Team:LMU-Munich/Primer Design

From 2011.igem.org

(Difference between revisions)
(→Introduction)
 
(10 intermediate revisions not shown)
Line 1: Line 1:
<!-- Include the next line at the beginning of every page -->
<!-- Include the next line at the beginning of every page -->
{{:Team:LMU-Munich/Templates/Page Header}}
{{:Team:LMU-Munich/Templates/Page Header}}
-
 
+
<div class="fullbox">
==Introduction==
==Introduction==
-
With these tools we would like to ease the design of primers for a Biobrick.
+
Our aim with these tools is to assist the user with primer design for coding and non coding Biobricks. In order to achieve this we chose two slightly different approaches for designing coding and noncoding Biobricks. While only one input sequence is needed in order to design a coding biobrick we chose to use flanking regions of the sequence of a non doding biobrick. The reason herefor is that using flanking regions of a non coding sequence which is supposed to be amplified enables the possibility to create a broad range of primers which meet the necessary criteria for a working primer.
-
In case you find any bugs or have any comments, suggestions or questions please feel free to email us at
+
Hence we created ''Adjacent Regions'' and ''Design Primers''.
-
lmuprimer@googleemail.com
+
-
We provide two main functions and hope that these can help you during primer design.
 
-
===Adjacent Regions===
+
''Adjacent Regions'' finds upstream and downstream sequences of the desired target sequence which can be used for the design of non coding Biobricks. Besides the source genome of the to be amplified biobrick the user has the option to choose cutoff rates for the downstream region as well as the upstream region.
-
The main idea behind Adjacent Regions is that in case you would like to design a non coding Biobrick you can easily find
+
Click [https://2011.igem.org/Team:LMU-Munich/Primer_Design/Adjacent here] to use ''Adjacent Regions''.
-
adjacent regions of your Biobrick in the original host genome.  
+
-
As options we provide the host genome as well as cutoff rates for the adjacent regions. The input would be the sequence of your Biobrick.
 
 +
Using these upstream and downstream sequences the user can design primers for non coding Biobricks with ''Design Primers''.
-
===Design Primers===
+
Click [https://2011.igem.org/Team:LMU-Munich/Primer_Design/Design_Primers here] to use ''Design Primers''.
 +
''Design Primers'' is also able to design primers for coding sequences. Here the only needed input is the coding sequence of the Biobrick. ''Design Primers'' also has a number of options:
 +
* The length of the annealing region of the primers.
 +
* The Biobrick standard.
 +
**  You can choose between the "Classic" Biobrick standard and the "Freiburg" standard.
 +
* Whether to check for enzyme restriction sites in the input sequence or not.
 +
**  You can choose between all known restriction sites, only those used in the two Biobrick standards or none at all.
-
====General Overview====
+
For coding sequences ''Design Primers'' varies the primer length between 15 und 35 bp and names only those potential primers which and with a G/C on the 3' end.
-
Design Primers will provide you with several suggestions for primers and name soem of their properties which it determines. Only those primers are named which are not selfannealing and do not have a G or a C at the end of the sequence. Tm values are determined based on the Wallace Rule, potential Loop sites are named and the GC content of the annealing part of the primer is determined.
+
-
You will have to give either the Coding sequence of your Biobrick as an input in case you would like to create primers for a coding Biobrick or the flanking sequences of your Biobrick in case you would like to design a non codign Biobrick.
+
For non coding sequences ''Design Primers'' uses the by the user set primer length and finds all possible primers within the upstream and downstream regions. It checks every primer for selfannealing and uses only those which are predicted to be not selfannealing.
 +
Additionally for all input sequences the Tm (based on the Wallace rule) and GC content of the annealing region are being determined and named. Further on the 3' ends of the primers are being checked for having a G/C at the end and for potential terminal Hairpins. In case a potential Hairpin has been found the script adds HAIRPIN!?-X-Y to the output. Here X is the number of the nucleotides which compose the loop while Y is the number of the nucleotides which are adjacent to the loop forming nucleotides and potentially annealing.
-
As options you can choose the length of the annealing part of the primers and the Biobrick format: Either the "classic" Biobrick or the Freiburg standard. You can also have your input sequences checked for restriction enzyme binding sites. Here you can choose whether to check for all known restriction enzymes, only those used in Biobricks or non at all.  
+
 
 +
An example Output:
 +
 
 +
{|
 +
|-
 +
|FORWARD
 +
|GAATTCGCGGCCGCTTCTAGATGGCCGGCACGTCAGATCGACTACG
 +
|52 
 +
|0.52   
 +
|HAIRPIN!?-4-2
 +
|-
 +
|1                               
 +
|2                       
 +
|3       
 +
|4       
 +
|5
 +
|-
 +
|}
 +
<!--{{spaces|4}} 1 {{spaces|40}} 2 {{spaces|4}}  3{{spaces|4}}    4{{spaces|4}}    5 -->
 +
 
 +
 
 +
# Kind of primer.
 +
# Primer; in this case the Freiburg standard.
 +
# Tm.
 +
# GC Content.
 +
# Hairpin warning; in this case the very last CG nucleotides might anneal with GC and form a loop of ACTA.
 +
 
 +
 
 +
The input format for both tools can be a fasta sequence with or without a header. Sequences including nucleotide counters are also supported.  
 +
 
 +
In case you find any bugs or have any comments, suggestions or questions please feel free to email us at
 +
lmuprimer(at)googlemail.com
-
====How to interpret the results====
 
-
You will be given a set of potential primers for both the forward primer as wells as the reverse primer.
 
-
Next to the primer is the determined value of Tm.
 
-
Next to the Tm value is the GC content.
 
-
And as the very last value a potential Hairpin is being named.
 
-
E.g. HAIRPIN?!7-4 would mean that there are 4 nucleotides at the very end of the sequence of the primer which might bind 4 other nucleotides after a loop of 7 nucleotides.
 
 +
</div>
<!-- Include the next line at the end of every page -->
<!-- Include the next line at the end of every page -->
{{:Team:LMU-Munich/Templates/Page Footer}}
{{:Team:LMU-Munich/Templates/Page Footer}}

Latest revision as of 23:04, 21 September 2011


Introduction

Our aim with these tools is to assist the user with primer design for coding and non coding Biobricks. In order to achieve this we chose two slightly different approaches for designing coding and noncoding Biobricks. While only one input sequence is needed in order to design a coding biobrick we chose to use flanking regions of the sequence of a non doding biobrick. The reason herefor is that using flanking regions of a non coding sequence which is supposed to be amplified enables the possibility to create a broad range of primers which meet the necessary criteria for a working primer.

Hence we created Adjacent Regions and Design Primers.


Adjacent Regions finds upstream and downstream sequences of the desired target sequence which can be used for the design of non coding Biobricks. Besides the source genome of the to be amplified biobrick the user has the option to choose cutoff rates for the downstream region as well as the upstream region.

Click here to use Adjacent Regions.


Using these upstream and downstream sequences the user can design primers for non coding Biobricks with Design Primers.

Click here to use Design Primers.

Design Primers is also able to design primers for coding sequences. Here the only needed input is the coding sequence of the Biobrick. Design Primers also has a number of options:

  • The length of the annealing region of the primers.
  • The Biobrick standard.
    • You can choose between the "Classic" Biobrick standard and the "Freiburg" standard.
  • Whether to check for enzyme restriction sites in the input sequence or not.
    • You can choose between all known restriction sites, only those used in the two Biobrick standards or none at all.

For coding sequences Design Primers varies the primer length between 15 und 35 bp and names only those potential primers which and with a G/C on the 3' end.

For non coding sequences Design Primers uses the by the user set primer length and finds all possible primers within the upstream and downstream regions. It checks every primer for selfannealing and uses only those which are predicted to be not selfannealing.

Additionally for all input sequences the Tm (based on the Wallace rule) and GC content of the annealing region are being determined and named. Further on the 3' ends of the primers are being checked for having a G/C at the end and for potential terminal Hairpins. In case a potential Hairpin has been found the script adds HAIRPIN!?-X-Y to the output. Here X is the number of the nucleotides which compose the loop while Y is the number of the nucleotides which are adjacent to the loop forming nucleotides and potentially annealing.


An example Output:

FORWARD GAATTCGCGGCCGCTTCTAGATGGCCGGCACGTCAGATCGACTACG 52 0.52 HAIRPIN!?-4-2
1 2 3 4 5


  1. Kind of primer.
  2. Primer; in this case the Freiburg standard.
  3. Tm.
  4. GC Content.
  5. Hairpin warning; in this case the very last CG nucleotides might anneal with GC and form a loop of ACTA.


The input format for both tools can be a fasta sequence with or without a header. Sequences including nucleotide counters are also supported.

In case you find any bugs or have any comments, suggestions or questions please feel free to email us at lmuprimer(at)googlemail.com



Retrieved from "http://2011.igem.org/Team:LMU-Munich/Primer_Design"