"
User:Allancrossman/Gibson
From 2011.igem.org
< User:Allancrossman(Difference between revisions)
(→INP[spacer]) |
|||
| (35 intermediate revisions not shown) | |||
| Line 1: | Line 1: | ||
In the event that a straight-up Gibson assembly becomes desirable... | In the event that a straight-up Gibson assembly becomes desirable... | ||
| - | '''Primer strategy:''' to create homology between part A and part B, use >= 20 bases from the end of A and the start of B; gene A's reverse primer is the reverse complement of gene B's forward primer. It is possible to add bases in the junction. If a stop codon is needed, I only use one stop codon in case we need to use a template that completely lacks stops; in that case one stop codon will be added by the PCR. | + | '''Primer strategy:''' to create homology between part A and part B, use >= 20 bases from the end of A and the start of B; gene A's reverse primer is the reverse complement of gene B's forward primer. It is possible to add bases in the junction. If a stop codon is needed, I only use one stop codon in case we need to use a template that completely lacks stops; in that case one stop codon will be added by the PCR. Some primers have had bases added or deleted from the 3' end to make a sane Tm. |
| + | |||
| + | '''Note that (before any PCR) the INP part has to be created by attaching linker2fs and linker2rt to <partinfo>BBa_K523008</partinfo>. Note that we must use the new, serine-rich linker to avoid certain issues (homology with the endoglucanase)''' | ||
==Plac-RBS-LacZ-RBS-INP[spacer]-malS== | ==Plac-RBS-LacZ-RBS-INP[spacer]-malS== | ||
| Line 8: | Line 10: | ||
** Vector = pSB1C3 | ** Vector = pSB1C3 | ||
** Plac-RBS-LacZ-RBS = <partinfo>BBa_K523005</partinfo> | ** Plac-RBS-LacZ-RBS = <partinfo>BBa_K523005</partinfo> | ||
| - | ** INP[spacer] - make by cutting <partinfo>BBa_K523008</partinfo> with SpeI and ligating | + | ** INP[spacer] - make by cutting <partinfo>BBa_K523008</partinfo> with SpeI and ligating linker2fs and linker2rt |
** malS = <partinfo>BBa_K523001</partinfo> | ** malS = <partinfo>BBa_K523001</partinfo> | ||
| Line 14: | Line 16: | ||
====Vector==== | ====Vector==== | ||
| - | + | <!-- Gibthon: tctgggcagggcaacagtaa TACTAGTAGCGGCCGCTGCA --> | |
* '''Forward:''' gtctgggcagggcaacagtaa tactagtagcggccgctgcag | * '''Forward:''' gtctgggcagggcaacagtaa tactagtagcggccgctgcag | ||
| + | ** Complementary Tm = 68.5 | ||
* '''Reverse:''' gttaacggcgggatataacatgag ctctagaagcggccgcgaattc | * '''Reverse:''' gttaacggcgggatataacatgag ctctagaagcggccgcgaattc | ||
| + | ** Complementary Tm = 71.6 | ||
| + | <!-- Gibthon: ACGGCGGGATATAACATGAG ctctagaagcggccgcgaat --> | ||
====Plac-RBS-LacZ-RBS==== | ====Plac-RBS-LacZ-RBS==== | ||
| - | + | <!-- Gibthon: attcgcggccgcttctagag CTCATGTTATATCCCGCCGT --> | |
* '''Forward:''' gaattcgcggccgcttctagag ctcatgttatatcccgccgttaac | * '''Forward:''' gaattcgcggccgcttctagag ctcatgttatatcccgccgttaac | ||
| - | * '''Reverse:''' | + | ** Complementary Tm = 65.9 |
| + | * '''Reverse:''' gcgctttatccagggtcatTAT TTAcctccttgagctctagtatcactcc | ||
| + | ** Complementary Tm = 64.4 | ||
| + | <!-- Gibthon: GCTTTATCCAGGGTCATTAT ttacctccttgagctctagt --> | ||
====INP[spacer]==== | ====INP[spacer]==== | ||
| - | + | <!-- Gibthon: actagagctcaaggaggtaa ATAATGACCCTGGATAAAGC --> | |
| - | * '''Forward:''' gatactagagctcaaggaggTAA | + | * '''Forward:''' gatactagagctcaaggaggTAA ATAatgaccctggataaagcgc |
| - | * '''Reverse:''' cccggagaagtccagctggc | + | ** Complementary Tm = 63.9 |
| + | * '''Reverse:''' cccggagaagtccagctggc ccgccacgctgctcggg | ||
| + | ** Complementary Tm = 76.3 | ||
| + | <!-- Gibthon: CCCGGAGAAGTCCAGCTGGC ccgccacgctgctcgggctg --> | ||
====malS==== | ====malS==== | ||
| - | + | <!-- Gibthon: cagcccgagcagcgtggcgg GCCAGCTGGACTTCTCCGGG --> | |
| - | * '''Forward:''' | + | * '''Forward:''' cagcccgagcagcgtggcgg gccagctggacttctccggg |
| + | ** Complementary Tm = 72.5 | ||
* '''Reverse:''' ctgcagcggccgctactagta ttactgttgccctgcccagac | * '''Reverse:''' ctgcagcggccgctactagta ttactgttgccctgcccagac | ||
| + | ** Complementary Tm = 68.4 | ||
| + | <!-- Gibthon: TGCAGCGGCCGCTACTAGTA ttactgttgccctgcccaga --> | ||
==Plac-RBS-LacZ-RBS-INP[spacer]-Endoglucanase== | ==Plac-RBS-LacZ-RBS-INP[spacer]-Endoglucanase== | ||
| Line 38: | Line 52: | ||
** Vector = pSB1C3 | ** Vector = pSB1C3 | ||
** Plac-RBS-LacZ-RBS = <partinfo>BBa_K523005</partinfo> | ** Plac-RBS-LacZ-RBS = <partinfo>BBa_K523005</partinfo> | ||
| - | ** INP[spacer] - make by cutting <partinfo>BBa_K523008</partinfo> with SpeI and ligating | + | ** INP[spacer] - make by cutting <partinfo>BBa_K523008</partinfo> with SpeI and ligating linker2fs and linker2rt |
** Endoglucanase - use <partinfo>BBa_K118023</partinfo>. Don't use anything else; in particular, our previous primers to PCR this altered some codons and the product doesn't match the new primers below. So use K118023. | ** Endoglucanase - use <partinfo>BBa_K118023</partinfo>. Don't use anything else; in particular, our previous primers to PCR this altered some codons and the product doesn't match the new primers below. So use K118023. | ||
| Line 44: | Line 58: | ||
====Vector==== | ====Vector==== | ||
| - | + | <!-- Gibthon: cgcgcaacgccaggtggtaa TACTAGTAGCGGCCGCTGCA --> | |
* '''Forward:''' cgcgcaacgccaggtggtaa tactagtagcggccgctgcag | * '''Forward:''' cgcgcaacgccaggtggtaa tactagtagcggccgctgcag | ||
| + | ** Complementary Tm = 68.5 | ||
* '''Reverse:''' [as for malS] | * '''Reverse:''' [as for malS] | ||
====Plac-RBS-LacZ-RBS==== | ====Plac-RBS-LacZ-RBS==== | ||
| + | * '''Forward:''' [as for malS] | ||
| + | * '''Reverse:''' [as for malS] | ||
| + | ====INP[spacer]==== | ||
| + | * '''Forward:''' [as for malS] | ||
| + | * '''Reverse:''' gtcgacgcggcagccgggagc ccgccacgctgctcggg | ||
| + | <!-- Gibthon: TCGACGCGGCAGCCGGGAGC ccgccacgctgctcgggctg --> | ||
| + | ** Complementary Tm = 76.3 | ||
| + | |||
| + | ====Endoglucanase==== | ||
| + | <!-- Gibthon: cagcccgagcagcgtggcgg GCTCCCGGCTGCCGCGTCGA --> | ||
| + | * '''Forward:''' cagcccgagcagcgtggcgg gctcccggctgccgcgtcgac | ||
| + | * '''Reverse:''' ctgcagcggccgctactagta ttaccacctggcgttgcgcg | ||
| + | <!-- Gibthon: TGCAGCGGCCGCTACTAGTA ttaccacctggcgttgcgcg --> | ||
| + | |||
| + | ==Plac-RBS-LacZ-RBS-INP[spacer]-Exoglucanase== | ||
| + | |||
| + | * Templates: | ||
| + | ** Vector = pSB1C3 | ||
| + | ** Plac-RBS-LacZ-RBS = <partinfo>BBa_K523005</partinfo> | ||
| + | ** INP[spacer] - make by cutting <partinfo>BBa_K523008</partinfo> with SpeI and ligating linker2fs and linker2rt | ||
| + | ** Exoglucanase = <partinfo>BBa_K118022</partinfo> | ||
| + | |||
| + | ===Primers=== | ||
| + | |||
| + | ====Vector==== | ||
| + | <!-- Gibthon: cgccctgcacggtcggctaa TACTAGTAGCGGCCGCTGCA --> | ||
| + | * '''Forward:''' cgccctgcacggtcggctaa tactagtagcggccgctgcag | ||
| + | * '''Reverse:''' [as for malS] | ||
| + | |||
| + | ====Plac-RBS-LacZ-RBS==== | ||
* '''Forward:''' [as for malS] | * '''Forward:''' [as for malS] | ||
* '''Reverse:''' [as for malS] | * '''Reverse:''' [as for malS] | ||
====INP[spacer]==== | ====INP[spacer]==== | ||
| + | * '''Forward:''' [as for malS] | ||
| + | * '''Reverse:''' gcctccttgagcgtggtcgc ccgccacgctgctcgggctg | ||
| + | <!-- Gibthon: GCCTCCTTGAGCGTGGTCGC ccgccacgctgctcgggctg --> | ||
| + | ====Exoglucanase==== | ||
| + | <!-- Gibthon: cagcccgagcagcgtggcgg GCGACCACGCTCAAGGAGGC --> | ||
| + | * '''Forward:''' cagcccgagcagcgtggcgg gcgaccacgctcaaggaggc | ||
| + | * '''Reverse:''' ctgcagcggccgctactagta ttagccgaccgtgcagggcg | ||
| + | <!-- Gibthon: TGCAGCGGCCGCTACTAGTA ttagccgaccgtgcagggcg --> | ||
| + | |||
| + | ==Plac-RBS-LacZ-RBS-INP[spacer]-B.Glucosidase== | ||
| + | |||
| + | * Templates: | ||
| + | ** Vector = pSB1C3 | ||
| + | ** Plac-RBS-LacZ-RBS = <partinfo>BBa_K523005</partinfo> | ||
| + | ** INP[spacer] - make by cutting <partinfo>BBa_K523008</partinfo> with SpeI and ligating linker2fs and linker2rt | ||
| + | ** B-glucosidase = <partinfo>BBa_K392008</partinfo> | ||
| + | |||
| + | ===Primers=== | ||
| + | |||
| + | ====Vector==== | ||
| + | <!-- Gibthon: ccgcgacctaccagccctga TACTAGTAGCGGCCGCTGCA --> | ||
| + | * '''Forward:''' ccgcgacctaccagccctga tactagtagcggccgctgcag | ||
| + | * '''Reverse:''' [as for malS] | ||
| + | |||
| + | ====Plac-RBS-LacZ-RBS==== | ||
* '''Forward:''' [as for malS] | * '''Forward:''' [as for malS] | ||
| - | * '''Reverse:''' | + | * '''Reverse:''' [as for malS] |
| - | ==== | + | ====INP[spacer]==== |
| + | * '''Forward:''' [as for malS] | ||
| + | * '''Reverse:''' cccgaggggcgcgtggtggt ccgccacgctgctcgggctg | ||
| + | <!-- Gibthon: CCCGAGGGGCGCGTGGTGGT ccgccacgctgctcgggctg --> | ||
| - | * '''Forward:''' | + | ====B-Glucosidase==== |
| - | * '''Reverse:''' ctgcagcggccgctactagta | + | <!-- Gibthon: cagcccgagcagcgtggcgg ACCACCACGCGCCCCTCGGG --> |
| + | * '''Forward:''' cagcccgagcagcgtggcgg accaccacgcgcccctcggg | ||
| + | * '''Reverse:''' ctgcagcggccgctactagta tcagggctggtaggtcgcgg | ||
| + | <!-- Gibthon: TGCAGCGGCCGCTACTAGTA tcagggctggtaggtcgcgg --> | ||
| + | |||
| + | ==Plac-RBS-LacZ-RBS-INP[spacer]-EYFP== | ||
| + | |||
| + | * Templates: | ||
| + | ** Vector = pSB1C3 | ||
| + | ** Plac-RBS-LacZ-RBS = <partinfo>BBa_K523005</partinfo> | ||
| + | ** INP[spacer] - make by cutting <partinfo>BBa_K523008</partinfo> with SpeI and ligating linker2fs and linker2rt | ||
| + | ** EYFP = <partinfo>BBa_K216011</partinfo> | ||
| + | |||
| + | ===Primers=== | ||
| + | |||
| + | ====Vector==== | ||
| + | <!-- Gibthon: tggacgagctgtacaagtaa TACTAGTAGCGGCCGCTGCA --> | ||
| + | * '''Forward:''' catggacgagctgtacaagtaa tactagtagcggccgctgcag | ||
| + | * '''Reverse:''' [as for malS] | ||
| + | |||
| + | ====Plac-RBS-LacZ-RBS==== | ||
| + | * '''Forward:''' [as for malS] | ||
| + | * '''Reverse:''' [as for malS] | ||
| + | |||
| + | ====INP[spacer]==== | ||
| + | * '''Forward:''' [as for malS] | ||
| + | * '''Reverse:''' cagctcctcgcccttgctcac ccgccacgctgctcgggctg | ||
| + | <!-- Gibthon: AGCTCCTCGCCCTTGCTCAC ccgccacgctgctcgggctg --> | ||
| + | |||
| + | ====EYFP==== | ||
| + | <!-- Gibthon: cagcccgagcagcgtggcgg GTGAGCAAGGGCGAGGAGCT --> | ||
| + | * '''Forward:''' cagcccgagcagcgtggcgg gtgagcaagggcgaggagctg | ||
| + | * '''Reverse:''' ctgcagcggccgctactagta ttacttgtacagctcgtccatg | ||
| + | <!-- Gibthon: TGCAGCGGCCGCTACTAGTA ttacttgtacagctcgtcca --> | ||
==Appendix: Sequences== | ==Appendix: Sequences== | ||
| Line 121: | Line 227: | ||
</pre> | </pre> | ||
| - | ===INP[ | + | ===INP[with serine-rich linker]=== |
(Three bases added at start to give RBS room to work) | (Three bases added at start to give RBS room to work) | ||
| Line 135: | Line 241: | ||
gttctgaccgctggggcacgttctaaactgatcgggagcgaaggctctactctgtccgccggagaagattctaccctgatctttcgtctgtgggatggta | gttctgaccgctggggcacgttctaaactgatcgggagcgaaggctctactctgtccgccggagaagattctaccctgatctttcgtctgtgggatggta | ||
aacgttatcgtcagctggtcgctcgtacaggtgaaaatggtgtggaagccgacattccgtattatgtgaatgaggacgatgatattgtggacaaaccgga | aacgttatcgtcagctggtcgctcgtacaggtgaaaatggtgtggaagccgacattccgtattatgtgaatgaggacgatgatattgtggacaaaccgga | ||
| - | + | cgaagatgatgattggatcgaagtgaaaggtactagcagcagcattgcgagcagcagcccgagcagcgtggcgg</pre> | |
| - | </pre> | + | |
===malS [mature peptide only, aa 18 onwards]=== | ===malS [mature peptide only, aa 18 onwards]=== | ||
| Line 182: | Line 287: | ||
agtggtggcaggagatcgccctggagatggcgcgcaacgccaggtggtaa | agtggtggcaggagatcgccctggagatggcgcgcaacgccaggtggtaa | ||
</pre> | </pre> | ||
| - | |||
===Exoglucanase BBa_K118022 [mature peptide only, aa 43 onwards]=== | ===Exoglucanase BBa_K118022 [mature peptide only, aa 43 onwards]=== | ||
| Line 201: | Line 305: | ||
cgcagtccggctcggccgtgacggtccgcaacgccccgtggaacggctcgatcccggcgggcggcaccgcgcagttcggcttcaacggctcgcacacggg | cgcagtccggctcggccgtgacggtccgcaacgccccgtggaacggctcgatcccggcgggcggcaccgcgcagttcggcttcaacggctcgcacacggg | ||
caccaacgccgcgccgacggcgttctcgctcaacggcacgccctgcacggtcggctaa | caccaacgccgcgccgacggcgttctcgctcaacggcacgccctgcacggtcggctaa | ||
| + | </pre> | ||
| + | |||
| + | ===B-glucosidase BBa_K392008 (or whatever we have)=== | ||
| + | |||
| + | <pre style="font-size:10pt"> | ||
| + | accaccacgcgcccctcgggccgccagttctccgacgacttcctgtggggctcggccacggcctcctaccagatc | ||
| + | gagggcgcgcacgacgagggcggtcgcggcccgtcgatctgggacacgttctcccgcaccccgggcaaggtcctcaacggcgacaccggcgacgtcgcgg | ||
| + | tcgaccactaccaccgcgtccccgaggacgtcgagatcatgaagagcctcggcctccaggcctaccggttctcgatcgcctggccccgcatccagccgac | ||
| + | cggctcgggcgagttcaaccaggccgggctcgacttctactccgacctcgtcgaccggctcatcgccgccggcatcaagcccgtcgcgacgctgtaccac | ||
| + | tgggacctcccgcagcccctggaggacgagggcggctgggcgaaccgcgcgacggcgtaccggttcgccgagtacgcgcgcaagctcgccgaggtcctcg | ||
| + | gcaagcgcgtcgacctgtggaccacgctcaacgagccgtggtgctccgcgttcctcggctacgcctcaggcgtgcacgcccccggcgtcaccgacccggt | ||
| + | caaggccctgcgcgccgtccaccacctcaacctcgcgcacggcctcgcgggccgcgcgatccgcgaggtcctcggcgagaacgcgcccgtctcgatcacg | ||
| + | ctcaacctgcacgtgacgcgcgccgccgacgactccgccgactccgtcgaggccaagcgccgcatcgacaccatcgcgaacgaggtcttcctcggcccgc | ||
| + | tgctcgacggcgagtaccccaaggaggtcttcgcggacaccgcgcacctcaccgactggtccttcgtcgagccgggcgacctcgagctcatccgcatccc | ||
| + | gctcaccgtgctcggcgtcaactactactcgaccggccgcgtgaagaagggcagcgccgcgggcgccgacccgggcaagccgggccccgacggccaccgc | ||
| + | gcctccgagcactcctcgtgggtcggcgccgacgaggtcgagtggctcccgcagcccggcccgcacaccgcgatgggctggaacatcgagcccgacggcc | ||
| + | tcgtcgacctgctgctcgagctgcgcgaccgttaccccagccagcccctggcgatcacggagaacggtgccgcgttctacgacacggtcagcgaggacgg | ||
| + | ccgcgtgcacgaccccgagcgcgtcggctacctgcacgaccacgtcgacgccgtcggcgaggccatcgacaagggcgccgacgtgcgcgcctacttcgtg | ||
| + | tggtcgctgctcgacaacttcgagtgggcctacggctacgaccgccggttcggcatcgtgcgcgtcgactacgacacgcacgagcgcatcgtgaaggact | ||
| + | cgggcctctggtaccgcgagctcgtgcgcacccgcaccatcgctccggccgaggacgccgcgacctaccagccctga | ||
| + | </pre> | ||
| + | |||
| + | ===Enchanced Yellow Fluorescent Protein=== | ||
| + | |||
| + | <pre style="font-size:10pt"> | ||
| + | gtgagcaagggcgaggagctgttcaccggggtggtgcccat | ||
| + | cctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatc | ||
| + | tgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgc | ||
| + | acgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagtt | ||
| + | cgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagc | ||
| + | cacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgacc | ||
| + | actaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaa | ||
| + | gcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa | ||
</pre> | </pre> | ||
Latest revision as of 10:40, 16 August 2011
In the event that a straight-up Gibson assembly becomes desirable...
Primer strategy: to create homology between part A and part B, use >= 20 bases from the end of A and the start of B; gene A's reverse primer is the reverse complement of gene B's forward primer. It is possible to add bases in the junction. If a stop codon is needed, I only use one stop codon in case we need to use a template that completely lacks stops; in that case one stop codon will be added by the PCR. Some primers have had bases added or deleted from the 3' end to make a sane Tm.
Note that (before any PCR) the INP part has to be created by attaching linker2fs and linker2rt to <partinfo>BBa_K523008</partinfo>. Note that we must use the new, serine-rich linker to avoid certain issues (homology with the endoglucanase)
Plac-RBS-LacZ-RBS-INP[spacer]-malS
- Templates:
- Vector = pSB1C3
- Plac-RBS-LacZ-RBS = <partinfo>BBa_K523005</partinfo>
- INP[spacer] - make by cutting <partinfo>BBa_K523008</partinfo> with SpeI and ligating linker2fs and linker2rt
- malS = <partinfo>BBa_K523001</partinfo>
Primers
Vector
- Forward: gtctgggcagggcaacagtaa tactagtagcggccgctgcag
- Complementary Tm = 68.5
- Reverse: gttaacggcgggatataacatgag ctctagaagcggccgcgaattc
- Complementary Tm = 71.6
Plac-RBS-LacZ-RBS
- Forward: gaattcgcggccgcttctagag ctcatgttatatcccgccgttaac
- Complementary Tm = 65.9
- Reverse: gcgctttatccagggtcatTAT TTAcctccttgagctctagtatcactcc
- Complementary Tm = 64.4
INP[spacer]
- Forward: gatactagagctcaaggaggTAA ATAatgaccctggataaagcgc
- Complementary Tm = 63.9
- Reverse: cccggagaagtccagctggc ccgccacgctgctcggg
- Complementary Tm = 76.3
malS
- Forward: cagcccgagcagcgtggcgg gccagctggacttctccggg
- Complementary Tm = 72.5
- Reverse: ctgcagcggccgctactagta ttactgttgccctgcccagac
- Complementary Tm = 68.4
Plac-RBS-LacZ-RBS-INP[spacer]-Endoglucanase
- Templates:
- Vector = pSB1C3
- Plac-RBS-LacZ-RBS = <partinfo>BBa_K523005</partinfo>
- INP[spacer] - make by cutting <partinfo>BBa_K523008</partinfo> with SpeI and ligating linker2fs and linker2rt
- Endoglucanase - use <partinfo>BBa_K118023</partinfo>. Don't use anything else; in particular, our previous primers to PCR this altered some codons and the product doesn't match the new primers below. So use K118023.
Primers
Vector
- Forward: cgcgcaacgccaggtggtaa tactagtagcggccgctgcag
- Complementary Tm = 68.5
- Reverse: [as for malS]
Plac-RBS-LacZ-RBS
- Forward: [as for malS]
- Reverse: [as for malS]
INP[spacer]
- Forward: [as for malS]
- Reverse: gtcgacgcggcagccgggagc ccgccacgctgctcggg
- Complementary Tm = 76.3
Endoglucanase
- Forward: cagcccgagcagcgtggcgg gctcccggctgccgcgtcgac
- Reverse: ctgcagcggccgctactagta ttaccacctggcgttgcgcg
Plac-RBS-LacZ-RBS-INP[spacer]-Exoglucanase
- Templates:
- Vector = pSB1C3
- Plac-RBS-LacZ-RBS = <partinfo>BBa_K523005</partinfo>
- INP[spacer] - make by cutting <partinfo>BBa_K523008</partinfo> with SpeI and ligating linker2fs and linker2rt
- Exoglucanase = <partinfo>BBa_K118022</partinfo>
Primers
Vector
- Forward: cgccctgcacggtcggctaa tactagtagcggccgctgcag
- Reverse: [as for malS]
Plac-RBS-LacZ-RBS
- Forward: [as for malS]
- Reverse: [as for malS]
INP[spacer]
- Forward: [as for malS]
- Reverse: gcctccttgagcgtggtcgc ccgccacgctgctcgggctg
Exoglucanase
- Forward: cagcccgagcagcgtggcgg gcgaccacgctcaaggaggc
- Reverse: ctgcagcggccgctactagta ttagccgaccgtgcagggcg
Plac-RBS-LacZ-RBS-INP[spacer]-B.Glucosidase
- Templates:
- Vector = pSB1C3
- Plac-RBS-LacZ-RBS = <partinfo>BBa_K523005</partinfo>
- INP[spacer] - make by cutting <partinfo>BBa_K523008</partinfo> with SpeI and ligating linker2fs and linker2rt
- B-glucosidase = <partinfo>BBa_K392008</partinfo>
Primers
Vector
- Forward: ccgcgacctaccagccctga tactagtagcggccgctgcag
- Reverse: [as for malS]
Plac-RBS-LacZ-RBS
- Forward: [as for malS]
- Reverse: [as for malS]
INP[spacer]
- Forward: [as for malS]
- Reverse: cccgaggggcgcgtggtggt ccgccacgctgctcgggctg
B-Glucosidase
- Forward: cagcccgagcagcgtggcgg accaccacgcgcccctcggg
- Reverse: ctgcagcggccgctactagta tcagggctggtaggtcgcgg
Plac-RBS-LacZ-RBS-INP[spacer]-EYFP
- Templates:
- Vector = pSB1C3
- Plac-RBS-LacZ-RBS = <partinfo>BBa_K523005</partinfo>
- INP[spacer] - make by cutting <partinfo>BBa_K523008</partinfo> with SpeI and ligating linker2fs and linker2rt
- EYFP = <partinfo>BBa_K216011</partinfo>
Primers
Vector
- Forward: catggacgagctgtacaagtaa tactagtagcggccgctgcag
- Reverse: [as for malS]
Plac-RBS-LacZ-RBS
- Forward: [as for malS]
- Reverse: [as for malS]
INP[spacer]
- Forward: [as for malS]
- Reverse: cagctcctcgcccttgctcac ccgccacgctgctcgggctg
EYFP
- Forward: cagcccgagcagcgtggcgg gtgagcaagggcgaggagctg
- Reverse: ctgcagcggccgctactagta ttacttgtacagctcgtccatg
Appendix: Sequences
Only the relevant parts of the sequence are shown; any flanking regions have not been shown, since they are irrelevant to the planning of primers. Since Gibson is scarless, the concatenation of the sequences involved is the final sequence.
Vector pSB1C3
tactagtagcggccgctgcagtccggcaaaaaagggcaaggtgtcaccaccctgcccttt ttctttaaaaccgaaaagattacttcgcgttatgcaggcttcctcgctcactgactcgct gcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggtt atccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggc caggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacga gcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagata ccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttac cggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctg taggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccc cgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaag acacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgt aggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagt atttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttg atccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattac gcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctca gtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcac ctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaac ttggtctgacagctcgaggcttggattctcaccaataaaaaacgcccggcggcaaccgag cgttctgaacaaatccagatggagttctgaggtcattactggatctatcaacaggagtcc aagcgagctcgatatcaaattacgccccgccctgccactcatcgcagtactgttgtaatt cattaagcattctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgcca gcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcga agaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattgg ctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgt aacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcac tccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacac tatcccatatcaccagctcaccgtctttcattgccatacgaaattccggatgagcattca tcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacgg tctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactg actgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatc cagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaa atacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgcccga tcaactcgagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaa aataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggat gatttctggaattcgcggccgcttctagag
Plac-RBS-LacZ-RBS
(Three bases added at end to give RBS room to work)
ctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcg gtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcat taatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttac actttatgcttccggctcgtatgttgtgtgaaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacggattcactggccgtcg ttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccg caccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtga tactagagctcaaggaggTAA
INP[with serine-rich linker]
(Three bases added at start to give RBS room to work)
ATAatgaccctggataaagcgctggtgctgcgcacttgtgccaataatatggccgaccattgtggcctgatctggcctgcttctggtacagttgaaagc cgctattggcagtctacacgtcgtcacgaaaacgggctggttgggctgctgtggggtgccggaacatccgcctttctgagcgttcatgccgatgctcgtt ggattgtttgtgaggttgctgttgccgacatcattagcctggaagaaccgggtatggtgaaatttcctcgtgctgaagtggtccatgttggtgatcgtat tagcgcctcccatttcatttcagctcgtcaggctgatccagcaagcacatcaacaagcacctctaccagtacactgacaccaatgccaaccgctatccct actcctatgccggctgtagcctctgttactctgcctgtggccgaacaagctcgccacgaagtctttgacgttgcctctgtgtctgctgctgctgctcctg ttaacactctgcctgttaccacgcctcaaaatctgcaaacggcgacctatggctcaacactgagtggtgataaccattctcgtctgattgccgggtatgg ctctaacgaaaccgccggaaaccattctgatctgatcggtggtcacgattgtacgctgatggcaggtgatcaatctcgtctgaccgctggcaaaaattcc gttctgaccgctggggcacgttctaaactgatcgggagcgaaggctctactctgtccgccggagaagattctaccctgatctttcgtctgtgggatggta aacgttatcgtcagctggtcgctcgtacaggtgaaaatggtgtggaagccgacattccgtattatgtgaatgaggacgatgatattgtggacaaaccgga cgaagatgatgattggatcgaagtgaaaggtactagcagcagcattgcgagcagcagcccgagcagcgtggcgg
malS [mature peptide only, aa 18 onwards]
gccagctggacttctc cggggtttcccgcctttagcgaacaggggacaggaacatttgtcagccacgcgcagttgcccaaaggtacgcgtccactaacgctaaattttgaccaaca gtgctggcagcctgcggatgcgataaaactcaatcagatgctttccctgcaaccttgtagcaacacgccgcctcaatggcgattgttcagggacggcgaa tatacgctgcaaatagacacccgctccggtacgccaacattgatgatttccatccagaacgccgccgaaccggtagcaagcctggtccgtgaatgcccga aatgggatggattaccgctcacagtggatgtcagcgccactttcccggaaggagccgccgtacgggattattacagccagcaaattgcgatagtgaagaa cggtcaaataatgttacaacccgctgccaccagcaacggtttactcctgctggaacgggcagaaactgacacatccgcccctttcgactggcataacgcc acggtttactttgtgctgacagatcgtttcgaaaacggcgatcccagtaatgaccagagttacggacgtcataaagacggtatggcggaaattggcactt ttcacggcggcgatttacgcggcctgaccaacaaactggattacctccagcagttgggcgttaatgctttatggataagcgccccatttgagcaaattca cggctgggtcggcggcggtacaaaaggcgatttcccgcattatgcctaccacggttattacacacaggactggacgaatcttgatgccaatatgggcaac gaagccgatctacggacgctggttgatagcgcacatcagcgcggtattcgtattctctttgatgtcgtgatgaaccacaccggctatgccacgctggcgg atatgcaggagtatcagtttggcgcgttatatctttctggtgacgaagtgaaaaaatcgctgggtgaacgctggagcgactggaaacctgccgccgggca aacctggcatagctttaacgattacattaatttcagcgacaaaacaggctgggataaatggtggggaaaaaactggatcagaacggatatcggcgattac gacaatcctggattcgacgatctcactatgtcgctagcctttttgccggatatcaaaaccgaatcaactaccgcttctggtctgccggtgttctataaaa acaaaatggatacccacgccaaagccattgacggctatacgccgcgcgattacttaacccactggttaagtcagtgggtccgcgactatgggattgatgg ttttcgggtcgataccgccaaacatgttgagttgcccgcctggcagcaactgaaaaccgaagccagcgccgcgcttcgcgaatggaaaaaagctaacccc gacaaagcattagatgacaaacctttctggatgaccggtgaagcctggggccacggcgtgatgcaaagtgactactatcgccacggcttcgatgcgatga tcaatttcgattatcaggagcaggcggcgaaagcagtcgactgtctggcgcagatggatacgacctggcagcaaatggcggagaaattgcagggtttcaa cgtgttgagctacctctcgtcgcatgatacccgcctgttccgtgaagggggcgacaaagcagcagagttattactattagcgccaggcgcggtacaaatc ttttatggtgatgaatcctcgcgtccgttcggtcctacaggttctgatccgctgcaaggtacacgttcggatatgaactggcaggatgttagcggtaaat ctgccgccagcgtcgcgcactggcagaaaatcagccagttccgcgcccgccatcccgcaattggcgcgggcaaacaaacgacacttttgctgaagcaggg ctacggctttgttcgtgagcatggcgacgataaagtgctggtcgtctgggcagggcaacagtaa
Endoglucanase BBa_K118023 [mature peptide only, aa 32 onwards]
gctcccg gctgccgcgtcgactacgccgtcaccaaccagtggcccggcggcttcggcgccaacgtcacgatcaccaacctcggcgaccccgtctcgtcgtggaagct cgactggacctacaccgcaggccagcggatccagcagctgtggaacggcaccgcgtcgaccaacggcggccaggtctccgtcaccagcctgccctggaac ggcagcatcccgaccggcggcacggcgtcgttcgggttcaacggctcgtgggccgggtccaacccgacgccggcgtcgttctcgctcaacggcaccacct gcacgggcaccgtgccgacgaccagccccacgccgaccccgacgccgacgacccccacgccgacgccgaccccgacccccacccccacgccgacggtcac gccgcagccgaccagcggcttctacgtcgacccgacgacgcagggctaccgcgcgtggcaggccgcgtccggcacggacaaggcgctgctcgagaagatc gcgctcaccccgcaggcgtactgggtcggcaactgggccgacgcgtcgcacgcgcaggccgaggtcgccgactacaccggccgcgccgtcgcggccggga agacgccgatgctcgtcgtctacgcgatcccgggccgcgactgcggctcgcactccggcggtggtgtgtccgagtccgagtacgcgcgctgggtcgacac cgtcgcgcagggcatcaagggcaacccgatcgtgatcctcgagcccgacgcgctcgcgcagctcggcgactgctccggccagggtgaccgcgtcggcttc ctcaagtacgccgccaagtcgctcaccctcaagggcgcgcgcgtctacatcgacgcgggccacgcgaagtggctgtcggtcgacacgccggtgaaccgcc tcaaccaggtcggcttcgagtacgcggtgggcttcgcgctcaacacgtcgaactaccagacgacggcggacagcaaggcgtacggccagcagatctcgca gcggctgggcggcaagaagttcgtcatcgacacctcgcgcaacggcaacggctcgaacggcgagtggtgcaacccgcgcggccgcgcgctcggcgaacgc ccggtcgcggtgaacgacggctccggcctggacgcgctcctgtgggtcaagctgcccggcgagtccgacggcgcgtgcaacggcggcccggccgccggcc agtggtggcaggagatcgccctggagatggcgcgcaacgccaggtggtaa
Exoglucanase BBa_K118022 [mature peptide only, aa 43 onwards]
gcgaccacgctcaaggaggccgccgacggcgccggccgggacttcggcttcgcgctcgaccccaaccggctctc ggaggcgcagtacaaggcgatcgccgacagcgagttcaacctcgtcgtcgccgagaacgcgatgaagtgggacgccaccgagccctcgcagaacagcttc tccttcggcgcgggcgaccgcgtcgcgagctacgccgccgacaccggcaaggagctgtacggccacacgctcgtatggcactcgcagctgcccgactggg cgaagaacctcaacggctccgcgttcgagagcgcgatggtcaaccacgtgacgaaggtcgccgaccacttcgagggcaaggtcgcgtcgtgggacgtcgt caacgaggcgttcgccgacggcggcggccgccggcaggactcggcgttccagcagaagctcggcaacggctacatcgagaccgcgttccgggcggcacgt gcggcggacccgaccgccaagctgtgcatcaacgactacaacgtcgagggcatcaacgcgaagagcaactcgctctacgacctcgtcaaggacttcaagg cgcgcggcgtcccgctcgactgcgtcgggttccagtcgcacctcatcgtcggccaggtgccgggcgacttccggcagaacctgcaacggttcgcggacct gggcgtggacgtgcgcatcaccgagctcgacatccgcatgcggacgccctccgacgcgaccaagctcgcgacccaggcggccgactacaagaaggtcgtg caggcctgcatgcaggtgacccgctgccagggcgtgaccgtctggggcatcaccgacaagtactcgtgggtgccggacgtcttcccgggcgagggggccg cgctggtgtgggacgcgagctacgccaagaagccggcctacgccgccgtgatggaggccttcggcgcgagcccgacgccgacgcccaccacgccgacccc gacgcccacgacgccgacgccgaccccgacgtccggtccggccgggtgccaggtgctgtggggcgtcaaccagtggaacaccggcttcaccgcgaacgtc accgtgaagaacacgtcctccgctccggtcgacggctggacgctcacgttcagcttcccgtccggccagcaggtcacccaggcgtggagctcgacggtca cgcagtccggctcggccgtgacggtccgcaacgccccgtggaacggctcgatcccggcgggcggcaccgcgcagttcggcttcaacggctcgcacacggg caccaacgccgcgccgacggcgttctcgctcaacggcacgccctgcacggtcggctaa
B-glucosidase BBa_K392008 (or whatever we have)
accaccacgcgcccctcgggccgccagttctccgacgacttcctgtggggctcggccacggcctcctaccagatc gagggcgcgcacgacgagggcggtcgcggcccgtcgatctgggacacgttctcccgcaccccgggcaaggtcctcaacggcgacaccggcgacgtcgcgg tcgaccactaccaccgcgtccccgaggacgtcgagatcatgaagagcctcggcctccaggcctaccggttctcgatcgcctggccccgcatccagccgac cggctcgggcgagttcaaccaggccgggctcgacttctactccgacctcgtcgaccggctcatcgccgccggcatcaagcccgtcgcgacgctgtaccac tgggacctcccgcagcccctggaggacgagggcggctgggcgaaccgcgcgacggcgtaccggttcgccgagtacgcgcgcaagctcgccgaggtcctcg gcaagcgcgtcgacctgtggaccacgctcaacgagccgtggtgctccgcgttcctcggctacgcctcaggcgtgcacgcccccggcgtcaccgacccggt caaggccctgcgcgccgtccaccacctcaacctcgcgcacggcctcgcgggccgcgcgatccgcgaggtcctcggcgagaacgcgcccgtctcgatcacg ctcaacctgcacgtgacgcgcgccgccgacgactccgccgactccgtcgaggccaagcgccgcatcgacaccatcgcgaacgaggtcttcctcggcccgc tgctcgacggcgagtaccccaaggaggtcttcgcggacaccgcgcacctcaccgactggtccttcgtcgagccgggcgacctcgagctcatccgcatccc gctcaccgtgctcggcgtcaactactactcgaccggccgcgtgaagaagggcagcgccgcgggcgccgacccgggcaagccgggccccgacggccaccgc gcctccgagcactcctcgtgggtcggcgccgacgaggtcgagtggctcccgcagcccggcccgcacaccgcgatgggctggaacatcgagcccgacggcc tcgtcgacctgctgctcgagctgcgcgaccgttaccccagccagcccctggcgatcacggagaacggtgccgcgttctacgacacggtcagcgaggacgg ccgcgtgcacgaccccgagcgcgtcggctacctgcacgaccacgtcgacgccgtcggcgaggccatcgacaagggcgccgacgtgcgcgcctacttcgtg tggtcgctgctcgacaacttcgagtgggcctacggctacgaccgccggttcggcatcgtgcgcgtcgactacgacacgcacgagcgcatcgtgaaggact cgggcctctggtaccgcgagctcgtgcgcacccgcaccatcgctccggccgaggacgccgcgacctaccagccctga
Enchanced Yellow Fluorescent Protein
gtgagcaagggcgaggagctgttcaccggggtggtgcccat cctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatc tgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgc acgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagtt cgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagc cacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgacc actaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaa gcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa
