Harvest the bacterial cells by centrifugation at 6000 x g for 15 min at 4°C. Resuspend the bacterial pellet in 10 ml Buffer P1

Add 10 ml Buffer P2, mix gently but thoroughly by inverting 4–6 times, and incubate at room temperature for 5 min. The lysis reaction time must not exceed 5 min.

Add 10 ml chilled Buffer P3 to the lysate, and mix immediately but gently by inverting 4–6 times. Proceed directly to next step. Do not incubate the lysate on ice.

Pour the lysate into the barrel of the QIAfilter Cartridge. Incubate at room temperature for 10 min. Do not insert the plunger!

Remove the cap from the QIAfilter Cartridge outlet nozzle. Gently insert the plunger into the QIAfilter Maxi Cartridge and filter the cell lysate into a 50 ml tube.

Add 2.5 ml Buffer ER to the filtered lysate, mix by inverting the tube approximately 10 times, and incubate on ice for 30 min.

Equilibrate a QIAGEN-tip 500 by applying 10 ml Buffer QBT, and allow the column to empty by gravity flow.

Apply the filtered lysate from step 9 to the QIAGEN-tip and allow it to enter the resin by gravity flow.

Wash the QIAGEN-tip with 2 x 30 ml Buffer QC.

Elute DNA with 15 ml Buffer QN.

Precipitate DNA by adding 10.5 ml (0.7 volumes) room-temperature isopropanol to the eluted DNA. Mix and centrifuge immediately at ≥15,000 x g for 30 min at 4°C. Carefully decant the supernatant.

Wash DNA pellet with 5 ml of endotoxin-free room-temperature 70% ethanol (add 40 ml of 96–100% ethanol to the endotoxin-free water supplied with the kit) and centrifuge at ≥15,000 x g for 10 min. Carefully decant the supernatant without disturbing the pellet.

Air-dry the pellet for 5–10 min, and redissolve the DNA in a suitable volume of endotoxin-free Buffer TE.

To determine the yield, DNA concentration should be determined by both UV spectrophotometry and quantitative analysis on an agarose gel.

Restriction enzyme analysis

Materials

Procedure

The components for restriction analysis of the fungi plasmid are mixed. The recipe for 1 restriction analysis below.

Ingredients	Volume: 10µl
Device	5 µl
Buffer 3	3 µl
Restriction enzyme	1,5 µl
H₂O	5,5 µl

For fungal plasmides the restriction enzyme used: BgI II.

For mammalian plasmides the restriction enzyme used: ScaI.

The mixture is incubated for 1 hour and applied to gel electrophoresis

Fungi

Transformation in fungi

Genetic Transformation of filamentous fungi – protocol from Center for Microbial Biotechnology (CMB) at DTU, Author Nielsen, J. B.

Materials
Media
Minimal medium (MM) (1L): 50 mL D-glucose 20% w/V, 20 mL 50x mineral mix, 10 mL 1 M sodium nitrate, 20 g ager.
Transformation media(TM)(1L): 342.3 g Sucrose, 20 mL 50x mineral mix, 20 g agar.
Mineral Mix (1L): 26g KCL, 26g MgSO4·7H2O, 76g KH2PO4, 50 mL Trace element solution, MilliQ water to volume 1000 mL.
D-glucose 20% (0.5 L): 100g D-glucose and MilliQ water up to 500 ml.
Aspergillus protoplastationbuffer (APB): Final conc. 1.1 M MgSO4 and 10 mM Na-phosphate buffer. pH is adjusted with 2 N NaOH to 5.8.
Aspergillus transformation buffer (ATB):Final conc: 1.2 M Sorbitol; 50 mM CaCl2·2 H2O; 20 mM Tris; and 0.6 M KCl. pH is adjusted with 2 N HCl to 7.2.
PCT (200ml) - Final conc: 50% w/vol PEG 8000; 50 mM CaCl2; 20 mM Tris; and 0.6 M KCl. pH is adjusted with 2 N HCl to 7.5. Store at 4 °C.

Procedure

The host strain is grown as three-point stabs on Minimal medium plates with the require suppliants added. MM will be referred to as MM with the supplements included throughout the protocol.

Inoculation:

The conidia are harvested by adding 5 ml of MM and firmly rub with a sterile Grigalsky spatula. The conidial suspension is pipetted to a sterile 500 ml shake flask containing 100 ml MM. The cultures are incubated at 30 °C with 150 rpm of shaking over night (14-20 hours).

Mycelial harvest:

A funnel with a sterile Mira cloth (filter) is used to harvest mycelia. To remove residual glucose from mycelia the biomass are washed with Aspergillus protoplastationbuffer (APB).

The filtered biomass is transferred to a new Falcon tube with a sterile spoon.

Protoplastation:

Mycellium is resuspended in 10 ml filter-sterillized(0.45μm filters) APB containing 40 mg Glucanex/ml. The Glucanex is dissolved in APB with gentle magnetic stirring less than 100/min.

Mycelia with dissolved Glucanex are mixed at 30 °C with 150 rpm of shaking for 2-3 hours.

Protoplast solutions are diluted in APB adding up to 40 ml mark. An overlay of max. 5ml Aspergillus transformation buffer (ATB) diluted to ½x with sterile MilliQ-water is carefully placed on top of the APB.

Centrifuged at 13 min 3000 RCF in Sorvall centrifuge. Protoplates should be observed as a halo of with slurry in the interphase of the two liquids.

Withdraw of the protoplasts are done with pipette and placed in a Falcon tube.

ATB is added up to 40 ml mark. Centrifuge at 300 RCF in 13 min and supernatanted are discarded.

The protoplastes are resuspended in 1 ml ATB with a 5 ml pipette.

Genetic transformation:

Aliquotes of 50 μl are transferred to a 1.5 ml Eppendorf tube containgen 10 μl of DNA for transformation.

Protoplast and DNA are incubated at room temperature for at least 30 min.

Protoplat and DNA suspension are added to 1 ml PCT in a 15 ml tube and shake gently.

Incubate for 1-5 min at room temperature.

Dilute in 3 ml ATB. The tube is filled with molten transformation medium (TM) agar (temperature of 40-45°C) to apporeimately 12 ml. The tube is mix rapidly by inverting the tube twice.

Poure directly on pre-made TM plates and incubate at 37°C for 3-8 days.

Production of conidiospores

Materials
tooth stick
LB plates

Procedure

Gently touch the a mature colony with a tooth pick.

Hold the LB-plate upside down to avoid scattering of spores, and stab three different places.

Incubated plates at 37°C for approximately five days. After incubation spores were either harvested from the plates or they were stored in the fridge at 4°C.

Flourescence Microscopy

Materials
MM
Bleomycin
4-NQO

Procedure Cultivation for fluorescence detection was performed by collecting the conidia from plates having three point stab colonies that have grown for 4-5 days. 5ml of MM with supplements were added to the plate and conidia were rubbed off the colonies with a sterile Drigalsky spatula.

Inoculate the conidial suspension in 5ml MM in a sterile 50ml Falcon.

Add bleomycin (10mg/mL) and 4-NQO (5 mg/mL). This will cause damage to the DNA inducing gene expression

Incubated at 37 °C with 150 rpm of shaking overnight.

Fluorescence detection

Materials
Coverslide + overlay cover.
Conidia Culture.
Procedure

Take 500µL of conidia culture (ref. till protocol for det) in a tube. This has to be done after 4, 24, 48 and 120 hours .

Centrifuge the tube at 16000g for 1min and 30 sec.

Discard the supernatant.

Resolute the pellet in 5µL Milli Q water and place on slide. Place the overlay cover

Detection microscopy was performed first with DIT filter and fluorescence filter with enlargement of 10x and 100x.

To check background fluorescence, comparison of detection with yellow filter was made against detection by green and red filter.

Extraction of proteins

Materials
Z-buffer
AEBSF stock solution
Bradford Reagent
BSA
MilliQ water
Minimal media with aminoacids

Procedure
Inoculation of conidia in shaking bottle

The colonies from the three point stab are harvested by adding 2mL MilliQ water to the petri dish. The colonies are rubt with a digalski spartula.

500µl of the colony suspension is pipette into a 500mL shaking bottle with 100mL minimal media containing amino acids

Incubate in 48 hours at 37°C

Protein extract

2 mL culture are transferred from the shaking bottles to eppendorf tubes. Remember to do triple determination.

Centrifuge tubes in 1 min with 8000g

Remove the supernatant.

Transfer the mycelierne with a sterile spartula to FastPrep tubes.

250 µL Z-buffer is added to the FastPrep tubes in stink cabinet.

Add approximately 200µL of the small glass balls to the FastPrep tubes.

Add 12,5µL AEBSF stock solution.

Place the FastPrep tubes in the FastPrep machines. Let it run with max velocity for 30 sec.

Tubes are kept on ice from now on. Add 250 µL Z-buffer and mix well.

The extract is transferred by a 1000 µL pipette. Place the pipet at the bottom of the tube and transfer it to a new eppendorf tube.

Centrifuge the eppendorp tubes in 15 min at 10000g to purify the protein extract.

Transfer the supernatant to a new eppendorp tube.

Assays

Materials
Z-buffer
AEBSF stock solution
Bradford Reagent
BSA
MilliQ water
Minimal media with aminoacids
Protein extract (from above)

ß-galactosidase assay

Procedure

Add 25 µL extract and 225 µL Z-buffer to a well in a microtiter plate. Three wells per extract for triple determination.

Mix enough ONPG stock solution so 50 µL can be added to each well.

Measure OD with the computer program Gen5; Shake the plate every 30 sec to mix the solution, rest for 10 min before measuring the OD.

Bradford assay

Procedure

Add 5 µL extract and 245 µL Bradford reagent to a well in a microtiter plate. Three wells per extract for triple determination.

Make a BSA standard with concentrations between 0,1-2,0mg/mL with. See table below:

Preparation of BSA standards

Standard	µL standard	µL dH₂O	Concentration
Std 1	300 µL stock	1200µL	2 mg/ml
Std 2	200 µL stock	1000µL	1,67mg/ml
Std 3	700 µL Std 1	700µL	1 mg/ml
Std 4	700 µL Std 2	700µL	mg/ml
Std 5	700 µL Std 3	700µL	0,5 mg/ml
Std 6	700 µL Std 4	700µL	mg/ml
Std 7	700 µL Std 5	700µL	0.25mg/ml
Std 8	700 µL Std 7	700µL	0,125mg/ml
Std 9	-	700µL	0 mg/ml

Make triple determination.
Incubate at 37°C for 10 min.

Mammalian cells

Cell culture and reagents

Materials
cells: U2OS cells were kindly provided by The Danish Cancer Society. U2OS cell line is derived from the bone tissue of a patient suffering from osteosarcoma. U2OS cells show epithelial adherent morphology.

Medium:
500 ml DMEM
50 ml Fetal Calf Serum (FCS)
5 ml Penicillin
5 ml Streptomycin

Procedures

Add FCS, penicillin, and streptomycin to a new flask of DMEM. Store at 5°C.

The cells are cultivated in Dulbecco’s Modified Eagle Medium (DMEM), supplemented with Penicillin, Streptomycin, and 10 % heat-inactivated foetal calf serum (FCS). Penicillin and Streptomycin are added to prevent any microbial growth. FCS is added to supply essential non-defined components, such as serum proteins and lipids. Supplemented DMEM medium is referred to as complete DMEM throughout the report. The cells are adherent and are kept in 75 cm² culture flask until 80-100% confluency, where they are passed on to new culture flasks or cover slips.

Cultivation of cells

Materials 25 cm² culture flask
Complete DMEM

Procedures

Place the appropriate amount of EDTA-trypsin and complete DMEM in the incubator (37°C), before handling the cells (about 1-2 hours before).

The U2OS cells are kept at -80°C until defrosted gently at 37°.

Exactly when defrosted, they are mixed with 12 ml complete DMEM in the pipette.

The cell suspension is transferred to a 15 ml vial and centrifuged at 280 g for 10 minutes. The supernatant is discarded.

The cell pellet is resuspended in 5 ml complete DMEM and transferred to a 25 cm² culture flask.

The cells are kept at 37°C in a 5% CO² incubator until the following day, where they are passed on to larger culture flasks.

Passing and maintenance of U2OS cells

Materials
75 cm² culture flask:
50 ml vial
Complete DMEM medium
0.05 % EDTA-trypsin

Procedure

The appropriate amount of EDTA-trypsin and complete DMEM in the incubator (37°C), before handling the cells.

The filter of a 1 ml pipette is broken off, and the pipette is attached to the vacuum suction maschine. The medium is removed, and the pipette is put in a 50 ml vial for later use.

1 ml 0,05% EDTA-trypsin/PBS is added to wash the cells. Tilt the flask quickly, so the EDTA-trypsin covers the cells. Remove the liquid quickly.

1 ml 0.05% trypsin-EDTA/PBS is added and the flask is incubated for 3 min at 37°C and 5 % CO².

9 ml complete medium is added to inactivate the EDTA-trypsin and to wash the cells of the surface. Make sure the cells are well resuspended, before you transfer them.

2,5 ml (depends on the concentration of the cells) cell suspension is transferred to a new 75 cm² culture flask.

The cells are kept at 37°C in a 5% CO² incubator until they are 80-100% confluent. This takes about 2-3 days. Then they are passed on to a new flask or plate.

Transferring cells to coverslips

Materials
75 cm² culture flask:
50 ml vial
Complete DMEM medium
0.05 % EDTA-trypsin
6-well plate
Cover slips

Procedure

The filter of a 1 ml pipette is broken off, and the pipette is attached to the vacuum suction maschine. The medium is removed, and the pipette is put in a 50 ml vial for later use.

1,5 ml 0,05% EDTA-trypsin/PBS is added to wash the cells. Tilt the flask quickly, so the EDTA-trypsin covers the cells. Remove the liquid quickly.

1,5 ml 0.05% trypsin-EDTA/PBS is added and the flask is incubated for 3 min at 37°C and 5 % CO².

9 ml complete medium is added to inactivate the EDTA-trypsin and to wash the cells of the surface. Make sure the cells are well resuspended, before you transfer them.

Calculate the concentration of cells you want in the wells

Cover slips are placed in the bottom of a 6-well plate (2 cover slips/well). 2 ml cell suspension is added gently to each well.

The plate is placed in the incubator at 37°C and 5% CO² O/N.

Transfection of cells

Materials
Optimem
FuGENE transfection reagent
Plasmid DNA

Procedure

The LAF bench and gloves is disinfected with ethanol before and after working in the LAF bench.

46μl optimem per is transferred to a 1,5 ml eppendorf tube per tranfection.

3 μl of Fugene is mixed well with the optimem.

The tube is flicked gently to make sure that the solution is properly mixed. Incubation for 5 min at room temperature

1 μl of plasmid DNA is mixed well with the optimem/Fugene mix.

The tube is flicked gently to make sure the mixture is properly mixed.

If there is any liquid remaining on the side of the tube, the tube is centrifuged shortly.

The plasmid mixture is incubated for 15 min at 37°C.

The dish with U-2OS cells from the incubator.

The 50 μl transfection mixture is added dropwise to the 6 cm² dish containg the coverslips.

The mixture is gently mixed by rocking motion and the dish is placed back in the incubator.

Coverslips for microscopy

Materialer
PBS
MilliQ water
Formaldehyde
lint-free paper
Cover slides
Transparent nail polish

Procedure

A 10X PBS dilution is made from PBS and MilliQ water.

The coverslips are transferred to a 24-well plate (2 coverslip/well).

The coverslips are washed by adding 1 ml diluted PBS to the wells. The PBS is discarded. This is done twice

400 μl Formaldehyde is added to each well under the fume hood, and incubated for 12 min at RT. The liquid is transferred to the waste bin

The coverslips are washed 3 times with the diluted PBS.

The coverslips are dipped in MilliQ water before laid on lint-free paper for drying.

4 drops each of 4 μl Vectashield is placed on a glass slide.

When a coverslip is completely dry, it is placed on a drop of Vectashield on the glass slide. The procedure is repeated for each coverslip.

The coverslips are fixated with transparent nail polish.

@@ Line 10: / Line 10: @@
 A:visited {color:  #990000 ;text-decoration: none }
 A:hover {text-decoration: underline}
+div.text {
+   padding-right: 20px;
+   padding-left: 20px;
+   padding-top:20px;
+   padding-bottom:20px;
+}
@@ Line 31: / Line 38: @@
    font-size: 9pt;
    margin-left: 10px;
+}
+span.red {
+  color: #990000;
 }
@@ Line 37: / Line 48: @@
 </head>
 <body>
+<div class="text">
 <table cellpadding=10px>
 <th>
@@ Line 43: / Line 57: @@
 <font color=" #990000" face="arial" size="6">
 <br>
-<b>Protocols</b><br> <br> <br>
+<span class="red"><b>Protocols</b></span><br> <br> <br>
 </font>
 <div id="menu">
 <!--<span id="test">test</span>-->
 <a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Amplification of biobricks by PCR" class="h1"><b>1</b> Amplification of biobricks by PCR</a><br>
+<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#List of primers for fungi and for mammalian cells" class="h2"><b>1.1</b> List of primers for fungi and for mammalian cells</a><br>
-<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#PCR MIX" class="h2"><b>1.1</b> PCR MIX</a><br>
+<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#PCR" class="h2"><b>1.2</b> PCR </a><br>
-<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#PCR Programs" class="h2"><b>1.2</b> PCR Programs</a><br>
 <a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Purification of PCR Product" class="h2"><b>1.3</b> Purification of PCR Product</a><br>
+<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Gel electrophoresis" class="h2"><b>1.4</b> Gel electrophoresis</a><br>
 <br>
-<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Gel electrophoresis" class="h1"><b>2</b> Gel electrophoresis</a><br>
+<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#USER cloning" class="h1"><b>2</b> USER cloning</a><br>
-<br>
+<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Tranformation in <i>E. coli</i>" class="h2"><b>2.1</b> Tranformation in <i>E. coli</i></a><br>
-<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#USER cloning" class="h1"><b>3</b> USER cloning</a><br>
+<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Cultivation of transformed cells" class="h2"><b>2.2</b> Cultivation of transformed cells</a><br>
-<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Tranformation in E.coli" class="h2"><b>3.1</b> Tranformation in E.coli</a><br>
+<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Purification of plasmids for fungi" class="h2"><b>2.3</b> Purification of plasmids for fungi</a><br>
-<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Cultivation of transformed cells" class="h2"><b>3.2</b> Cultivation of transformed cells</a><br>
+<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Purification of plasmids for mammalian cells" class="h2"><b>2.4</b> Purification of plasmides for mammalian cells</a><br>
-<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Purification of plasmids" class="h2"><b>3.3</b> Purification of plasmids</a><br>
+<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Restriction enzyme analysis" class="h2"><b>2.5</b> Restriction enzyme analysis</a><br>
 <br>
-<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Fungi" class="h1"><b>4</b> Fungi</a><br>
+<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Fungi" class="h1"><b>3</b> Fungi</a><br>
-<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Transformation in fungi" class="h2"><b>4.1</b> Transformation in fungi</a><br>
+<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Transformation in fungi" class="h2"><b>3.1</b> Transformation in fungi</a><br>
+<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Production of conidiospores" class="h2"><b>3.2</b> Production of conidiospores</a><br>
+<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Flourescence Microscopy" class="h2"><b>3.3</b> Flourescence Microscopy</a><br>
+<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Fluorescence detection" class="h2"><b>3.4</b> Fluorescence detection</a><br>
+<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Extraction of proteins" class="h2"><b>3.5</b> Extraction of proteins</a><br>
+<br>
+<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Assays" class="h1"><b>4</b> Assays</a><br>
+<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#ß-galactosidase assay" class="h2"><b>4.1</b> ß-galactosidase assay</a><br>
+<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Bradford assay" class="h2"><b>4.2</b> Bradford assay</a><br>
 <br>
 <a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Mammalian cells" class="h1"><b>5</b> Mammalian cells</a><br>
 <a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Cell culture and reagents" class="h2"><b>5.1</b> Cell culture and reagents</a><br>
-<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Medium" class="h2"><b>5.2</b> Medium</a><br>
+<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Cultivation of cells" class="h2"><b>5.2</b> Cultivation of cells</a><br>
-<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Cultivation of cells" class="h2"><b>5.3</b> Cultivation of cells</a><br>
+<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Passing and maintenance of U2OS cells" class="h2"><b>5.3</b> Passing and maintenance of U2OS cells</a><br>
-<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Passing and maintenance of U2OS cells" class="h2"><b>5.4</b> Passing and maintenance of U2OS cells</a><br>
+<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Transferring cells to coverslips" class="h2"><b>5.4</b> Transferring cells to coverslips</a><br>
-<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Transferring cells to coverslips" class="h2"><b>5.5</b> Transferring cells to coverslips</a><br>
+<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Transfection of cells" class="h2"><b>5.5</b> Transfection of cells</a><br>
-<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Transfection of cells" class="h2"><b>5.6</b> Transfection of cells</a><br>
+<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Coverslips for microscopy" class="h2"><b>5.6</b> Coverslips for microscopy</a><br>
-<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Coverslides for microscopy" class="h2"><b>5.7</b> Coverslides for microscopy</a><br>
-<a href="https://2011.igem.org/Team:DTU-Denmark-2/Team/Protocols#Purifications of plasmids" class="h2"><b>5.8</b> Purification of plasmides</a><br>
+<br>
 </div>
 </td>
+</th>
 <td width="75%" height="100%" valign="top">
 <br>
 <br>
 <a name="Amplification of biobricks by PCR"></a><h2><b>Amplification of biobricks by PCR</b></h2>
+<a name="List of primers for fungi and for mammalian cells"></a><h3><b>List of primers for fungi and for mammalian cells</b></h3>
+<table border="3" bordercolor=#990000>
+  <tr>
+    <th>Fungal primers</th>
+  </tr>
+  <tr>
+    <th>Primer name </th>
+    <th>Sequence </th>
+  </tr>
+<tr>
+  <td>pgpd FW</td>
+    <td><font color=" #990000" id="red">ACGTCGCU</font>ATTCCCTTGTATCTCTACACACAGG</td>
+  </tr>
+<tr>
+    <td>pgpd RV</td>
+    <td><font color=" #990000">ATCGCACU</font>GCGGTAGTGATGTCTGCTCAA</td>
+  </tr>
+<tr>
+    <td>pAlc FW</td>
+    <td><font color=" #990000">ACGTCGCU</font>CTCCCCGATGACATACAGGAGG</td>
+  </tr>
+<tr>
+    <td>pAlc RV</td>
+    <td><font color=" #990000">ATCGCACU</font>TTTGAGGCGAGGTGATAGGATTG</td>
+  </tr><tr>
+    <td>DMKP-P6 FW</td>
+    <td><font color=" #990000">ACGTCGCU</font>ATCTCACTCCACTAGAATTCCTGTC</td>
+  </tr>
+<tr>
+    <td>DMKP-P6 RV</td>
+    <td><font color=" #990000">ATCGCACU</font>AAATGAGTCGAGAATGGCGG</td>
+  </tr>
+<tr>
+    <td>GFP-module FW</td>
+    <td><font color=" #990000">AGTGCGAU</font>ATGGTGAGCAAGGGCGAG </td>
+  </tr>
+<tr>
+    <td>GFP-module RV</td>
+    <td><font color=" #990000">ATCGGAAU</font>TTACTTGTACAGCTCGTCCATGC</td>
+  </tr>
+<tr>
+    <td>GFP-GOI FW</td>
+    <td><font color=" #990000">AGTGCGAU</font>ATGGTGAGCAAGGGCGAG</td>
+  </tr>
+<tr>
+    <td>GFP-GOI RV</td>
+    <td><font color=" #990000">ATCGCTCU</font>TTACTTGTACAGCTCGTCCATGC</td>
+  </tr>
+<tr>
+    <td>GFP-TS FW</td>
+    <td><font color=" #990000">AGCGCTGGU</font>ATGGTGAGCAAGGGCGAG</td>
+  </tr>
+<tr>
+    <td>GFP-TS RV</td>
+    <td><font color=" #990000">ATCGGAAU</font>TTACTTGTACAGCTCGTCCATGC</td>
+  </tr>
+<tr>
+    <td>GFP-PTS1_module RV</td>
+    <td><font color=" #990000">ATCGGAAU</font> <font color=" blue">TTACAGCTTGGA</font> CCTTGTACAGCTCGTCCATGCC</td>
+  </tr>
+<tr>
+    <td>RFP-module FW</td>
+    <td><font color=" #990000">AGTGCGAU</font>ATGGCCTCCTCCGAGGAC </td>
+  </tr>
+<tr>
+    <td>RFP-module RV</td>
+    <td><font color=" #990000">ATCGGAAU</font>TTAGGCGCCGGTGGAGTG</td>
+  </tr>
+<tr>
+    <td>RFP-GOI FW</td>
+    <td><font color=" #990000">AGTGCGAU</font>ATGGCCTCCTCCGAGGAC</td>
+  </tr>
+<tr>
+    <td>RFP-GOI RV</td>
+    <td><font color=" #990000">ATCGCTCU</font>TTAGGCGCCGGTGGAGTG</td>
+  </tr>
+<tr>
+    <td>RFP-TS FW</td>
+    <td><font color=" #990000">AGCGCTGGU</font>ATGGCCTCCTCCGAGGAC</td>
+  </tr>
+<tr>
+    <td>RFP-TS RV</td>
+    <td><font color=" #990000">ATCGGAAU</font>TTACTTGTACAGCTCGTCCATGC</td>
+  </tr>
+<tr>
+    <td>RFP-NLS_module RV</td>
+    <td><font color=" #990000">ATCGGAAU</font> <font color=" blue">TTAGACCTTGCGCTTTTTCTTGGG</font> GGCGCCGGTGGAGTGG</td>
+  </tr>
+<tr>
+    <td>LacZ FW</td>
+    <td><font color=" #990000">AGTGCGAU</font>ATGACCATGATTACGGATTCACT</td>
+  </tr>
+<tr>
+    <td>LacZ RV</td>
+    <td><font color=" #990000">ATCGGAAU</font>TTATTTTTGACACCAGACCAACT</td>
+  </tr>
+<tr>
+    <td>trpC FW</td>
+    <td><font color=" #990000">ATTCCGAU</font>GATCCACTTAACGTTACTGAAATCA</td>
+  </tr>
+<tr>
+    <td>trpC RV</td>
+    <td><font color=" #990000">ACGCAAGU</font>GGGCGCTTACACAGTACACGAG</td>
+  </tr>
+<tr>
+    <td>PyrG FW</td>
+    <td><font color=" #990000">ACTTGCGU</font>CGTGGAGTTACCAGTGATTGACC</td>
+  </tr>
+<tr>
+    <td>PyrG RV</td>
+    <td><font color=" #990000">AGCTTAAU</font>CTTGCTAGATGACTGGTAGGAATCT</td>
+  </tr>
+<tr>
+    <td>bleR FW</td>
+    <td><font color=" #990000">ACTTGCGU</font>ATGGCCAAGTTGACCAGTG</td>
+  </tr>
+<tr>
+    <td>bleR RV</td>
+    <td><font color=" #990000">AGCTTAAU</font>TCAGTCCTGCTCCTCGGCC</td>
+  </tr>
+<tr>
+    <td>hyrR FW</td>
+    <td><font color=" #990000"> ACTTGCGU</font> GCTAGTGGAGGTCAACACATCAAT </td>
+  </tr>
+<tr>
+    <td>hyrR RV</td>
+    <td><font color=" #990000">AGCTTAAU</font>CGGTCGGCATCTACTCTATTCC</td>
+  </tr>
+<tr>
+    <td>argB FW</td>
+    <td><font color=" #990000">ACTTGCGU</font>CGCGGTTTTTTGGGGTAGT</td>
+  </tr>
+<tr>
+    <td>argB RV</td>
+    <td><font color=" #990000">AGCTTAAU</font>GCCACCTACAGCCATTGCGAA</td>
+  </tr>
+<tr>
+    <td>PyrG-DR FW</td>
+    <td><font color=" #990000">ACTTGCGU</font>TGGATAACCGTATTACCGCCT</td>
+  </tr>
+<tr>
+    <td>PyrG-DR RV</td>
+    <td><font color=" #990000">AGCTTAAU</font>TGCCAAGCTTAACGCGTACC</td>
+  </tr>
+<tr>
+    <td>ptrA FW</td>
+    <td><font color=" #990000">ACTTGCGU</font>GGAGATCGTCCGCCGATG</td>
+  </tr>
+<tr>
+    <td>ptrA RV</td>
+    <td><font color=" #990000">AGCTTAAU</font>CTAGAATGCCCCACCGTTACATAC</td>
+  </tr>
+<tr>
+    <td>Amp-cas FW</td>
+    <td><font color=" #990000">AGCTTAAU</font>TTACCAATGCTTAATCAGTGAGGC</td>
+  </tr>
+<tr>
+    <td>Amp-cas RV</td>
+    <td><font color=" #990000">ACTTGCGU</font>GACGTCAGGTGGCACTTTTCG</td>
+  </tr>
+<tr>
+    <td>yA FW</td>
+    <td><font color=" #990000">AGTGCGAU</font>ATGTACCTCTCCACGGTCCTCT</td>
+  </tr>
+<tr>
+    <td>yA RV</td>
+    <td><font color=" #990000">ATCGCTCU</font>CTAAGAATCCCAAACATCAACCC</td>
+  </tr>
+<tr>
+    <td>MTS FW</td>
+    <td><font color=" #990000">AGTGCGAU</font>ATGTTTACAGCGGCAGCTCG</td>
+  </tr>
+<tr>
+    <td>MTS RV</td>
+    <td><font color=" #990000">ACCAGCGCU</font>CTTGCGCCGCGGAGC</td>
+  </tr>
+<tr>
+    <td> T1-motni FW</td>
+    <td><font color=" #990000">ATTCCGAU</font>GGCTCCGAGGCTACTGGAGT</td>
+  </tr>
+<tr><tr>
+    <td> T1-motni FW</td>
+    <td><font color=" #990000">ACGCAAGU</font>GCGACGTCTGATGCCAATAT</td>
+  </tr>
+<tr>
+  <tr>
+    <td> T2-motni FW</td>
+    <td><font color=" #990000">ATTCCGAU</font>GCGGTTTTCAAGGATAACAGAT</td>
+  </tr>
+<tr>
+    <td>T2-motni RV</td>
+    <td><font color=" #990000">ACGCAAGU</font>CATGACCCCGGATAACTTTAAAA</td>
+  </tr>
+<tr>
+    <td>T3 motni FW</td>
+    <td><font color=" #990000">ATTCCGAU</font>AAGTCTTCCGTTACCCTTGCA</td>
+  </tr>
+<tr>
+    <td>T3-motni RV</td>
+    <td><font color=" #990000">ACGCAAGU</font>TGTAATTCCTACCTACCTACCTCTT</td>
+  </tr>
+</table>
+<br><br>
+<table border="3" bordercolor=#990000>
+  <tr>
+    <th>Mammalian primers</th>
+  </tr>
+  <tr>
+    <th>Primer name </th>
+    <th>Sequence </th>
+  </tr>
+  <tr>
+    <td> PGK FW</td>
+    <td><font color=" #990000">ACGTCGCU</font>CCGGTAGGCGCCAACCG</td>
+  </tr>
+<tr>
+    <td>PGK RV</td>
+    <td><font color=" #990000">ATCGCACU</font>GGCTGCAGGTCGAAAGGCC</td>
+  </tr>
+<tr>
+    <td>SV40 (+ori) FW</td>
+    <td><font color=" #990000">ACGTCGCU</font>CTGTGGAATGTGTGTCAGTTAGG</td>
+  </tr>
+<tr>
+    <td>SV40 (+ori) RV</td>
+    <td><font color=" #990000">ATCGCACU</font>AGCTTTTTGCAAAAGCCTAGG</td>
+  </tr>
+<tr>
+    <td>CMV FW</td>
+    <td><font color=" #990000">ACGTCGCU</font>CGATGTACGGGCCAGATATAC</td>
+  </tr>
+<tr>
+    <td>CMV-RV</td>
+    <td><font color=" #990000">ATCGCACU</font>ATTTCGATAAGCCAGTAAGCAGT</td>
+  </tr>
+<tr>
+    <td>eGFP+K_GOI FW</td>
+    <td><font color=" #990000">AGTGCGAU</font>CGCCACCATGGTGAGCAA </td>
+  </tr>
+<tr>
+    <td>eGFP+K_GOI RV</td>
+    <td><font color=" #990000">ATCGCTCU</font>TTACTTGTACAGCTCGTCCATGC</td>
+  </tr>
+<tr>
+    <td>Mammalian backbone pU0020 FW</td>
+    <td><font color=" #990000">ATTAAGCU</font>AGTGAGTCGAATAAGGGCGACA</td>
+  </tr>
+<tr>
+    <td>Mammalian backbone pU0020 RV</td>
+    <td><font color=" #990000">AGCGACGU</font>GAGTCGAATAAGGGCGACACC</td>
+  </tr>
+<tr>
+    <td>eGFP_module FW</td>
+    <td><font color=" #990000">AGTGCGAU</font>CGCCACCATGGTGAGCAA</td>
+  </tr>
+<tr>
+    <td>eGFP_module RV</td>
+    <td><font color=" #990000">ATCGGAAU</font>TTACTTGTACAGCTCGTCCATGCC</td>
+  </tr>
+<tr>
+    <td>eGFP+K GOI FW</td>
+    <td><font color=" #990000">AGTGCGAU</font>CGCCACCATGGTGAGCAA</td>
+  </tr>
+<tr>
+    <td>eGFP+K GOI-stop RV</td>
+    <td><font color=" #990000">ACCAGCGCU</font>CTTGTACAGCTCGTCCATGCC</td>
+  </tr>
+<tr>
+    <td>eGFP_TS FW</td>
+    <td><font color=" #990000">AGAGCGAU</font>CGCCACCATGGTGAGCAA</td>
+  </tr>
+<tr>
+    <td>eGFP_TS RV</td>
+    <td><font color=" #990000">ATCGGAAU</font>TTACTTGTACAGCTCGTCCATGCC</td>
+  </tr>
+<tr>
+    <td>YFP_module FW</td>
+    <td><font color=" #990000">AGTGCGAU</font>CGCCACCATGGTGAGCAA</td>
+  </tr>
+<tr>
+    <td>YFP_module RV</td>
+    <td><font color=" #990000">ATCGGAAU</font>TTATCTAGATCCGGTGGATCCC</td>
+  </tr>
+<tr>
+    <td>YFP+K GOI FW</td>
+    <td><font color=" #990000">AGTGCGAU</font>CGCCACCATGGTGAGCAA</td>
+  </tr>
+<tr>
+    <td>YFP+K GOI RV</td>
+    <td><font color=" #990000"> ACCAGCGCU </font> TCTAGATCCGGTGGATCCCG </td>
+  </tr>
+<tr>
+    <td>YFP_TS FW</td>
+    <td><font color=" #990000">AGCGCTGGU</font>CGCCACCATGGTGAGCAA</td>
+  </tr>
+<tr>
+    <td>YFP_TS RV</td>
+    <td><font color=" #990000">ATCGGAAU</font>TTATCTAGATCCGGTGGATCCC</td>
+  </tr>
+<tr>
+    <td>CFP_module FW</td>
+    <td><font color=" #990000">AGTGCGAU</font>CGCCACCATGGTGAGCAA</td>
+  </tr>
+<tr>
+    <td>CFP_module RV</td>
+    <td><font color=" #990000">ATCGGAAU</font>TTATCTAGATCCGGTGGATCCC</td>
+  </tr>
+<tr>
+    <td>CFP+K GOI FW</td>
+    <td><font color=" #990000">AGTGCGAU</font>CGCCACCATGGTGAGCAA</td>
+  </tr>
+<tr>
+    <td>CFP+K GOI-stop RV</td>
+    <td><font color=" #990000">ACCAGCGCU</font>TCTAGATCCGGTGGATCCCG</td>
+  </tr>
+<tr>
+    <td>CFP_TS FW</td>
+    <td><font color=" #990000">AGCGCTGGU</font>CGCCACCATGGTGAGCAA</td>
+  </tr>
+<tr>
+    <td>CFP_TS RV</td>
+    <td><font color=" #990000">ATCGGAAU</font>TTATCTAGATCCGGTGGATCCC</td>
+  </tr>
+<tr>
+    <td>mCherry module FW</td>
+    <td><font color=" #990000">AGTGCGAU</font>CGCCACCATGGTGAGCAA</td>
+  </tr>
+<tr>
+    <td>mCherry module RW</td>
+    <td><font color=" #990000">ATCGGAAU</font>CTACTTGTACAGCTCGTCCATGC</td>
+  </tr>
+<tr>
+    <td>mCherry+K GOI FW</td>
+    <td><font color=" #990000">AGTGCGAU</font>CGCCACCATGGTGAGCAA</td>
+  </tr>
+<tr>
+    <td>mCherry GOI-stop RV</td>
+    <td><font color=" #990000">ACCAGCGCU</font>CTTGTACAGCTCGTCCATGCC</td>
+  </tr>
+<tr>
+    <td>mCherry_TS FW</td>
+    <td><font color=" #990000">AGCGCTGGU</font>CGCCACCATGGTGAGCAA</td>
+  </tr>
+<tr>
+    <td>mCherry_TS RV</td>
+    <td><font color=" #990000">ATCGGAAU</font>CTACTTGTACAGCTCGTCCATGC</td>
+  </tr>
+<tr>
+    <td>BGH poly A FW</td>
+    <td><font color=" #990000">ATTCCGAU</font>CTGTGCCTTCTAGTTGCCAGC</td>
+  </tr>
+<tr>
+    <td>BGA poly A RV</td>
+    <td><font color=" #990000">ACGCAAGU</font>CCATAGAGCCCACCGCATC</td>
+  </tr>
+<tr>
+    <td>SV40 pA FW</td>
+    <td><font color=" #990000">ATTCCGAU</font>AACTTGTTTATTGCAGCTTATAATGGTTAC</td>
+  </tr>
+<tr>
+    <td>SV40 pA RV</td>
+    <td><font color=" #990000">ACGCAAGU</font>CAGACATGATAAGATACATTGATGAGTTTG</td>
+  </tr>
+<tr>
+    <td>Hygromycin FW</td>
+    <td><font color=" #990000">ACTTGCGU</font>CCAGCAGGCAGAAGTATGCA</td>
+  </tr>
+<tr>
+    <td>Hygromycin RV</td>
+    <td><font color=" #990000">AGCTTAAU</font>CAGGCTTTACACTTTATGCTTCC</td>
+  </tr>
+<tr>
+    <td>Neomycin FW</td>
+    <td><font color=" #990000">ACTTGCGU</font>CTGTGGAATGTGTGTCAGTTAGG</td>
+  </tr>
+<tr>
+    <td>Neomycin RV</td>
+    <td><font color=" #990000">AGCTTAAU</font>CAGACATGATAAGATACATTGATGAGTTTG</td>
+  </tr>
+</table>
 <br>
+<table border="3" bordercolor=#990000>
+  <tr>
+    <th>Copenhagen primers</th>
+  </tr>
+  <tr>
+    <th>Primer name </th>
+    <th>Sequence </th>
+  </tr>
+<tr>
+  <td>pIPTG FW</td>
+    <td><font color=" #990000">ACGTCGCU</font>CAATACGCAAACCGCCTCTC</td>
+  </tr>
+<tr>
+    <td>pIPTG RV</td>
+    <td><font color=" #990000">ATCGCACU</font>TGTGTGAAATTGTTATCCGCTCA</td>
+  </tr>
+ <tr>
+  <td>CYP79A1 FW</td>
+    <td><font color=" #990000">AGTGCGAU</font><font color="blue">aaagaggagaaa</font>ATGGCTCTGTTATTAGCAGTTTTT</td>
+  </tr>
+<tr>
+    <td>CYP79A1 RV</td>
+    <td><font color=" #990000">ATCGGAAU</font>TTAGATGGAGATGGACGGGTA</td>
+  </tr>
+ <tr>
+  <td>CYP79B1 FW</td>
+    <td><font color=" #990000">AGTGCGAU</font><font color="blue">aaagaggagaaa</font>ATGTATTTACTTACAACGCTTCAAG</td>
+  </tr>
+<tr>
+    <td>CYP79B1 RV</td>
+    <td><font color=" #990000">ATCGGAAU</font>TACTTCACTGTAGGGTAAAGATGT</td>
+  </tr>
+<tr>
+  <td>2C9 FW</td>
+    <td><font color=" #990000">AGTGCGAU</font><font color="blue">aaagaggagaaa</font>ATGGCTCGACAATCTTCTGGA</td>
+  </tr>
+<tr>
+    <td>2C9 RV</td>
+    <td><font color=" #990000">ATCGGAAU</font>TTAATGGTGATGGTGATGGACAG</td>
+  </tr>
+<tr>
+  <td>Terminator FW</td>
+    <td><font color=" #990000">ATTCCGAU</font>CCAGGCATCAAATAAAACGAAA</td>
+  </tr>
+<tr>
+    <td>Terminator RV</td>
+    <td><font color=" #990000">ACGCAAGU</font>TATAAACGCAGAAAGGCCCAC</td>
+  </tr>
+<tr>
+  <td>Amp-cas FW</td>
+    <td><font color=" #990000">AGCTTAAU</font>TTACCAATGCTTAATCAGTGAGGC</td>
+  </tr>
+<tr>
+    <td>Amp-cas RV</td>
+    <td><font color=" #990000">ACTTGCGU</font>GACGTCAGGTGGCACTTTTCG</td>
+  </tr>
+<br><br>
+</table>
+<br><br>
-<a name="Materials - PCR MIX"></a><h4>Materials - PCR MIX</h4>
+<a name="PCR"></a><h3>PCR</h3>
 <br>
 <table border="3" bordercolor=#990000>
@@ Line 95: / Line 562: @@
    <tr>
      <th>PCR mix</th>
-     <th>1 x PCR mix á 50µl </th>
+     <th>1 x PCR mix á 50 µl </th>
    </tr>
    <tr>
-     <td> 5 x HF PCR buffer with MgCl2 or GC buffer</td>
+     <td> 5 x HF PCR buffer</td>
-     <td>10µl</td>
+     <td>10 µl</td>
    </tr>
 <tr>
      <td> dNTP’s 2mM </td>
-     <td>5µl</td>
+     <td>5 µl</td>
    </tr>
 <tr>
      <td> Primer forward 10 µM</td>
-     <td>4µl</td>
+     <td>5 µl</td>
    </tr>
 <tr>
      <td> Primer reverse 10 µM</td>
-     <td>4µl</td>
+     <td>5 µl</td>
    </tr>
 <tr>
      <td> Phusion DNA polymerase 5u/µl</td>
-     <td>0.3µl</td>
+     <td>0.5 µl</td>
    </tr>
 <tr>
      <td> DNA template </td>
-     <td>0.5µl</td>
+     <td>1 µl</td>
    </tr>
 <tr>
      <td> MilliQ water</td>
-     <td>26.20µl</td>
+     <td>23.5 µl</td>
    </tr>
 </table>
 <br>
-<big><b> Procedures </b></big><br>
+<b><big>Procedure</big></b><br><br>
-<li>Start by mixing the receipt of PCR mix (cf. Materials) and remember to multiply by the amount of PCR reactions. Do not add DNA template to the PCR mix. </li>
+<li>The following PCR mix components are mixed together: HF Buffer, dNTP, Phusion DNA polymerase, and MilliQ water. The DNA template and the corresponding primers are added subsequently (see Materials).
-<li>Add the DNA template to the PCR tubes and add 50 µl PCR mix to each tube.</li>
+Remember to multiply by the amount of PCR reactions. </li>
-<li>After mixing the DNA template and PCR mix, the PCR mixture has to be run in the following PCR program. </li>
+<li>50 µl PCR mix is added to each tube, and afterwards the DNA template and the corresponding primers are added to each PCR tubes. The solution is mixed well.</li>
+<li>Often it can be advantageous to add 1 µl MgCl2 (50mM) to the reaction and reduce the volume of MilliQ water to 22.5 µl.
+<li>The following PCR program is applied, and the PCR samples are run. </li>
+<br>
 <a name="PCR Programs"></a><h3>PCR Programs</h3>
 <table border="3" bordercolor=#990000>
@@ Line 142: / Line 611: @@
    <tr>
      <td>98</td>
-     <td>2:00</td>
+     <td>15:00</td>
 <td></td>
    </tr>
 <tr>
      <td> 98</td>
-     <td>0:10</td>
+     <td>0:20</td>
      <td>35</td>
    </tr>
 <tr>
-     <td>59</td>
+     <td>62</td>
      <td>0:30</td>
      <td>-</td>
@@ Line 157: / Line 626: @@
 <tr>
      <td> 72</td>
-     <td>3:00</td>
+     <td>1:00</td>
      <td>-</td>
    </tr>
@@ Line 173: / Line 642: @@
 </table>
 <br>
-To check whether the PCR was succesful, gel electrophoresis was run on each PCR product.
+For each PCR product a gel electrophoresis is made to make sure that the PCR product has the correct size.
-To check the PCR reactions were correct, all PCR samples were run on a Gel electrophoresis. All PCR reactions of 50µl were added 7-10µl loading buffer and run in 2% agarose. The Gel electrophoresis was set the volt to 75V and time after length but between 30-60 minutes.
+-10µl loading buffer is added to each 50µl PCR product and the samples are run in 2% agarose. The Gel electrophoresis were set on 75V for 30-60 minutes (according to the length of the product).
 <br><br>
 <a name="Purification of PCR Product"></a><h3>Purification of PCR Product</h3>
 <big><b>Materials</b></big><br>
-GFX PCR DNA and Gel band purification Kit from GE healthcare was used to purify the PCR product after gel electrophoresis.
+GFX PCR DNA and Gel band purification Kit from GE healthcare is used to purify the PCR product after gel electrophoresis.
 <br><br>
 <big><b>Preparations</b></big><br>
-<li> Wash buffer 1; Add ethanol to the buffer and mark the label. Store in airtight container.</li>
+<li>Ethanol is added to the Wash Buffer 1 and the label is marked. Store in airtight container.</li>
 <br>
 <big><b>Procedures - GE healthcare protocol</b></big><br><br>
 <b>Sample Capture </b><br>
-<li> Weigh a DNase-free 1,5 ml microcentrifuge tube and record the weight.</li>
+<li> A DNase-free 1,5 ml eppendorf tube is weighed, and the weight is noted.</li>
-<li> Using a clean scalpel, long wavelength (365 nm) ultraviolet light and minimal exposure time, cut out an agarose band containing the sample of interest. Place agarose gel band into a DNase-free 1,5 ml microcentrifuge tube. </li>
+<li> By using long wavelength (365 nm) ultraviolet light and minimal exposure time, the sample in the gel is visualized. A clean scalpel is used to cut out an the sample from the agarose gel. The agarose gel band is placed into a DNase-free 1,5 ml eppendorf tube and weighed. The weight of the agarose band is calculated.</li>
-<li> Weigh the microcentrifuge tube plus agarose band and calculate the weight of the agarose slice </li>
+<li> 10 μl Capture buffer type 3 is added for each 10 mg of gel slice. Never use less than 300 μl Capture buffer type 3.</li>
-<li> Add 10 μl Capture buffer type 3 for each 10 mg of gel slice, for example, add 300 μl Capture buffer type 3 to each 300 mg gel slice. Never use less than 300 μl Capture buffer type 3.</li>
+<li> The Capture buffer type 3-sample mix is mixed by inversion and incubated at 60°C for 15–30 minutes until the agarose is completely dissolved. The sample is mixed by inversion every 3 minutes</li>
-<li> Mix by inversion and incubate at 60°C for 15–30 minutes until the agarose is completely dissolved. Mix by inversion every 3 minutes</li>
+<li> For each purification a GFX MicroSpin column is placed into a Collection tube. </li>
-<li> For each purification that is to be performed, place one GFX MicroSpin column into one Collection tube. </li>
 <br>
 <b>Sample Binding</b><br>
-<li> Centrifuge Capture buffer type 3-sample mix briefly to collect the liquid at the bottom of the DNase-free 1,5 ml microcentrifuge tube.</li>
+<li> The Capture buffer type 3-sample mix is centrifuged briefly to collect the liquid at the bottom of the DNase-free 1,5 ml microcentrifuge tube.</li>
-<li> Transfer up to 800 μl Capture buffer type 3- sample mix onto the assembled GFX MicroSpin column and Collection tube.</li>
+<li> Up to 800 μl Capture buffer type 3- sample mix is transferred to the assembled GFX MicroSpin column.</li>
-<li> Incubate at room temperature for 1 minute. </li>
+<li> The sample is incubated at room temperature for 1 minute. </li>
-<li> Spin the assembled column and Collection tube at 16 000 × g for 30 seconds. </li>
+<li> The sample is centrifuged for 30 s at 16 000 × g. The flow-through is discarded. </li>
-<li> Discard the flow through by emptying the Collection tube. Place the GFX MicroSpin column back inside the Collection tube. </li>
+<li> Repeat the sample binding until all sample is loaded. </li><br>
-<li> Repeat Sample Binding steps b. to e. as necessary until all sample is loaded. </li><br>
 <b>Wash and Dry</b><br>
-<li> Add 500 μl Wash buffer type 1	to the GFX MicroSpin column. </li>
+<li> 500 μl Wash buffer type 1 is added to the GFX MicroSpin column. </li>
-<li> Spin the assembled column and Collection tube at 16 000 × g for 30 seconds.</li>
+<li> The sample is centrifuged at 16 000 × g for 30 seconds.</li>
-<li> Discard the Collection tube and transfer the GFX MicroSpin column to a <b>fresh</b> DNase-free 1.5 ml microcentrifuge tube (supplied by user). </li><br>
+<li> Discard the Collection tube and transfer the GFX MicroSpin column to a new DNase-free 1.5 ml eppendorf tube (supplied by user). </li><br>
 <b>Elution</b><br>
-<li> Add 10–50 μl MilliQ water to the center of the membrane in the assembled GFX MicroSpin column and sample Collection tube. </li>
+<li> 10–50 μl MilliQ water is added to the center of the membrane in the GFX MicroSpin column placed in a Collection tube. The sample is incubated at room temperature for 1 minute. </li>
-<li> Incubate the assembled GFX MicroSpin column and sample Collection tube at room temperature for 1 minute. </li>
+<li> The GFX MicroSpin column placed in the Collection tube is centrifuged for 1 minute at 16 000 × g to recover the purified DNA. </li>
-<li> Spin the assembled column and sample Collection tube at 16 000 × g for 1 minute to recover the purified DNA. </li>
+<li> The purified DNA is stored at -20°C. </li>
-<li> Proceed to downstream application. Store the purified DNA at -20°C. </li>
 <br>
-<a name="Gel electrophoresis"></a><h2><b>Gel electrophoresis</b></h2>
+<a name="Gel electrophoresis"></a><h3><b>Gel electrophoresis</b></h3>
 <br>
@@ Line 219: / Line 685: @@
 Agarose<br>
-TAE Buffer (1L): <SUP>4.84 g Tris Base, 1.14 ml Glacial Acetic Acid, 2 ml 0.5M EDTA (pH 8.0), bring the total volume up to with water</SUP><br>
+TAE Buffer (1L): <SUP>4.84 g Tris Base, 1.14 ml Glacial Acetic Acid, 2 ml 0.5M EDTA (pH 8.0), add water until volume is 1L</SUP><br>
-Sample Loading Buffer<br>
+X Loading Buffer<br>
 DNA ladder standard<br>
 Electrophoresis chamber<br>
@@ Line 228: / Line 694: @@
 <big><b> Procedures </b></big><br>
-<li>Measure 1.25 g Agarose powder and add it to a 500 ml flask</li>
+<li>1.25 g Agarose powder is measured and added to a 500 ml flask</li>
-<li>Add 125 ml TAE Buffer to the flask.  </li>
+<li>125 ml TAE Buffer is added to the flask.  </li>
-<li>Melt the agarose in a microwave or hot water bath until the solution becomes clear.</li>
+<li>The agarose is melted in a microwave or hot water bath until the solution becomes clear.</li>
-<li>Let the solution cool to about 50-55°C, swirling the flask occasionally to cool evenly.  </li>
+<li>The solution is cooled down to 50-55°C. A trick is to swirl the flask lightly to cool evenly.  </li>
+<li> 20 µl of cybrsafe is added in 4-5 drops on the casting tray. The agarose gel is added and mixed evenly. The gel is left to cure, which takes 30-45 min. </li>
-<li> Place 20 µl of cybrsafe in 4-5 drops on the casting tray. Add agarose gel and mix until even. Let the gel cure for 30-45 min. </li>
+<li> The gel is placed in a electrophoresis chamber. Make sure the TAE buffer in the chamber is 2-3mm above the agarose gel.</li>
-<li> Place the gel in a electrophoresis chamber. Make sure the TAE buffer in the chamber is 2-3mm above the agarose gel.</li>
+<li>The gel is loaded with the samples, a negative sample, and the DNA ladder.</li>
-<li> On a piece of parafilm, mix 1 µl of PCR product with 3 µl of loading buffer.</li>
+<li> The gel is run at 70V. The time depends on the bp length, but 30-60 min are usually good for 1000-3000bp.</li>
-<li>Load the gel with the samples, a negative, and DNA ladder.</li>
+<li> The gel is visualized in a <b>-GEL EXPOSER!-.</b>
-<li> Run the gel at 70V. The time is depending on the bp length, but 30-60 min are usually good for 1000-3000bp.</li>
-<li> Visualise the gel in a <b>-GEL EXPOSER!-.</b>
 <br><br>
 <a name="USER cloning"></a><h2><b>USER cloning</b></h2>
+<a name="Materials"></a><h3>Materials</h3>
 <br>
-<a name="Materials - USER mix"></a><h4>Materials - USER mix</h4>
+<big><b>Procedures </b></big>
+<li> The USER mix components are mixed (Table in materials). The PCR product must be purified before used in USER cloning</li>
+<li> 2 µl of the USER mix is transferred to PCR tubes.</li>
+<li> The PCR products is added in equal amounts of each to a total volume of 8 µl and incubated for 40 minutes at 37°C and for 30 min at 25°C.</li>
 <br>
 <table border="3" bordercolor=#990000>
@@ Line 265: / Line 734: @@
    </tr>
    <tr>
-     <td> PCR product</td>
+     <td> PCR product(s)</td>
      <td> 8 µl</td>
    </tr>
 </table>
 <br>
-<big><b>Procedures </b></big>
-<li>Start mixing the USER mix (Table in materials.) Muliplying by the number of USER-clonings. PCR product must not be master USER mix.</li>
-<li> Transfer 2 µl of the USER mix to PCR tubes.</li>
-<li> Add the PCD products in an amount equal to 8µl for all components. </li>
-<li>Incubate for 37°C for 40 min and 30 min at 25°C.</li>
-<br><br>
-<a name="Tranformation in E.coli"></a><h3>Tranformation in E.coli</h3>
+<a name="Tranformation in <i>E. coli</i>"></a><h3>Tranformation in <i>E. coli</i></h3>
-The preparations for the transformation can preferably be done while the USER cloning is incubating.
+The preparations for the transformation can preferably be done, while the USER cloning is incubating.
 <br><br>
 <big><b>Materials</b></big>
 LB-plates with antibiotic resistance.<br>
-''E. coli DHα5'' cells"<br>
+<i>E. coli DHα5</i> cells"<br>
-Digalski spartula<br>
+Grigalsky spartula<br>
 Ethanol <br>
+USER reaction
 Bunsen burner <br><br>
 <big><b>Procedures</b></big>
-<li> Take LB- plates out of the refrigerator and mark them. Remember to use LB-plates with the right antibiotic. </li>
+<li> LB- plates are taken out of the refrigerator and marked. Remember to use LB-plates with the right antibiotics. </li>
-<li> Take 50 µl competent ''E. coli DHα5'' cells per USER reaction, from the -80 freezer and place on ice. Additionally, place 1,5 ml tubes on ice.</li>
+<li> 50 µl competent <i>E. coli DHα5</i> cells per USER reaction is taken from the -80C freezer and place on ice. Additionally, 1,5 ml tubes are placed on ice.</li>
-<li> Add all USER reaction to the 50µl tube with the competent ''E. coli'' cells. Mix well by pipetting. </li>
+<li> The USER reaction mix is added to the 50 µl competent <i>E. coli</i> cells. Mix well by pipetting. </li>
-<li> Keep cells on ice for 30 min. </li>
+<li> The cells are kept on ice for 30 min. </li>
-<li> Turn on the hot plate at 60°C. </li>
+<li> The hot plate is set on 60C, and each transformation is heat shocked for 90 sec. The cells are put directly on ice for 2 min afterwards</li>
-<li> Heat chock each transformation for 90 sec. Afterward, put directly on ice for 2 min</li>
+<li><small><dl><dt><b> Plating on LB plates. </b></small></li>
-<li><small><dl><dt><b> Plating of bacteria on LB-plates. </b></small></li>
+                       <dt><small> With ampicillin resistence gene.</small></dd>
-                       <dd><li> Bacteria backbone with amp resistence gene.</li> </dd>
+                       <dd><li> A Drigalski spartula is sterilized in 90% ethanol and flamed between each transformation.</li></dd> <dd><li>The transformation mix is transferred to an LB-amp plate containing ampicillin and dispersed with the cooled drigalski.</li> </dd>
-                       <dd> Sterilize a Drigalski spartula in 90% ethanol and flame between each transformation. Plate all the transformation mix out on the LB-amp plate and disperse with the cooled drigalski.
+<dd><li>The transformated cells are incubated over night at 37°C. </li></dd>
-                      <dt><li><small> Bacteria backbone without amp resistence gene</small></li></dd>
+<dd><li>Next day; the plates are checked for visual colonies. These are used for cultivating. </li></dd>
-                       <dd>-Add  500 µl LB to the transformation mix. </dd>
+ <br></dl>
-                       <dd>-Incubate for 30-60 min at RT. </dd>
+                       <dt><small> Without ampicillin resistence gene</small></dd>
-                       <dd>-Spin the transformation mix down. </dd>
+                       <dd><li>500 µl LB is added to the transformation mix and incubated for 30-60 min at RT. </dd>
-                       <dd>-Remove the supernantant until approximately 50 µl are left.</dd>
+                       <dd><li>The transformation mix is centrifuged for 1 min at 8000g. </dd>
-                       <dd>-Resuspend the pellet in the remaining LB. </dd>
+                       <dd><li>The supernantant is removed except for approximately 50 µl.<dd></li>
-                       <dd>-Plate the 50 µl of tranformatin mix in the same way as described above, but on LB plate with the specific resistance gene.</dd>
+                       <dd><li>The pellet is resuspended in the remaining LB. </dd>
-<li> Incubate over night at 37°C. </li>
+                       <dd><li>The 50 µl of tranformatin mix is plated on the LB plate.<dd></li>
-<li> Next day; Check for visual colonies and use them for cultivating. </li>
+<li> The transformated cells are incubated over night at 37°C. </li>
+<li> Next day; the plates are checked for visual colonies. These are used for cultivating. </li>
   <br></dl>
@@ Line 315: / Line 779: @@
 tooth pick<br><br>
-<big><b>Procedures</b></big>
+<big><b>Procedure</b></big>
-<li> Choose a couple of colonies from the LB-plate. </li>
+<li> A couple of colonies are chosen from the LB-plate. </li>
 <li> Each colony are transferred to 5 ml LB + resistance marker with a pipet tip.</li>
 <li> Incubate over night at 37°C in the shaking incubator. </li>
+<br>
 <br>
+<a name="Purification of plasmids for fungi"></a><h3>Purification of plasmids for fungi</h3>
-<a name="Purification of plasmids"></a><h3>Purification of plasmids</h3>
 <br>
 <big><b>Materials</b></big><br>
-The GenElute Plasmid Miniprep Kit from Sigma-Aldrich was used to isolate our plasmids to use in fungi while QIAGENs EndoFree Plasmid Maxi kit was used to purify plasmids for use in mammalian cells.
+The GenElute Plasmid Miniprep Kit from Sigma-Aldrich is used to isolate our plasmids to use in fungi. QIAGENs EndoFree Plasmid Maxi kit is used to purify plasmids for use in mammalian cells.
 <br><br>
 <big><b>Preparation</b></big><br>
-<li> Thoroughly mix agents; Examine reagents for precipitation. If any reagent forms a precipitate, warm at 55–65 °C until the precipitate dissolves and allow to cool to room temperature before use. </li>
+<li> The agents are thoroughly mixed. If any reagent forms a precipitate, warm at 55–65 °C until the precipitate dissolves. Cool to room temperature before use. </li>
-<li> Resuspend Solution; Spin the tube of the RNase A Solution briefly to collect the solution in the bottom of the tube. Add 13 μl (for 10 prep package), 78 μl (for 70 prep package) or 500 μl (for 350 prep package) of the RNase A Solution to the Resuspension Solution prior to initial use. Store at 4 °C.</li>
+<li> The solution is resuspended. Spin the tube of the RNase A Solution briefly to collect the solution in the bottom of the tube. Add 13 μl (for 10 prep package), 78 μl (for 70 prep package) or 500 μl (for 350 prep package) of the RNase A Solution to the Resuspension Solution prior to initial use. Store at 4 °C.</li>
 <li> Wash solution; Dilute with 95-100% ethanol prior to initial use. <br><br>
-<big><b>Procedures - Sigma-Aldrich protocol (use in fungi).</b></big><br>
+<big><b>Procedure - according to the manufactures protocol.</b></big><br>
-<b> Harvest cells: </b>
+<li> Harvest cells by centrifugation of 5 ml of an overnight recombinant <i>E. coli</i> culture. The optimal volume of culture to use depends upon the plasmid and culture density. For best yields, follow the instructions in the note below. Transfer the appropriate volume of the recombinant <i>E. coli</i> culture to a microcentrifuge tube and pellet cells at ≥12,000 3 g for 1 minute. Discard the supernatant.</li>
-Pellet 1–5 ml of an overnight recombinant E. coli culture by centrifugation. The optimal volume of culture to use depends upon the plasmid and culture density. For best yields, follow the instructions in the note below. Transfer the appropriate volume of the recombinant E. coli culture to a microcentrifuge tube and pellet cells at ;12,000 3 g for 1 minute. Discard the supernatant.
-<br> <br>
+<li>Completely resuspend the bacterial pellet with 200 μl of the Resuspension Solution. Vortex or pipette up and down to thoroughly resuspend the cells until homogeneous. Incomplete resuspension will result in poor recovery.</li>
-<b> Resuspend cells: </b>
-Completely resuspend the bacterial pellet with 200 μl of the Resuspension Solution. Vortex or pipette up and down to thoroughly resuspend the cells until homogeneous. Incomplete resuspension will result in poor recovery.
+<li>Lyse the resuspended cells by adding 200 μl of the Lysis Solution. Immediately mix the contents by gentle inversion (6–8 times) until the mixture becomes clear and viscous. The lyse reaction must not exceed 5 min.</li>
-<br><br>
-<b> Lyse cells:</b>
+<li>Precipitate the cell debris by adding 350 μl of the Neutralization/Binding Solution. Gently invert the tube 4–6 times. Pellet the cell debris by centrifuging at ≥12,000*3 g or maximum speed for 10 minutes. Cell debris, proteins, lipids, SDS, and chromosomal DNA should fall out of solution as a cloudy, viscous precipitate.</li>
-Lyse the resuspended cells by adding 200 μl of the Lysis Solution. Immediately mix the contents by gentle inversion (6–8 times) until the mixture becomes clear and viscous. The lyse reaction must not exceed 5 min.
-<br><br>
+<li>Prepare columns<br>
-<b> Neutralize:</b>
+Insert a GenElute Miniprep Binding Column into a provided microcentrifuge tube, if not already assembled. Add 500 μl of the Column Preparation Solution to each miniprep column and centrifuge at ≥12,000*3 g for 30 seconds to 1 minute. Discard the flow-through liquid.</li>
-Precipitate the cell debris by adding 350 μl of the Neutralization/Binding Solution. Gently invert the tube 4–6 times. Pellet the cell debris by centrifuging at ≥12,000*3 g or maximum speed for 10 minutes. Cell debris, proteins, lipids, SDS, and chromosomal DNA should fall out of solution as a cloudy, viscous precipitate.
-<br><br>
+<li>Transfer the cleared lysate from step 3 to the column prepared in step 4 and centrifuge at ≥12,000*3 g for 30 seconds to 1 minute. Discard the flow-through liquid.</li>
-<b> Prepare columns: </b>
-Insert a GenElute Miniprep Binding Column into a provided microcentrifuge tube, if not already assembled. Add 500 μl of the Column Preparation Solution to each miniprep column and centrifuge at ≥12,000*3 g for 30 seconds to 1 minute. Discard the flow-through liquid.
+<li>Add 750 μl of the diluted Wash Solution to the column. Centrifuge at ≥12,000*3 g for 30 seconds to 1 minute. The column wash step removes residual salt and other contaminants introduced during the column load. Discard the flow-through liquid and centrifuge again at maximum speed for 1 to 2 minutes without any additional Wash Solution to remove excess ethanol.</li>
+<li>Transfer the column to a fresh collection tube. Add 100 μl of MilliQ water to the column. Centrifuge at ≥12,000*3 g for 1 minute. <br>The DNA is now present in the eluate and is ready for immediate use or storage at –20 °C.</li>
+<br>
+<br>
+<a name="Purification of plasmids for mammalian cells"></a><h3>Purification of plasmids for mammalian cells</h3>
+<br>
+<big><b>Materials</b></big><br>
+EndoFree Plasmid Maxi kit from QIAGEN was used to purify plasmids for use in mammalian cells. <br><br>
+<big><b>Procedure (according to manufactures protocol)</b></big><br>
+<li> Pick a single colony from a freshly streaked selective plate and inoculate a starter culture of 2–5 ml LB medium containing the appropriate selective antibiotic. Incubate for ~8 h at 37°C with vigorous shaking (~300 rpm). </li>
+<li> Dilute the starter culture 1/500 to 1/1000 into selective LB medium. For high-copy plasmids inoculate 100 ml medium, and for low-copy plasmids, inoculate 250 ml medium. Grow at 37°C for 12–16 h with vigorous shaking (~300 rpm). </li>
+<li> Harvest the bacterial cells by centrifugation at 6000 x g for 15 min at 4°C. Resuspend the bacterial pellet in 10 ml Buffer P1 </li>
+<li> Add 10 ml Buffer P2, mix gently but thoroughly by inverting 4–6 times, and incubate at room temperature for 5 min. The lysis reaction time must not exceed 5 min. </li>
+<li>Add 10 ml chilled Buffer P3 to the lysate, and mix immediately but gently by inverting 4–6 times. Proceed directly to next step. Do not incubate the lysate on ice. </li>
+<li>Pour the lysate into the barrel of the QIAfilter Cartridge. Incubate at room temperature for 10 min. Do not insert the plunger! </li>
+<li>Remove the cap from the QIAfilter Cartridge outlet nozzle. Gently insert the plunger into the QIAfilter Maxi Cartridge and filter the cell lysate into a 50 ml tube. </li>
+<li>Add 2.5 ml Buffer ER to the filtered lysate, mix by inverting the tube approximately 10 times, and incubate on ice for 30 min. </li>
+<li>Equilibrate a QIAGEN-tip 500 by applying 10 ml Buffer QBT, and allow the column to empty by gravity flow. </li>
+<li>Apply the filtered lysate from step 9 to the QIAGEN-tip and allow it to enter the resin by gravity flow. </li>
+<li>Wash the QIAGEN-tip with 2 x 30 ml Buffer QC. </li>
+<li>Elute DNA with 15 ml Buffer QN. </li>
+<li>Precipitate DNA by adding 10.5 ml (0.7 volumes) room-temperature isopropanol to the eluted DNA. Mix and centrifuge immediately at ≥15,000 x g for 30 min at 4°C. Carefully decant the supernatant. </li>
+<li>Wash DNA pellet with 5 ml of endotoxin-free room-temperature 70% ethanol (add 40 ml of 96–100% ethanol to the endotoxin-free water supplied with the kit) and centrifuge at ≥15,000 x g for 10 min. Carefully decant the supernatant without disturbing the pellet. </li>
+<li>Air-dry the pellet for 5–10 min, and redissolve the DNA in a suitable volume of endotoxin-free Buffer TE.</li>
+To determine the yield, DNA concentration should be determined by both UV spectrophotometry and quantitative analysis on an agarose gel.
+<br>
+<a name="Restriction enzyme analysis"></a><h3>Restriction enzyme analysis</h3>
+<a name="Materials "></a><h4>Materials </h4>
+<b><big>Procedure</big></b><br>
+<li> The components for restriction analysis of the fungi plasmid are mixed. The recipe for 1 restriction analysis below. </li><br>
+<table border="3" bordercolor=#990000>
+  <tr>
+    <th>Ingredients </th>
+    <th>Volume: 10µl </th>
+  </tr>
+  <tr>
+    <td> Device</td>
+    <td>5 µl</td>
+  </tr>
+  <tr>
+    <td>Buffer 3</td>
+    <td>3 µl </td>
+  </tr>
+  <tr>
+    <td>Restriction enzyme </td>
+    <td>1,5 µl</td>
+  </tr>
+  <tr>
+    <td> H<SUB>2</SUB>O</td>
+    <td> 5,5 µl</td>
+  </tr>
+</table>
+<br>
+<li>For fungal plasmides the restriction enzyme used: BgI II. </li>
+<li>For mammalian plasmides the restriction enzyme used: ScaI. </li>
 <br><br>
-<b> Load cleared lysate: </b>
+<li> The mixture is incubated for 1 hour and applied to gel electrophoresis</li>
-Transfer the cleared lysate from step 3 to the column prepared in step 4 and centrifuge at ≥12,000*3 g for 30 seconds to 1 minute. Discard the flow-through liquid.
-<br><br>
-<b> Wash column:</b>
-Add 750 μl of the diluted Wash Solution to the column. Centrifuge at ≥12,000*3 g for 30 seconds to 1 minute. The column wash step removes residual salt and other contaminants introduced during the column load. Discard the flow-through liquid and centrifuge again at maximum speed for 1 to 2 minutes without any additional Wash Solution to remove excess ethanol.
-<br><br>
-<b> Elute DNA:</b>
-Transfer the column to a fresh collection tube. Add 100 μl of MilliQ water to the column. Centrifuge at ≥12,000*3 g for 1 minute. <br>The DNA is now present in the eluate and is ready for immediate use or storage at –20 °C.
 <br><br>
@@ Line 366: / Line 884: @@
 <br>
 <br>
-<big><b>Materials</b></big>
+<big><b>Materials</b></big><br>
 <b>Media</b><br>
 Minimal medium (MM) (1L): <small>50 mL D-glucose 20% w/V, 20 mL 50x mineral mix, 10 mL 1 M sodium nitrate, 20 g ager.</small><br>
@@ Line 372: / Line 890: @@
 Transformation media(TM)(1L): <small> 342.3 g Sucrose, 20 mL 50x mineral mix, 20 g agar.</small><br>
-Mineral Mix (1L):<small> 26g KCL, 26g MgSO4·7H2O, 76g KH2PO4, 50 mL Trace element solution, MIlli-Q water to volume 1000 mL.</small><br>
+Mineral Mix (1L):<small> 26g KCL, 26g MgSO4·7H2O, 76g KH2PO4, 50 mL Trace element solution, MilliQ water to volume 1000 mL.</small><br>
 D-glucose 20% (0.5 L): <small> 100g D-glucose and MilliQ water up to 500 ml.</small><br>
@@ Line 382: / Line 900: @@
 PCT (200ml) - Final conc: 50% w/vol PEG 8000; <small>50 mM CaCl2; 20 mM Tris; and 0.6 M KCl. pH is adjusted with 2 N HCl to 7.5. Store at 4 °C.</small><br><br>
-<big><b>Procedures</b></big>
+<big><b>Procedure</b></big>
-<b>Initiation:</b>
+<br>
-<li>The host strain is grown as three-point stabs on Minimal medium plates with the require suppliants added. MM will for convenience throughout the protocol refer to MM with the supplements included.</li>
+<li>The host strain is grown as three-point stabs on Minimal medium plates with the require suppliants added. MM will be referred to as MM with the supplements included throughout the protocol.</li>
 <br>
 <b>Inoculation:</b>
-<li>The conidia are harvest by adding 5 ml of MM and firmly rub with a sterile Drigalsky spatula. The conidial suspension is pipette to a sterile 500 ml shake flask containing 100 ml MM. The cultures are incubated at 30 °C with 150 rpm of shaking over night (14-20 hours).</li>
+<li>The conidia are harvested by adding 5 ml of MM and firmly rub with a sterile Grigalsky spatula. The conidial suspension is pipetted to a sterile 500 ml shake flask containing 100 ml MM. The cultures are incubated at 30 °C with 150 rpm of shaking over night (14-20 hours).</li>
 <br>
 <b>Mycelial harvest:</b>
-<li>A funnel with a sterile Mira cloth (filter) is used to harvest mycelia. To remove residual glucose from mycelia the biomass are wash with Aspergillus protoplastationbuffer (APB). </li>
+<li>A funnel with a sterile Mira cloth (filter) is used to harvest mycelia. To remove residual glucose from mycelia the biomass are washed with Aspergillus protoplastationbuffer (APB). </li>
 <li>The filtered biomass is transferred to a new Falcon tube with a sterile spoon.</li>
 <br>
 <b>Protoplastation:</b>
-<li> Mycellium is resuspenden in 10 ml filter-sterillized(0.45μm filters) APB containing 40 mg Glucanex/ml. The Glucanex is dissolved in APB with gentle magnetic stirring less than 100/min.</li>
+<li> Mycellium is resuspended in 10 ml filter-sterillized(0.45μm filters) APB containing 40 mg Glucanex/ml. The Glucanex is dissolved in APB with gentle magnetic stirring less than 100/min.</li>
 <li> Mycelia with dissolved Glucanex are mixed at 30 °C with 150 rpm of shaking for 2-3 hours.</li>
-<li>Portoplast solutions are diluted in APB adding up to 40 ml mark. An overlay of max. 5ml Aspergillus transformation buffer (ATB) diluted to ½x with sterile MilliQ-water is carefully placed on top of the APB. </li>
+<li>Protoplast solutions are diluted in APB adding up to 40 ml mark. An overlay of max. 5ml Aspergillus transformation buffer (ATB) diluted to ½x with sterile MilliQ-water is carefully placed on top of the APB. </li>
 <li>Centrifuged at 13 min 3000 RCF in Sorvall centrifuge. Protoplates should be observed as a halo of with slurry in the interphase of the two liquids. </li>
 <li>Withdraw of the protoplasts are done with pipette and placed in a Falcon tube. </li>
@@ Line 412: / Line 929: @@
 <li>Poure directly on pre-made TM plates and incubate at 37°C for 3-8 days.</li>
 <br><br>
+<a name="Production of conidiospores"></a><h3>Production of conidiospores</h3>
+<b><big>Materials</big></b> <br>
+tooth stick <br>
+LB plates <br>
+<br>
+<b><big>Procedure</big></b><br>
+<li> Gently touch the a mature colony with a tooth pick.</li>
+<li> Hold the LB-plate upside down to avoid scattering of spores, and stab three different places.</li>
+<li> Incubated plates at 37°C for approximately five days. After incubation spores were either harvested from the plates or they were stored in the fridge at 4°C.</li>
+<br>
+<a name="Flourescence Microscopy"></a><h3>Flourescence Microscopy</h3>
+<b><big>Materials</big></b><br>
+MM<br>
+Bleomycin <br>
+-NQO <br><br>
+<b><big>Procedure</big></b>
+Cultivation for fluorescence detection was performed by collecting the conidia from plates having three point stab colonies that have grown for 4-5 days. 5ml of MM with supplements were added to the plate and conidia were rubbed off the colonies with a sterile Drigalsky spatula.
+<li> Inoculate the conidial suspension in 5ml MM in a sterile 50ml Falcon. </li>
+<li> Add bleomycin (10mg/mL) and 4-NQO (5 mg/mL). This will cause damage to the DNA inducing gene expression</li>
+<li> Incubated at 37 °C with 150 rpm of shaking overnight.
+<br><br>
+<a name="Fluorescence detection"></a><h3>Fluorescence detection</h3>
+<big><b>Materials</b></big><br>
+Coverslide + overlay cover. <br>
+Conidia Culture.<br>
+<big><b>Procedure</b></big><br>
+<li> Take 500µL of conidia culture (ref. till protocol for det) in a tube. This has to be done after 4, 24, 48 and 120 hours .</li>
+<li> Centrifuge the tube at 16000g for 1min and 30 sec.</li>
+<li>Discard the supernatant.</li>
+<li>Resolute the pellet in 5µL Milli Q water and place on slide. Place the overlay cover</li>
+<li> Detection microscopy was performed first with DIT filter and fluorescence filter with enlargement of 10x and 100x.</il>
+<dd>To check background fluorescence, comparison  of detection with yellow filter was made against detection by green and red filter.</dd>
+<br>
+<a name="Extraction of proteins"></a><h3>Extraction of proteins</h3>
+<br>
+<big><b>Materials</b></big><br>
+Z-buffer<br>
+AEBSF stock solution<br>
+Bradford Reagent<br>
+BSA<br>
+MilliQ water<br>
+Minimal media with aminoacids<br><br>
+<big><b>Procedure</b></big><br>
+<b>Inoculation of conidia in shaking bottle</b>
+<li>The colonies from the three point stab are harvested by adding 2mL MilliQ water to the petri dish. The colonies are rubt with a digalski spartula.</li>
+<li>500µl of the colony suspension is pipette into a 500mL shaking bottle with 100mL minimal media containing amino acids</li>
+<li>Incubate in 48 hours at 37°C</li>
+<br>
+<b>Protein extract</b>
+<li> 2 mL culture are transferred from the shaking bottles to eppendorf tubes. Remember to do triple determination. </li>
+<li> Centrifuge tubes in 1 min with 8000g</li>
+<li> Remove the supernatant. </li>
+<li> Transfer the mycelierne with a sterile spartula to FastPrep tubes.</li>
+<li> 250 µL Z-buffer is added to the FastPrep tubes in stink cabinet.</li>
+<li>Add approximately 200µL of the small glass balls to the FastPrep tubes.</li>
+<li>Add 12,5µL AEBSF stock solution.</li>
+<li> Place the FastPrep tubes in the FastPrep machines. Let it run with max velocity  for 30 sec.</li>
+<li>Tubes are kept on ice from now on. Add 250 µL Z-buffer and mix well.</li>
+<li>The extract is transferred by a 1000 µL pipette. Place the pipet at the bottom of the tube and transfer it to a new eppendorf tube.</li>
+<li>Centrifuge the eppendorp tubes in 15 min at 10000g to purify the protein extract.</li>
+<li>Transfer the supernatant to a new eppendorp tube.</li>
+<br>
+<a name="Assays"></a><h2><b>Assays</b></h2>
+<big><b>Materials</b></big><br>
+Z-buffer<br>
+AEBSF stock solution<br>
+Bradford Reagent<br>
+BSA<br>
+MilliQ water<br>
+Minimal media with aminoacids<br>
+Protein extract (from above)<br><br>
+<a name="ß-galactosidase assay"></a><h3><b>ß-galactosidase assay</b></h3>
+<big><b>Procedure</b></big><br>
+<li> Add 25 µL extract and 225 µL Z-buffer to a well in a microtiter plate. Three wells per extract for triple determination.</li>
+<li> Mix enough ONPG stock solution so 50 µL can be added to each well.</li>
+<li> Measure OD with the computer program Gen5; Shake the plate every 30 sec to mix the solution, rest for 10 min before measuring the OD.</li>
+<br>
+<a name="Bradford assay"></a><h3><b>Bradford assay</b></h3>
+<big><b>Procedure</b></big><br>
+<li> Add 5 µL extract and 245 µL Bradford reagent to a well in a microtiter plate. Three wells per extract for triple determination.</li>
+<li>Make a BSA standard with concentrations between 0,1-2,0mg/mL with. See table below:</li>
+<a name="Preparation of BSA standards"></a><h3>Preparation of BSA standards</h3>
+<table border="3" bordercolor=#990000>
+<tr>
+  <th> Standard</th>
+  <th> µL standard </th>
+  <th> µL dH<SUB>2</SUB>O</th>
+  <th> Concentration</th>
+</tr>
+<tr>
+  <th> Std 1</th>
+  <th> 300 µL stock</th>
+  <th>1200µL</th>
+  <th> 2 mg/ml </th>
+</tr>
+<tr>
+<th> Std 2 </th>
+  <th> 200 µL stock</th>
+  <th>1000µL</th>
+  <th> 1,67mg/ml </th>
+</tr>
+<tr>
+<th> Std 3</th>
+  <th> 700 µL Std 1</th>
+  <th>700µL</th>
+  <th> 1 mg/ml </th>
+</tr>
+<tr>
+<th> Std 4</th>
+  <th> 700 µL Std 2</th>
+  <th>700µL</th>
+  <th> mg/ml </th>
+</tr>
+<tr>
+<th> Std 5</th>
+  <th> 700 µL Std 3</th>
+  <th>700µL</th>
+  <th> 0,5 mg/ml </th>
+</tr>
+<tr>
+<th> Std 6</th>
+  <th> 700 µL Std 4</th>
+  <th>700µL</th>
+  <th> mg/ml </th>
+</tr>
+<tr>
+<th> Std 7</th>
+  <th> 700 µL Std 5</th>
+  <th>700µL</th>
+  <th> 0.25mg/ml </th>
+</tr>
+<tr>
+<th> Std 8</th>
+  <th> 700 µL Std 7</th>
+  <th>700µL</th>
+  <th> 0,125mg/ml </th>
+</tr>
+<tr>
+<th> Std 9</th>
+  <th> - </th>
+  <th>700µL</th>
+  <th> 0 mg/ml </th>
+</tr>
+</table>
+<br>
+<ul>
+ <li>Make triple determination.</li>
+<li>Incubate at 37°C for 10 min.</li>
+</ul>
@@ Line 419: / Line 1,103: @@
 <br>
 <big><b>Materials</b></big><br>
-<b>cells</b>: U2OS cells were kindly provided by The Danish Cancer Society.  U2OS cell line is derived from the bone tissue of a patient suffering from osteosarcoma. U2OS cells show epithelial adherent morphology. <br>
+<b>cells</b>: U2OS cells were kindly provided by The Danish Cancer Society.  U2OS cell line is derived from the bone tissue of a patient suffering from osteosarcoma. U2OS cells show epithelial adherent morphology. <br><br>
 <b>Medium</b>:<br>
 ml DMEM <br>
@@ Line 476: / Line 1,160: @@
 <br>
 <br>
-<a name="Transferring the cells to coverslips"></a><h3>Transferring the cells to coverslips</h3>
+<a name="Transferring cells to coverslips"></a><h3>Transferring cells to coverslips</h3>
 <br>
 <big><b>Materials</b></big><br>
@@ Line 500: / Line 1,184: @@
 <big><b>Materials</b></big><br>
 Optimem<br>
-Fungene 6 <br>
+FuGENE transfection reagent<br>
 Plasmid DNA<br><br>
 <big><b>Procedure</b></big><br>
-<li>Disinfect LAF bench and gloves with ethanol before and after working in the LAF bench. </li>
+<li>The LAF bench and gloves is disinfected with ethanol before and after working in the LAF bench. </li>
-<li>To prepare the transfection, transfer 46μl optimem to a 1,5ml eppendorf tube per tranfection. </li>
+<li>46μl optimem per is transferred to a 1,5 ml eppendorf tube per tranfection. </li>
-<li>Add 3 μl of Fungene 6 directly into the optimem and pipet up and down to mix. </li>
+<li>3 μl of Fugene is mixed well with the optimem. </li>
-<li>Flick gently on the tube to obtain further mixing</li>
+<li>The tube is flicked gently to make sure that the solution is properly mixed. Incubation for 5 min at room temperature</li>
-<li>Incubate for 5 mn at room temperature </li>
+<li>1 μl of plasmid DNA is mixed well with the optimem/Fugene mix.</li>
-<li>Add 1 μl of plasmid DNA directly into the optimem/Fugene mixture and pipet up and down to mix.</li>
+<li>The tube is flicked gently to make sure the mixture is properly mixed.</li>
-<li>Flick gently on the tube to obtain further mixing.</li>
+<li>If there is any liquid remaining on the side of the tube, the tube is centrifuged shortly.</li>
-<li>If there is any liquid remaining on the side of the tube, spin very shortly in the centrifuge.</li>
+<li>The plasmid mixture is incubated for 15 min at 37°C. </li>
-<li>Incubate the eppendorf tubes for 15 min at 37°C. </li>
+<li>The  dish with U-2OS cells from the incubator. </li>
-<li>Take out the 6 cm<SUP>2</SUP> dish with HEK293 cells from the incubator. </li>
+<li>The 50 μl transfection mixture is added dropwise to the 6 cm<SUP>2</SUP> dish containg the coverslips.</li>
-<li>In the LAF bench, add the 50 μl transfection mixture to the cells. Do it drop-wise into the medium. </li>
+<li>The mixture is gently mixed by rocking motion and the dish is placed back in the incubator.</li>
-<li>Use rocking motion to gently mix and place the dishes back in the incubator.</li>
 <br>
-<a name="Coverslides for microscopy"></a><h3>Coverslides for microscopy</h3>
+<a name="Coverslips for microscopy"></a><h3>Coverslips for microscopy</h3>
 <br>
 <big><b>Materialer</b></big><br>
@@ Line 526: / Line 1,209: @@
 lint-free paper<br>
 Cover slides<br>
-Transparent nail varnish<br>
+Transparent nail polish<br><br>
 <big><b>Procedure</b></big><br>
-<li>Delute PBS with MilliQ ten times, having final amount of 500ml. </li>
+<div style="float: right; clear: left;"><IMG SRC="https://static.igem.org/mediawiki/2011/6/6b/Mam3.png" height="200px" ></div> <br>
-<li>Sterile move the coverslips to a 24-well plate. </li>
+<li> A 10X PBS dilution is made from PBS and MilliQ water. </li>
-<li>Wash twice with  PBS. </li>
+<li>The coverslips are transferred to a 24-well plate (2 coverslip/well). </li>
-<li>Add 400 μl Formaldehyde to each well under the fume hood. </li>
+<li>The coverslips are washed by adding 1 ml diluted PBS to the wells. The PBS is discarded. This is done twice</li>
-<li>Incubate for 12 min at RT. Remove liquid to the waste bin </li>
+<li>400 μl Formaldehyde is added to each well under the fume hood, and incubated for 12 min at RT. The liquid is transferred to the waste bin </li>
-<li>Wash three times with PBS. </li>
+<li>The coverslips are washed 3 times with the diluted PBS. </li>
-<li>Remove coverslips and immerse shortly in MilliQ water before laid on lint-free paper for drying. </li>
+<li>The coverslips are dipped in MilliQ water before laid on lint-free paper for drying. </li>
-<li>Take 4 μ Vecta shield and place on cover slide. Repeat for each coverslip. </li>
+<li>4 drops each of 4 μl Vectashield is placed on a glass slide.
-<li>When the coverslip is dry, place on coverslide with cells downwards. </li>
+<li> When a coverslip is completely dry, it is placed on a drop of Vectashield on the glass slide. The procedure is repeated for each coverslip. </li>
-<li>Fixate the coverslips with transparent nail varnish.
+<li>The coverslips are fixated with transparent nail polish.
-<br>
-<a name="Purification of plasmids"></a><h3>Purification of plasmids</h3>
-<br>
-<big><b>Mateials</b></big><br>
-EndoFree Plasmid Maxi kit from QIAGEN was used to purify plasmids for use in mammalian cells. <br><br>
-<big><b>Procedures - QIAGEN protocol</b></big><br>
-<li> Pick a single colony from a freshly streaked selective plate and inoculate a starter culture of 2–5 ml LB medium containing the appropriate selective antibiotic. Incubate for ~8 h at 37°C with vigorous shaking (~300 rpm). </li>
-<li> Dilute the starter culture 1/500 to 1/1000 into selective LB medium. For high-copy plasmids inoculate 100 ml medium, and for low-copy plasmids, inoculate 250 ml medium. Grow at 37°C for 12–16 h with vigorous shaking (~300 rpm). </li>
-<li> Harvest the bacterial cells by centrifugation at 6000 x g for 15 min at 4°C. Resuspend the bacterial pellet in 10 ml Buffer P1 </li>
-<li> Add 10 ml Buffer P2, mix gently but thoroughly by inverting 4–6 times, and incubate at room temperature for 5 min. The lysis reaction time must not exceed 5 min. </li>
-<li>Add 10 ml chilled Buffer P3 to the lysate, and mix immediately but gently by inverting 4–6 times. Proceed directly to next step. Do not incubate the lysate on ice. </li>
-<li>Pour the lysate into the barrel of the QIAfilter Cartridge. Incubate at room temperature for 10 min. Do not insert the plunger! </li>
-<li>Remove the cap from the QIAfilter Cartridge outlet nozzle. Gently insert the plunger into the QIAfilter Maxi Cartridge and filter the cell lysate into a 50 ml tube. </li>
-<li>Add 2.5 ml Buffer ER to the filtered lysate, mix by inverting the tube approximately 10 times, and incubate on ice for 30 min. </li>
-<li>Equilibrate a QIAGEN-tip 500 by applying 10 ml Buffer QBT, and allow the column to empty by gravity flow. </li>
-<li>Apply the filtered lysate from step 9 to the QIAGEN-tip and allow it to enter the resin by gravity flow. </li>
-<li>Wash the QIAGEN-tip with 2 x 30 ml Buffer QC. </li>
-<li>Elute DNA with 15 ml Buffer QN. </li>
-<li>Precipitate DNA by adding 10.5 ml (0.7 volumes) room-temperature isopropanol to the eluted DNA. Mix and centrifuge immediately at ≥15,000 x g for 30 min at 4°C. Carefully decant the supernatant. </li>
-<li>Wash DNA pellet with 5 ml of endotoxin-free room-temperature 70% ethanol (add 40 ml of 96–100% ethanol to the endotoxin-free water supplied with the kit) and centrifuge at ≥15,000 x g for 10 min. Carefully decant the supernatant without disturbing the pellet. </li>
-<li>Air-dry the pellet for 5–10 min, and redissolve the DNA in a suitable volume of endotoxin-free Buffer TE.</li>
-"To determine the yield, DNA concentration should be determined by both UV spectrophotometry and quantitative analysis on an agarose gel."
 <br><br>
-<ul>
-</ul>
 </td>
-</tr>
+</th>
 </table>
+</div>
 <div id="EndOfPage"></div>
 <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js" charset="utf-8"></script>
@@ Line 601: / Line 1,260: @@
 });
 </script>
 </body>
 </html>