Team:TU Munich/lab/notebook/part3

From 2011.igem.org

(Difference between revisions)
Line 645: Line 645:
<div class="cloning">
<div class="cloning">
<h4><span class="mw-headline" id="AND-Gate">AND-Gate</span></h4>
<h4><span class="mw-headline" id="AND-Gate">AND-Gate</span></h4>
-
<p>Minipreps of picked cones on 12-09-11 were done according to Metabion's instructions. Concentrations:</p><p>2a: c = 34.5 ng/µl</p><p>2b: c = 68.0 ng/µl</p><p>3a: c = 118 ng/µl</p><p>3b: c = 65.0 ng/µl</p><p>5a: c = 122 ng/µl</p><p>5b: c = 71.5 ng/µl</p><p>6a: c = 122 ng/µl</p><p>6b: c = 119 ng/µl</p><p>6c: c = 51.0 ng/µl</p><p>After restriction digest using E and P, samples were separated on a 0.8&nbsp;% gel:</p><p><a href="/wiki/index.php?title=File:110913_analytischer_verdau_and-gate_Thorsten.jpg" class="image"><img alt="110913 analytischer verdau and-gate Thorsten.jpg" src="/wiki/images/5/51/110913_analytischer_verdau_and-gate_Thorsten.jpg" width="300"  /></a></p>
+
<p>Minipreps of picked cones on 12-09-11 were done according to Metabion's instructions. Concentrations:</p><p>2a: c = 68.5 ng/µl</p><p>2b: c = 68.0 ng/µl</p><p>3a: c = 118 ng/µl</p><p>3b: c = 65.0 ng/µl</p><p>5a: c = 122 ng/µl</p><p>5b: c = 71.5 ng/µl</p><p>6a: c = 122 ng/µl</p><p>6b: c = 119 ng/µl</p><p>6c: c = 51.0 ng/µl</p><p>After restriction digest using E and P, samples were separated on a 0.8&nbsp;% gel:</p><p><a href="/wiki/index.php?title=File:110913_analytischer_verdau_and-gate_Thorsten.jpg" class="image"><img alt="110913 analytischer verdau and-gate Thorsten.jpg" src="/wiki/images/5/51/110913_analytischer_verdau_and-gate_Thorsten.jpg" width="300"  /></a></p>
<h4><span class="mw-headline" id="Vector_prep_pSB1A3_and_pSB1C3">Vector prep pSB1A3 and pSB1C3</span></h4>
<h4><span class="mw-headline" id="Vector_prep_pSB1A3_and_pSB1C3">Vector prep pSB1A3 and pSB1C3</span></h4>
<dl><dd>The restricted vectors ID10 pSB1A3 and ID12 pSB1C3 from 30-08-2011 were applied onto a 1&nbsp;% agarose gel and prepped using the Wizard SV gel purification kit.</dd></dl>
<dl><dd>The restricted vectors ID10 pSB1A3 and ID12 pSB1C3 from 30-08-2011 were applied onto a 1&nbsp;% agarose gel and prepped using the Wizard SV gel purification kit.</dd></dl>

Revision as of 10:29, 19 September 2011

Cloning Part III Alex/Simon/Bea/Thorsten/Anna

24-08-2011

People: Alex, Simon, Bea, Thorsten

Cloning

Ligation

Three ligations in total were conducted. K238013 (S,P) was quick-ligated with lacZ (X,P), rbs (S,P) with T7Pol (X,P) and T7Prom (S,P) with lacZ (X,P).

Transformation

The ligations were transformed into DH5alpha. Additionally, K238013 (from23-08-2011) was transformed into DH5alpha. The ligation of K238013 with lacZ is plated onto Amp and Cm, rbs with T7pol is plated onto Amp, T7Prom with lacZ onto Kan and K238013 is plated onto Amp and Cm.

Testing

The two cultures of K322127 in DH5alpha incubated over night with red light (ca. 630 nm) were split. One half was further incubated with red light, while the other half was incubated with sun light and light from a table-lamp over night.

Test of negative controls on S-Gal: T7prom (Kan) transformed into DH5alpha and K322127 (Cm) transformed into BL21 were inoculated onto S-Gal plates with the respective antibiotics. The are incubated over night, and should not yield black colonies, as they both should not be able to express functional lacZ.

Results

Expression test of reporter plasmid: The cultures with ligation of T7prom and lacZ transformed into BL21 and induced with IPTG showed black colonies on the S-Gal plates. However, the cultures, which were NOT induced also showed black colonies of the same intensity. At the current point, we cannot sufficiently explain this.

Red light sensor assembly (Bea and Thorsten)

aim:

Ligation of red light sensor didn't work, yet. Therefore we ligated PCR product of BBa_K322127(X and P cut) into pSB3C5(S and P cut) to verify correct sites. Subsequent amplification and recutting of this part should lead to correct ligation with SupD.

In parallel, PCR was performed again in case of failed ligations with existent PCR-products.


Materials:

digest:

pSB3C5: S and P cut by Alex on 23.08.11, CAM resistance, 2,7 kbp vector backbone

PCR product of BBa_K322127 with primers BBa_K568000, derived from Biomers, sequence see below, 3,8 kbp (Florian 6.7.11 labelled with "K322127 PCR product aus gel ausgeschnitten")


pcr:

Template: BBa_K322127 ("Edinburgh part") conc: 150 ng/µl

primers (synthesized by biomers, 29.6.11, stock: 100µM):

BBa_K568000_fwd: tatatctatatcgaattcgcggccgcttctagagtttacggctagctcagtcctaggta (59bp)
BBa_K568000_rev: cgtgccggcggctgcagcggccgctactagtaagtccattctccccaaaaatg (53bp)


Procedure

digest:

10 µl PCR Product was cut with 1 µl XbaI and 1 µl PstI in 5 µl NEB4-buffer (total volume 50 µl) for 2h at 37°C with subsequent heat inactivation at 80°C for 20 minutes. Cut PCR-product was loaded on a 1% Agarose Gel in TAE buffer and run at 120 V for 1 h.

PCR:

amplification with Taq PCR Kit (NEB) according to Florian at 5.7.11. No water control was run due to lacking remaining buffer volume.

5 µl 10x standard buffer
1 µl dNTP's
0,25 µl Tag DNA polymerase
0,5 µl primers, respectively
0,4 µl Template DNA
add up to 50 µl with sterile water


PCR-program:

see 5.7.11


Bands were cut from Gel and DNA was isolated using Squeeze N Freeze (protocol see Methods)


Results

240811 pcr cutXP new pcr edited.jpg

1% Agarose Gel of new PCR-product (line 3) and cut PCR-product (line2) with 2 log ladder (line 1)


cut PCR Fragment with correct size (3,8 kbp) was frozen after isolation. PCR yielded some short products with variable length. Used PCR-Kit is not suitable for amplification of long fragments. Experiment will be repeated tomorrow with correct Kit.

25-08-2011

People: Alex, Simon, Bea, Thorsten

Cloning

Digestion

R2 (red writing: MiniPrep iGEM R2 31.5.11) was digested with X,P and T7prom (black writing: 17.6.11 T7) with S,P. After heat-inactivation, GLP was added to the digested DNA. The samples were applied onto a 1 % Agarose gel. The samples, along with those from the PCR (see below), were applied as follows: 2lod DNA ladder (5 ul); R2 (20 ul); R2 (20 ul); T7prom (20 ul); T7 prom (20 ul); PCR cut; positive control; PCR approach 1; PCR approach 1; PCR approach 2; PCR approach 2; PCR approaches 1 and 2 pooled. The gel was run for 1:30 h at 110 V. The following bands were expected: 3.1 kbp for lacZ with rbs and 2 kbp for vector pSB1A2. 3.4 kbp for T7prom in pSB1AK8. The bands are excised from the gel and the DNA is recovered using freeze 'n squeeze.

250811 restriction and PCR Alex Thorsten-1.jpg

The original file before cutting of the bands seems to be corrupt.

Ligation

In the next step, K238013 (from 23-08-2011; cut with S,P) was ligated with rbs&lacZ (=R2; X,P), rbs (from 22-08-2011; S,P) with T7pol (from 23-08-2011; X,P) and T7prom (S,P) with rbs&lacZ (X,P). Each time, ligation was performed as normal and as quick-ligation. After that, the transformed cells were plated onto LB (Amp) plates and incubated over night.

New PCR of K322128 using Phusion High-Fidelity PCR-Kit (NEB/Finnzymes)

Material

BBa_K322127 with primers BBa_K568000, derived from Biomers, 3,8 kbp cut vector pSB1A2 digestion with X,P from Alex on 25.8.2011 (Florian 6.7.11 labelled with "K322127 PCR product aus gel ausgeschnitten")

Procedure

using same protocol as Florian on 11.7 

PCR-Program:

1) Initial Denaturation: 98°C, 4'

2) 30 cycles of:

   Denat.: 98°C, 30 s
   Annealing: 60°C, 15 s
   Extension: 72°C, 2´ 30 s

3) Final extension: 72°C, 8'

4) Hold: 4°C, oo

samples

only 2 samples were prepared using each:

35,5µl of ddH2O 10 µl5x buffer 1 µl dNTPS 1 µl of template DNA K322127 (1,5ng/µl ) 1 µl of Primer fwd (10µM) 1 µl of Primer rev (10µM)

only the 10kB positive control was done:

34µl of ddH2O 10 µl5x buffer 1 µl dNTPS 1 µl of template DNA (template for positive control) 2,5 µl of Primer (10kB-Mix)


after pcr the samples were applied on a 1% Agarose-gel

The bands are excised from the gel and the DNA is recovered using freeze 'n squeeze.

two times 10µl of the PCR product were digested with X,P

the digestion and the pcr product were stored at -20°C

Ethanol precipitation of digested PCR product

Material: PCR product cut with X,P from the 24.8.2011 protocol see Methods the sample was applied on an agarose gel because the nanodrop indicated no DNA

Result

The gel showed that no DNA was yielded (see picture Restriction & Ligation)

Repeated Digest and Ligation of PCR Product

Material: PCR product of BBa_K322127 with primers BBa_K568000, derived from Biomers, 3,8 kbp cut vector pSB1A2 digestion with X,P from Alex on 25.8.2011 (Florian 6.7.11 labelled with "K322127 PCR product aus gel ausgeschnitten") Procedure: The PCR product was digested with X,P. After heat-inactivation, GLP was added to the digested DNA. The samples were applied onto a 0,8 % Agarose gel. The gel was run for 1:30 h at 110 V. The bands are excised from the gel and the DNA is recovered using freeze 'n squeeze. Ligation of the cut fragment with the vector pSB1A2 (cut with X,P; see Restriction & Ligation above) using quick ligation protocol see Methods

Result

25082011 verdau pcr produkt edited.jpg


Testing

SDS-PAGE

1 OD_600 each from the K322127 in DH5alpha cultures from yesterday was taken. The OD_600 were: 0.835 for the first colony exposed to bright lamp (bright 1); 0.84 for the second colony exposed to bright lamp (bright 2); 1.685 for the first colony incubated with red light (red 1); 1.855 for the second colony incubated with red light (red 2). The cells were centrifuged at 13000 rcf for 8 min. After resuspension in 100 ul loading buffer, the tubes were incubated for 10 min at 95 °C. After that, the samples (5 ul and 10 ul) were loaded onto a 10 % SDS-PAGE with stacking gel. Pageruler was used as protein ladder. The gel was run for 2:00 h at 80 V, which was increased to 120 V when the buffer front reaching the separation gel. After that, the gel was stained with Coomassie blue and subsequently destained.

110825 SDS-PAGE von Alex.jpg

The gel does not show elevated intensities of the band at around 10 kDa for lacZ alpha peptide, which would have been expected.

T7 promoter in vitro assay

As proposed yesterday, a second in vitro assay was performed to find out if the plasmids contain a T7 promoter. This time, a third sample was made for each plasmid (same plasmids as yesterday, see above). In this sample (labeled "#xi") the RNase that we assume to be present were inhibited using RNA secure prior to addition of T7 polymerase and incubation. See methods for detailed procedure. The 2% agarose gel was run at 110 V, 400 mA for 1:30 hours.

Other Work

K322127 Inoculation & Incubation:

The following inoculations were performed:

- "K238013 in DH5 alpha", plate date: 24.08.2011, yesterday's transformation, in LB Amp

- "BM28 from Jeanette Winter", plate date: 31.05.2011, in LB Amp, Kan

- "green light 2", plate date: 27.6.2011, in LB Cm

- "green light 3", plate date: 27.6.2011, in LB Cm

- "green light 4", plate date: 27.6.2011, in LB Cm

- "K322127 in DH5 alpha, Kolonie 1, Licht-induziert", plate date: 22.08.11, in LB cm (the picked colonies were the black ones after over night incubation in light)

- "K322127 in DH5 alpha, Kolonie 2, Rotlicht-deaktiviert", plate date: 22.08.11, in LB cm (the picked colonies were white ones after over night incubation in red light)

Incubation over night at 37 °C, 200 rpm.

Results

The PCR was successful (see picture Restriction & Ligation), the positive control and both samples yielded DNA that is located at the right spot according to their length positive control (10kB) samples (3,8kB)


Results

24.08.11

T7 promoter in vitro assay


250811 invitroassay3bearbeitet.jpg


The samples labeled "#xi" were treated with RNA secure to inhibit potentially present RNase. The gel photo shows blurry signals in all of these lanes which aren't visible in lanes "#x" and "#xa". This proves that RNase is present in the DNA samples used in the assay. Also, the fact that the RNA signals are quite large and strong shows leads us to the conclusion that the examined plasmids all contain a T7 promoter. Sample 1 contains two plasmids (about 6.6 kb and 3.5 kb) which is the reason for the bad sequencing data. Samples 2, 3, 5 and 6 contain one 6.6 kb plasmid each. This should be our correct reporter plasmid, part 2b, containing T7 promoter and lacZ. To verify this, a sample shall be sequenced.

S-Gal negative Control:

DH5alpha cells transformed with T7prom yielded white colonies on the S-Gal plates. However, BL21 cells transformed with K322127 yielded all black colonies. Most likely, our strain of BL21 is unsuited for expression tests using S-Gal (might constitutively express lacZ).

Expression test of K322127

After over night incubation, both plates incubated in red light showed white colonies only. Of the two plates incubated under the lamp, one did not show any colonies. The other one showed black colonies. --> First evidence that part K322127 works as expected!!! To further quantify and characterise this: Miller assay? Other methods?

240811 K322127inDH5alpha Kolonie2.jpg

26-08-2011

People: Alex, Simon, Bea, Thorsten

Other Work

Part-request: Parts requested from the registry for backup if the ligation of the PCR product will fail again:

Part Team Library Plate Well Plasmid Resistance
BBa_K322123 iGEM10_Edindburgh 2010 Submisions Samples 001 Shipment: 00694 4D pSB1C3 C
BBa_K322124 iGEM10_Edindburgh 2010 Submisions Samples 001 Shipment: 00694 4E pSB1C3 C

And Gate plasmid: PCR-Product from Edinburgh

New media and plates: LB, LB for Agar plates (Kan and Amp?) and Luria medium were prepared. Plates were prepared.

Sequencing:

The reporter plasmid clone 5 was handed in for sequencing at GATC-Biotech. The primer used for sequencing is "Primer pSB1A2 und pSB1AK8 fwd".

Skype talk with iGEM Team Freiburg

Cloning

Miniprep & Glycero-Stock: The cultures inoculated yesterday on LB were frozen at -80 °C as glycero-stocks. The culture of K238013 (pSB1A2) in DH5alpha was prepped. The resulting DNA yielded a concentration of approximately 300 ng/ul.

Repetition of transformations:

The transformations from yesterday (ligation using ligation protocol) were repeated using DH5alpha cells (kindly provided by Andrea). Transformations were done for reporter plasmid (part 2b) colony 5 from DATUM, K238013 with lacZ, rbs with T7pol and T7prom with lacZ. After incubation for one hour, the cells were plated on LB Amp (K238013 with lacZ; rbs with T7pol) and on LB Kan (reporter plasmid; T7prom with lacZ) and incubated over night.

Ligation of new PCR product with pSB1A2

Material:

cut PCR (X,P) product from K322127 from PCR 25.8.2011 cut pSB1A2 (X,P) from Alex from 25.8.

procedure:

we purified PCR product using Zymo DNA Clean +Concentrator 25

ligation:

sample 1: 15µl PCR product 5µl vector sample 2: 10µl PCR product 10µl vector

Transformation of the ligation and R2 as transformation control:

the two samples from purifiying and the part R2( OmpR in pSB1A2) as a positive control were transformed via electroperforation in competent DH5alpha cells that were kindly supplied by Andrea Mückl.

Testing

Testing K322127

Material: inoculated cultures of DH5alpha with K322127 from 25.8 Procedure: 100 µl of the culture was spread on S-gal plates with Kan and amp in dark Incubation of the plates at room temperature (30°C) under light of diode with maximum of 630nm (turn-off diode) for 2 hours afterwards incubation at light at 37°C for 19 hours afterwards 4°C in the incubator: one culture with aluminium TUM logo put on top one culture in the box under light of turn-off diode (negative control) one culture on top of the box, light from turn-off diode from below, light from the incubator from top only on cut out TUM logo in aluminium foil

Results

26-08-2011

Transformations: The transformations from yesterday, including K238013 & lacZ, rbs & T7pol, T7prom & lacZ as well as PCR product & Vector, did not work at all. There were no colonies on the plates.

Sequencing: More data from the sequencing from 19-08-2011 arrived. The newly ligated K238013 & double terminator from 17-08-2011 does contain the double terminator. However, as witnessed before, the blue light promotor K238013, which was part of the plasmid prior to ligation, is missing. We are still awaiting the data from another sequencing from the same construct, but from another ligation.

Planning for next week: We need to prepare new electrocompetent DH5alpha cells. EVERYONE, who has free time to spare, please come to the lab and help. We might also be able to get new BL21 (DE3) cells from Prof. Buchner. If anyone wants to get them, contact Lars Mitschke at the Lehrstuhl of Prof. Buchner and talk to him about the request, which Alex asked about. BL21 (DE3) contain a T7polymerase, which can be induced by IPTG. This would be great use in order to test our reporter plasmid, i case the ligation worked (which we should know on Monday).

29-08-2011

Cloning

inoculation the following were inoculated: T7 Promotor with lacZ 2x K322127 in DH5alpha

Retransformation of reporter plasmid clone 5

the reporter plasmid clone 5 (118ng/µl) was diluted to 50 pg/µl and to 20 ng/µl

1 µl of each dilution was transformed into DH5alpha


Transformation of RBS

0,42 µl of RBS (47,5 ng/µl) were transformed into DH5alpha

Results

26-08-2011

transformations

were only successful for R2, T7 Promotor with lacZ, reporter plasmid colony 5

testing of K322127

only very small colonies on the plate with no coloring plate that was illuminated with turn-off light and light from the incubator dried out. no black colonies could be detected. Incubation of plate with TUM pattern was continued. Plate was irradated with a light bulb.

sequencing of reporter plasmid colony 5

Sequencemixedclone.jpg

Bases in squared brackets are optional and belonging to another sequence. Due tu overlapping base shifts exact assignment of bases is difficult

Sequencemixedclonechromatogram.jpg

Sequencing reveals mixed clones. Correct Sequence with T7 promotor - RBS – lacZ is probably present beneath construct with T7 promotor lacking. Preparation of RBS-LacZ vector was contaminated with uncut or religated vector. Since plasmid length was ok, construct should be present.

next steps:

Retransformation with 50 pg and 20 ng MiniPrep DNA will be performed with subsequent sequencing of 4 clones. In parallel new construct from Alex will be sequenced.

30-08-2011

People: Thorsten, Bea

Results

29.8.11

Re-Transformation of part 2b clone 5 with 20 ng vector was succesful. 50 pg vector didnt yield any colonies. RBS was tranformed succesfully. 5 ml LB o/n cultures with apropriate antibiotica were inoculated and incubated at 37° C shaking. Mini Prep and sequencing will be performed at 31.8.11

Cloning

Electrocompetent cells

new electrocompetent cells (DH5alpha) were made by the following protocol:
a 20 ml Luria medium overnight culture was inoculated with electrocompetent DH5alpha (kindly provided Andrea Mückl) yesterday
350 ml Luria medium were inoculated with 15 ml of the overnight culture and incubated at 37°C until a OD(600) of 0,7 was reached
the medium was distributed on falcons and the cells were centrifuged at 4500 rpm for 20 min at 4°C
after discarding the supernatant 350 ml of sterile ice-cold 10% glycerol was added and the pellets were resuspended using a pipet
the resuspension was centrifuged at 4500 rpm at 4°C for 11 minutes
after discarding the supernatant the cells were resuspended again in 350 ml of ice-cold 10% glycerol ( cells kept chilled all the time)
and again centrifuged at 4500 rpm at 4°C for 11 minutes
the supernatant was discarded and the cells were resuspended in the remaining supernatant
the cells were dispensed in 40 µl aliquots and stored at -80°C for further use

Planning

In order to get ligations working, purification steps will be performed using Promegas Wizard PCR and Gel clean up Kit. We are going to ligate PCR product into pSB1C3 and upstream of SupD-tRNA. In parallel, T7ptag will be ligated into AND-Gate Plasmid, which will be pSB1C3. [First step of assembly]

Then, synthesis product, which contains parts from SupDtRNA to RBS J44001, will be ligated into succesful AND-Gate Plasmid-T7ptag. The last step will be ligation of PCR-product into this construct.

Excel sheets can be found in DropBox folder "protocols".

planned parts

PCR product ligated into pSB1C3 will be a new part "red light sensor without lacZ".

PCR product ligated with SupD will be a new part as well.

Synthesis product is another maybe not so useful part which will be send into the registry.

Reporter plasmid will be another Part. This one was called "part 2B" in recent cloning steps and needs further validation (see 29.8. retransformation and sequencing)

Restriction digest

Digest 30811 tho.jpg


300811 digestions tho.jpg


All digestions were complete and running on the expected lengths.

Purification of restricion digests from gel with Wizard Kit

the following items were purified using the Wizard Kit according to manufacturer's instructions and the concentration was determined by nanodrop:

1: 24,5 ng/µl

2: 24,5ng/µl

3: 24,5 ng/µl

5: 20,5 ng/µl

9: 20,0 ng/µl

10: 23 ng/µl

11: 21,5ng/µl

12: 29,5 ng/µl

13: 20,0 ng/µl

for more details see restriction digest table

Inoculation

the following overnight cultures were inoculated:

RBS reporter plasmid clone 1-5 K322127 from plate from 24.8.2011

31-08-2011

Results

30.8.11

Electrocompetent cells show good transformation efficiency. 100µl 10µl and 1µl of test transformation of 30 ng BBa_K322127 were plated on LB/cam plates. 1 µl yielded ca 400 colonies which refers to a tranformationefficiency of 1.3*10^7 cfu/µg BBa_K322127 in pSB1C3. 1*10^8 cfu/µg pUC19 is expected, so 1.3*10^7 cfu/µg vector with insert seems to be ok.

cph8 from Uppsala was succesfully transformed into DH5alpha. Cells have been 1:3 diluted and 20 ng plasmid was used. Output was ca 10^6 - 10^7 cfu/µg. Plate will be stored at 4°C til inoculation of o/n culture with subsequent minipreparation.

Cloning

Ligation

31811 ligation tho.jpg

Minipreparation of DNA

The following concentrations were gained through minipreparation:


RBS  : 86,5 ng/µl

reporter plasmid clone 1: 135 ng/µl

reporter plasmid clone 2: 234 ng/µl

reporter plasmid clone 3: 102 ng/µl

reporter plasmid clone 4: 119 ng/µl

reporter plasmid clone 5: 96 ng/µl


The reporter plasmid clone 1-5 were sent to be sequenced at GATC.

Testing

the overnight culture of K322127 was used to inoculate a 100 ml culture in LB which was incubated for 5 hours at 37°C

at an OD of 1.6 50 ml of the cells were centrifuged at 4500 rpm the supernatant discarded

the cells were resuspended in remaining 1 ml of LB

100 ml of LB media with s-gal was prepared and autoclaved according to protocol see Methods

the resuspended cells were added to the medium when it reached 40°C

the media was given in thee plates

two plates were incubated at 37°C under turn-off light (diode max. 630 nm)

the TUM cookie cutters were inserted in one plate that was then incubated under the light of a lamp

Other Work

new chloramphenicol plates were made


01-09-2011

Cloning

gel purification of 30.8.11 digest

20 µl of remaining digestions (made on 30.8.11) were loaded on 1 % agarose gel with 1xTAE. Items 1,2,3,4,5,6,7,8,9,10,12 were used. This samples were cut using 350nm UV illumination as short as possible. Cut gel slices were subsequently purified using Promegas Wizard Kit according to manufacturers instructions.


010911 digestions thorsten cut.jpg


Determination of concentration with Nanodrop resultet in not reliable data. Therefore quantitative 0.7 % agarose gel was run with 5 µl of each sample. 5 µl 2 log ladder was used (100 µg/ml). PCR Band (3.8 kbp) in line 2 was estimated to 75 ng. This gives aproximately 15 ng/µl. Intensities of 2 kbp band in line 4 as well as lines 5, 6, 7, 10 and 11 correspond to approx. 150 ng amount (--> 30 ng/µl).


010911 quantitative gel.jpg


Due to fly-by-night intensity of ladder those concentrations will be determined again on 02.09.11 for further ligations. Ligations today will be done with the following concentrations


110901 concentrations analytical gel tho.jpg


o/n ligation with T4 Ligase

110901 ligation tho table.jpg


P, S opened Vector containing blue light promotor was ligated with RBS-LacZ insert. Due to huge insert lengths, insert:vector ratios were choosen as can be seen in ligation table.


Ligation was conducted at 16° C in thermocycler o/n using 20 µl sample volume and 1 µl T4 DNA ligase. Examplary calculation of I/V ratio for 6x molar excess of insert (source: http://openwetware.org/wiki/DNA_Ligation):


Ratio calculation.png

Testing

inoculation of two cultures with 5 µl of the glycerol stock of K322127 in DH5alpha

the cultures were incubated at turn-off light (diode max. at 630 nm) at 37°C

new transformation of K322127 (150ng/µl) 0,5 µl were used

Testing

Preparing lacZ-ONPG or also called Miller Assay

MillerAssay.jpg

Other Work

Part design in the registry

edit the general information of the part : http://partsregistry.org/wiki/index.php?title=Part:BBa_K568000&action=edit

others

the primer for the sequencing of reporter plasmid clone 1-5 from yesterday is sent to GATC

Lars Mitschke kindly provided the E. coli strain BL21 (DE3), this strain contains a T7 Polymerase which can be induced with IPTG.

Results

31-08-2011

transformations

no colonies on the plates for all ligations

testing of K322127

the plate that was incubated under light showed no coloring but the plate became intransparent which indicates that the bacteria grew

plates incubated under turn-off light (diode max. 630 nm) became intransparent as well; this plates were used for further testing ( see testing of K322127 )

02-09-2011

Cloning

Digest of T7 promoter

020911 digest tho.jpg


Full volume of digest was loaded onto gel (50 µl digest + 10 µl 6 x Gel loading buffer)


020911 digest T7prom cut gel.jpg


Band with correct size of 3,5 kbp was cut using 365 nm illumination. Illumination time was kept as short as possible, picture was taken after cutting gel slice.

Gel purification of T7 promotor

Band was purified using Promega's Wizard Gel purification Kit according to manufacturer's instructions. Eluted DNA was subsequently quantified with an analytical 0.7 % agarose gel (120 V for 45 min)


020911 quantitative gel tho.jpg


Band in line 2 corresponds to 120 ng band of marker. Therefore concentration of purified T7 promoter is approx. 24 ng/µl. RBS_lacZ band is approx. 20 ng/µl and pSB1C3 band approx. 16 ng/µl

Ligation of Reporter Plasmid

digested T7 promoter was ligated with RBS_lacZ from 1.9.11 purification.

Ligation was conducted o/n at 16°C.

110902 ligation tho table.jpg

Other Work

Agar Plates

500 ml of media for ampcillin plates

250 ml of media for s-gal plates were prepared

Cloning

Transformation

the ligations from 01-09-2011 (1-7) were transformed into DH5alpha as a transformation control 0,5 of R2 (233ng/) was transformed into DH5alpha

Testing

preparing ONPG assay

ONPG solution (4mg/ml)

1 M Na2CO3 were prepared

Overnight Cultures

new overnight cultures of the new transformation of K322127 (see 01-09-2011) were inoculated

Results

01-09-2011

Testing K322127

no coloring on plates


03-09-2011

People: Bea, Thorsten, Susan, Wolfgang

Other work

Cloramphenicol stock was produced: 30 mg/ml final concentration in 100% ethanol. 153 mg + 5,1 ml 100% EtOH. 500 µl aliquotes were stored at -20°C.

Cloning

Precipitation of Ligations and Transformation

Todays Transformation were done after purifing ligation mix with Glycogen/Ethanol precipitation in order to increase transformed amount and purity of ligated vectors.

All Ligations of 02-09-11 and following items of 01-09-11 ligation were used:

1 (pos control pSB1A3single cut (10))
2 (PCR(1)-pSB1C3 linearized (3))
4 (T7ptag(1)-pSB1C3 (12))
6 (blue light(8) - lacZ(9))


Glycogen/ethanol precipitation:


-20 µl of the ligation mixed with 2 µl NaAc (3M), 0.5 µl glycogen and 22.5 µl isopropanol
-incubation step for 1 h @ -20 °C
-15 mins @ 10.000 rpms
-withdraw supernatant
-wash pelett with 70 % EtOH ~ 10 µl
-dry pelett and resuspense in 10 µl water


Transformation via electroporation was done with the whole cleaned 10 µl in 40 µl DH5alpha cells.

Ligations of PCR product into pSB1C3 and pSB1A3

Following ligations were examined using an excess of vector and 1 µl PCR-product (corresponds to approx 14 ng/µl).


110903 ligation susan table.jpg


Items 1+2 were incubated at room temperature and items 3+4 were incubated at 37° C for 1h each. 5 µl of ligations were subsequently electroporated into 40 µl undiluted DH5alpha cells.

Results

02-09-2011

Testing

no coloring on plates

Cloning

Single cut vector control(1) showed approx. 50 colonies. ALl ligations plated on Cam plates (2-5) showed no colonies.

Blue light - RBS_lacZ ligations (6+7) showed 5 colonies overall. Clones were inoculated into 5 ml LB/Amp and incubated at 37°C o/n.

04-09-2011

People: Bea, Thorsten, Flo

Results

03-09-2011

Transformation of purified ligations (02-09-2011)

positive control showed several thousand red colonies. All ligations showed bacterial lawn, including vector control.


Vector prep contains uncut or single cut vector. This result is consistent with sequencing results, which indicate mixed clones. Next steps: Preperation of 46 bp T7 promoter insert with 3 % preparative agarose gel and ligation upstream of RBS_lacZ into opened RBS_lacZ vector. In parallel vector prep of T7 promoter will be repeated on 1% agarose gel with a long gel and run. Uncut and single cut vector will be loaded on gel aswell.

Transformation of 03-09-2011 ligations

showed following output:

110903 trafo susan table.jpg

pSB1A3 colonies were possibly red. --> incubated again o/n

http://partsregistry.org/Part:BBa_J04450 --> red color indicates religated or uncut vector clone


4 clones of each successful transformation were picked and inoculated into 5 ml LB medium containing the appropriate antibiotica.

Conclusion:

Further incubations should be done at RT for 1h or o/n at 16°C with subsequent gylkogen/ethanol purification and transformation of whole 10 µl resuspended pellet into 40 µl DH5alpha

Cloning

Reporter Plasmid

As recent transformation of reporter plasmid yielded high vector background new preps will be done according to following scheme.


digest

110904 digest tho.jpg

long 1% preperative agarose gel and 3% preperative agarose gel have been produced and stored in a plastic bag with some 1x TAE buffer at 4°C o/n. Purification will be done tomorrow.

Minipreps of picked clones of Bluelight_lacZ 01-09-11 ligation (items 6+7)

[Flo]

Miniprep of 5 o/n cultures [names below protocol] (Metabion Kit)

All centrifugation steps were performed at 13.000 rpm and RT

1. Pellet 2 x 1,5 ml of bacterial suspension in one 2 ml-Eppi, centrifuge for 1 min each

2. Add 250 ul Bact.resuspension buffer, vortex

3. Add 250 ul Cell lysis buffer, invert 5x, incub. approx. 4 min

4. Add 350 ul DNA binding buffer, invert 5x, centrifuge for 10 min

5. Transfer clear lysate on column, centrifuge for 1 min, discard supernatant

6. Add 600 ul Column Wash Buffer, centrifuge for 1 min

7. Transfer column to new 1,5 ml-Eppi

8. Add 50 ul nuclease-free water (from Promega Wizard Kit), incub. approx. 2 min, centrifuge for 1 min

9. Store at -20°C

names:

-Blue Prom + lacZ #1 (= former "blue lacZ Trafo 7, Klon 2")

-Blue Prom + lacZ #2 (= former "blue lacZ Trafo 7, Klon 1")

-Blue Prom + lacZ #3 (= former "blue lacZ Trafo 6, Klon 1")

-Cph8 in DH5a

-K322127

Preparing glycerol stocks from cultures used above

Prepare 50% glycerol/LB solution by mixing 2 ml 100% glycerol and 2 ml LB

Add 300 ul of 50% glycerol/LB solution to 700 ul bacterial suspension to obtain an end concentration of 15% glycerol

Store at -80°C

Restriction digest of 5 Minipreps from today

Each plasmid has been cut with EcoRI HF AND EcoRI HF + PstI HF (= 2 digests per plasmid) as follows:

-5 ul Plasmid DNA

-2 ul 10x NEB buffer 4

-0.5 ul EcoRI HF

-(0.5 ul PstI HF)

-12 (11.5) ul ddH2O

end volume is 20 ul

mix, spin down, incub. at 37°C for 1 hour, inactivate at 80°C for 20 min

Add 4 ul 6x loading dye

Store at -20°C until tomorrow

--> quantification on gel 05-09-11

Testing

ONPG-Test - Miller Assay

The assay was conducted following the protocol:

3 samples of K322127 in DH5alpha were assayed: 1 sample was incubated for 25 hours in the dark at room temperature 1 sample was incubated for 25 hours in the light at room temperature 1 sample was incubated for 25 hours in the turn-off light at room temperature


- inoculation of 4 x 2ml LB with 10 μl of overnight cultures of K322127 (see 02-09-2011)
- light induction when the cultures reach OD of around
- control with only LB

start of Assay:

- measurement of Abs(600nm)
- new eppi with 1 ml of Zbuffer + 20 μl of freshly prepared 0,1% SDS+ 40 μl of Chloroform (under fume hood)
- 100 μl of the samples are taken and transferred to the Zbuffer
- mix the solution by vortexing for 10 s
- let the chloroform settle to the ground and take 700 μl of supernatant for measurement
- initiation of assay with 140μl of ONPG (4mg/ml) NOTE START TIME
(in the paper they use 100 μl supernatant plus 20 μl of ( 4mg/ml but we need more for measurement in cuvette)
-incubation at room temperature until yellow color develops
-stop reaction with 350 μl of 1 M Na2CO3 NOTE STOP TIME (we upscaled the paper uses 50 μl)
- measurement of Abs (420nm) and Abs(550nm)

Abs 420 nm should be less than 1 and more than 0,5

Result

incubation for 146 min because no visible yellow color developed;

not completely clear how to calculate the miller units:

here miller units are calculated as following:

units= 1000* (Abs 420-1,75 Abs550) /(time(min)*Abs 600/(11,6*1,7)))

Results

Miller 4.9.jpg

Other Work

S-Gal plates

Flo did Minipreps of cph8 from Uppsala and K322127. Nanodrop yielded no reliable data. --> quantification on gel

05-09-2011

People: Bea, Thorsten, Anna

Testing

Miller Assay

5 newly inoculated cultures were assayed:

after 5 hours of incubation the inducation was started and the first assay started:

induction start means: incubation at room temperature of: K322127 in DH5alpha in the light of lamp K322127 in DH5alpha in the dark K322127 in DH5alpha in the turn-off light K322127 in BL21in the light cpH8 in DH5 alpha in the light

a new protocol was used for this assay:


start of Assay: - measurement of Abs(600nm)

- new eppi with 0,5 ml of Zbuffer + 20 μl of freshly prepared 0,1% SDS+ 40 μl of Chloroform (under fume hood)

- 0,5 ml of the samples are taken and transferred to the Zbuffer

- mix the solution by vortexing for 10 s ( all samples equal vortexing time)

- initiation of assay with 200μl of ONPG (4mg/ml) NOTE START TIME

-incubation at room temperature for see table

-stop reaction with 500 μl of 1 M Na2CO3 NOTE STOP TIME

- measurement of Abs (420nm) and Abs(550nm)

Results

Ergebnisse Miller Assay table 2011-09-05.jpg

Ergebnisse Miller Assay 2011-09-05.jpg


Cloning

Analytical gel of Bluelight_lacZ, cph8 from Uppsala and K322127 testdigest

040911 anal digestions flo tho.jpg


Size of bands look fine. Expected: 3093bp(lacZ)+86bp(Bluelight)= 3179 bp

--> Send clone 2 for sequencing or load RBS_lacZ digest along with ligated construct on gel and check for 86 bp difference.

cph8(2,2kbp) and K322127(4kbp) are running on their correct sizes.

Miniprep and testdigest of picked colonies on 04-09-2011

Miniprep of yesterdays picked clones were done. Concentration was determined using Nanodrop.

T7 Pol in pSB1C3 (ligation 4 from 1.9.)samples:

clone 1 : 58,5 ng/µl (sample 1)

clone 2 : 60,5 ng/µl (sample 2)

clone 3 : 55,5 ng/µl (sample 10)

clone 4 : 56,5 ng/µl (sample 13)

PCR in linearized pSB1C3:

clone 1 : 44,0 ng/µl (sample 4)

clone 2 : 82,0 ng/µl (sample 7)

clone 3 : 77,5 ng/µl (sample 5)

clone 4 : 70,0 ng/µl (sample 14)

blue light promotor+ lacZ (ligation 6 from 1.9):

clone 1 : 79,0 ng/µl (sample 12)

clone 2 : 67,0 ng/µl (sample 9)

clone 3 : 55,5 ng/µl (sample 21)

clone 4 : 65,0 ng/µl (sample 19)

red light sensor in pSB1C3 ratio 1:3

clone 1 : 58,0 ng/µl (sample 11)

clone 2 : 52,5 ng/µl (sample 15)

clone 3 : 59,5 ng/µl (sample 8)

red light sensor in pSB1C3 ratio 1:6

clone 1 : 50,5 ng/µl (sample 18)

clone 2 : 58,5 ng/µl (sample 3)

clone 3 : 61,5 ng/µl (sample 6)

red light sensor in pSB1A3 (ligation 1:5 (from 1.9.) clone 1 : 52,5 ng/µl (sample 20)(red colony) clone 2 : 51,0 ng/µl (sample 16)

red light sensor in pSB1A3 (ligation 1:1 (from 3.9) (red colony): clone 1 : 40,5 ng/µl (sample 17)

All samples were digested except 9,21,19:

5 µl of Mini-DNA was cut using 0,5 µl E and 0,5 µl P in 2 µl NEB4 and 20 µl total volume. Digest was loaded onto 1 % agarose gel.

040911 anal ligations.jpg


Red light sensor constructs look fine (3,8kbp insert and 2 kbp vector). T7ptag constructs are wrong and will be repeated (T7ptag expected at 2,6 kbp). Blue light sensor looks fine (3kbp). Red light sensor cloning into pSB1A3 didnt yield any insertion products, mainly slightly red colonies were visible --> 1kbp insert is RFP cassette. One not-red clone could be picked (sample 15), which contains a 400 bp insert of unkown origin.

--> Sample 7 was choosen to be sequenced as it yielded most amount of DNA.

Reporter Plasmid: T7 promotor prep and new RBS_LacZ prep

3 % agarose gel from yesterday was used at 100V for 1,5h

040911 3percentgel tho.jpg


No band could be detected. Nevertheless, gel slice was cut and will be purified.


040911 t7prom cut tho.jpg


Bands were cut and purified using Wizard Kit according to manufacturer's instructions.

Concentrations was determined using Nanodrop:

T7prom E, S: 9 ng/µl

T7prom P, S: 11.5 ng/µl

RBS_lacZ E, X: 14 ng/µl

RBS_lacZ E, X: 14.5 ng/µl

06-09-2011

People: Thorsten, Anna, Katharina

Testing

Miller Assay

5 newly inoculated cultures were assayed: difference to day before: grow in the dark (only DH5alpha)

incubation at room temperature of:

K322127 in DH5alpha in the light of lamp

K322127 in DH5alpha in the dark

K322127 in DH5alpha in the turn-off light

K322127 in BL21 in the light

cpH8 in DH5 alpha in the light

Problem 1: OD of bacterial cultures was very high, should have been around 0,7.

Problem 2: too long incubation of color reaction yielded too high ODs, samples couldn't be diluted as more blank sample (as diluent) was missing.

Miller Assay Tabelle 2011-09-06.jpg

Results

Miller Assay 2011-09-06.jpg

Cloning

Reporter Plasmid

Purification of 05-09-11 gel runs

Frozen gel slices were purified using Promega's Wizard Kit according to manufacturers instructions.

Subsequent determination of concentration via Nanodrop:

1: T7prom 46 bp cut: 9 ng/µl

2: T7prom vector cut: 11.5 ng/µl

3: RBS_lacZ vector cut: 14.0 ng/µl

4: RBS_lacZ insert cut: 14.5 ng/µl


Ligation of purified samples: Reporter Plasmid and T7ptag into shipping vector pSB1C3

110906 digest tho.jpg


Ligation mix was incubated for 1h at RT and and then at 16°C o/n.

Other Work

Sequencing of clones

Primer overview: http://partsregistry.org/Primers/Catalog


For most biobrick plasmids the standard sequencing primers VF2 (verification forward) and VR (verification reverse) will fit. They will be synthesized at GATC and stored for 1 year.


10 µl of Following clones were send for sequencing 300-100 ng/µl with VF2 primer (tgccacctgacgtctaagaa):


Bluelight_lacZ in pSB1A2 110904_clone2 miniprep conc.: 49.5 ng/µl


red light in pSB1C3 110905_sample 7 conc.: 82 ng/µl diluted 1:1 with ddH2O

07-09-2011

People: Thorsten, Anna, Katharina

Cloning

Reporter Plasmid and T7ptag into pSB1C3

Glycogen/ethanol precipitation and transformation

- DNA precipitation with glycogen:of the ligation samples from 6-9-11

1. add 2 µl 3 M sodium acetate, 0.5 µl glycogen and 22.5 µl isopropanol to 20 µl ligation product

2. incubate the mixture at -20°C for one hour

3. centrifuge the mixture for 15 minutes at 18,000 rpm, 4°C

4. discard the supernatant

5. add 50 µl 70 % ethanol

6. centrifuge the mixture for another 10 minutes at 18,000 rpm, 4°C

7. remove supernatant with a pipet CAREFULLY. If pellet moves, centrifuge again.

8. air-dry the pellet until the ethanol is completely evaporated. Do not over-dry pellet as this makes dissolving more difficult.

9. resuspend the pellet in 10 µl nuclease-free water by pipetting carefully.


  • 10 µl purified ligation was mixed with 40 µl competent cells and electroporated into DH5alpha.
  • 1 ml SOC medium (SOB medium + 20 mM glucose) was used and incubation was carried out for 1h at 37°C, shaking at 500 rpm in 2 ml eppis.
  • Culture was then centrifuged at 4000 rpm for 5 minutes, and resolved in 100 µl medium.
  • Whole sample was plated onto LB/agar plates supplemented with appropriate antibiotic and incubated o/n @ 37°C

Synthetic construct

Digest of synthetic construct and PCR-product (in pSB1C3)

110907 digest tho .jpg


Samples were loaded on preparative gel (1 %, TAE 1x, 100 V, 2 h 30 min) and subsequently cut with a new scalpel for each sample using 365 nm illumination as short as possible. Gel slices were purified using Promega's Wizard Kit according to manufacturer's instructions. Picture was taken after cutting of gel slices in order to reduce illumination.


7911-preparative-gel-red-light-synthetisch.jpg

ligation of synthetic construct and PCR-product (in pSB1C3)

110907 ligation.jpg


Ligation was performed at 16°C o/n

08-09-2011

People: Anna, Katharina

Cloning

AND-Gate plasmid

- DNA precipitation with glycogen/ethanol of the ligation samples from 7-9-11 accroding to protocol 7-9-11


- transformation via electroporation of 40 µl electro competent DH5alpha cells with the full volume of purified ligation samples from 7-9-11

Reporter plasmid and T7ptag

-overnight cultures for mini prep of transformations from 7-9-2011:

four clones of plates:

2 (T7prom(2)_RBS_lacZ(4))

3 (T7prom(2)_RBS_lacZ(4))

5 (RBS_lacZ(3)_T7prom(1))

6 (pSB1C3(3)_T7pol(5))

7 (pSB1C3(3)_T7pol(5))


one clone of plate 13 (synthetic construct in delivery vector pMA-RQ)

Other work

- production of LB-Agar plates with Kanamycin (500 ml), Chloramphenicol (300 ml) and Ampicillin (500 ml)

- overnight cultures of K322127 in DH5alpha (Cam, in the dark) and cpH8 inDH5alpha (Kan) for Miller Assay the next day


09-09-2011

People: Anna, Katharina, Thorsten

Results

Std Primer VR seems to misprime to B0015 double terminator: http://partsregistry.org/Help:Primers/Problems_using_VF2_and_VR_to_amplify_BioBrick_parts

Could be a problem when sequencing into our construct from downstream primer binding site as we use B0015 in synthetic construct. Because sequencing was done succesfully using this primer by others, we'll try it keeping the mispriming in mind. --> B0014 would be a better terminator for next time.

pSB1C3 is using B0056 as terminator downstream of suffix.


Cloning

Reporter plasmid and T7 polymerase

- Plasmid isolation -> Miniprep of the over night cultures from 8-9-11 according to manufacturers instructions from Metabion


- measurement of the DNA concentration of the following samples:


2a: 92 ng/µl

2b: 122 ng/µl

2c: 131 ng/µl

3a: 98 ng/µl

3b: 152 ng/µl

3c: 124 ng/µl

3d: 112 ng/µl

5a: 52.5 ng/µl

5b: 55 ng/µl

5c: 74.5 ng/µl

5d: 87 ng/µl

6a: 134 ng/µl

6b: 118 ng/µl

6c: 101 ng/µl

6d: 140 ng/µl

7a: 76.5 ng/µl

7b: 113 ng/µl

7c: 83 ng/µl

7d: 71.5 ng/µl

13: 79 ng/µl


- control restriction digest of the 21 DNA samples (2a-d, 3a-d, 5a-d, 6a-d, 7a-d,13) with the restricition enzymes E,P

total volume 50 µl (39 µl nf H20, 5 µl DNA, 5 µl NEB4 Buffer, 0,5 µl of each enzyme)

incubation for 1 hour at 37°C, inactivation for 20 min at 80°C


- analytical gelelectrophoresis ( 1%, 1x TAE, 12 wells, 120 V, 1 hour 30 minutes)

50 µl DNA + 10 µl loading buffer -> 40 µl sample in each well


110909 analytical gel ligation of 110906.jpg


110909 analytical gel ligation of 110906 part2.jpg


Size of T7promotor with RBS_lacZ looks correct (RBS_lacZ approx 3kbp pSB1AK8 approx 3.4 kbp). Ligation of 46 bp T7promotor into pSB1A2_RBS_lacZ (ID 5) didnt yield any correct clones, only vector background could be picked. Samples were discarded. Transformation of sample 4 resulted in short-circuit and was lost. Ligation of T7ptag into pSB1C3 looks fine. (T7ptag approx 2.6 kbp)

AND-Gate plasmid

transformation output: vector background looks fine

following clones have been picked:


Other Work

Next steps

Besides ligation of T7ptag insert, pSB1C3_T7ptag vector will be opened to ligate with red light_synthetic construct insert--> see 10-09-11.

Send clones for sequencing on Monday.

Testing

Miller Assay

two cultures in LB medium:

K322127 in DH5alpha with three incubation conditions: lighted, dark and under off-light

cpH8 in DH5 alpha as a control

conditions of bacterial growth: 37 °C, shaken, culture K322127 in DH5alpha grown in the dark prior to the experiment

volume of bacterial suspension used: 500 µl

incubation time for Miller Assay: 10 min (37 °C)


improvement to prior experiments: start OD between 0,15 and 0,17, correct antibiotics applied, incubation time of Miller Assay only 10 min.


Miller Assay tabelle 9.9.2011.jpg


Results

Miller Assay diagramm 9.9.2011.jpg

10-09-2011

People: Susan, Wolfgang, Thorsten

Cloning

AND-Gate plasmid

red_light sensor - synthetic construct ligation check

- Plasmid isolation -> Miniprep of the over night cultures from 09-09-11 according to manufacturers instructions from Metabion. 4 ml culture was used and 1 ml culture was saved for potential glycerol stocks


- control restriction digest of the 21 DNA samples (2a-d, 3a-d, 5a-d, 6a-d, 7a-d,13) with the restricition enzymes E,S

total volume 10 µl (7 µl nf H20, 1 µl DNA, 1 µl NEB4 Buffer, 1 µl of each enzyme)

nuke for 1 minute at 800 W (microwave)



- analytical gelelectrophoresis ( 0.7%, 1 x TAE, 12 wells, 160 V, 20 minutes)

10 µl DNA + 2 µl loading buffer -> 12 µl sample in each well


110910 anal digest of 110907 ligations.jpg


Sample ID 3c was choosen to be used for further cloning. pSB1C3 with red light sensor and synthetic construct

Nanodrop derived DNA conc. of 3c: 114 ng/µl

samples 2, 3a, 4b and 6a were discarded

sample 7b was choosen to be synthetic construct in pSB1C3 --> sequencing on monday

last step: assembly of redlight sensor_synthetic construct in pSB1C3 with T7ptag

we took 2 approaches: ligation of T7ptag as insert and vector, respectively


Digestions

1109010 digest tho.jpg


samples were loaded on 1 % preparative agarose gel and run for 1.5 h at 120V


110910 prep digest tho.jpg


Samples were cut (365 nm illumination as short as possible, picture taken after cutting of gel slices) and purified using Promegas Wizard purification kit according to manufacturers instructions.

Ligations

110910 ligation tho table.jpg

Samples were incubated o/n at 16°C.

11-09-2011

People: Katharina, Flo, Anna

Cloning

Glycogen/EtOH-precipitation of ligation samples from 10-09-11 and transformation

Put everything on ice before starting to work! Pre-cool centrifuge!

See protocol for precipitation/transformation from 07-09-11[[1]]

Changes made:

  • all solutions were icecold
  • pellet was air-dryed for about 10 min
  • autoclaved water was used instead of nuclease-free, due to quick subsequent use in the transformation
  • resuspending of the bacterial pellet after transformation was difficult (tried pipetting and vortexing), because the wrong centrifuge has been used
  • 1,5 ml-Eppis were used instead of 2 ml-Eppis for the shaking step at 37°C in SOC

Samples 1, 8 and 9: comp. cells used were DH5a from 01-07-11

Samples 2 - 7: comp. cells used were DH5a from 30-08-11

Antibiotic resistance:

  • 1: Amp
  • 2 - 9: Cam

Testing

Inoculation of o/n-cultures for tomorrow´s Miller Assay

10 ml LB+antibiotic in 50 ml-falcon tube

add 10 ul (= 1:1000 dilution) of yesterday´s o/n-cultures:

  • bluelight + lacZ in DH5a (Amp)
  • redlight + lacZ (trunc.) in DH5a (Cam)
  • neg. contr. Cph8 in DH5a (Kan)

Wrap falcons with aluminium foil, so growth can occur in the dark!

Shake o/n @ 37°C, 180 rpm

Miller Assay with blue light construct

two cultures in M9 medium:

blue light - lacZ on pSB1A2 in DH5alpha with two incubation conditions: lighted in blue light and dark

cpH8 in DH5 alpha as a control under room light

conditions of bacterial growth: 23,5 °C, shaken, both cultures grown under room light prior to the experiment

volume of bacterial suspension used: 0,1 ml

incubation time for Miller Assay: 5 min (37 °C)

improvement to prior experiments: start OD between 0,15 and 0,17, correct antibiotics applied


Start of Assay: - measurement of Abs(600nm)

- new eppi with 0,5 ml of Zbuffer + 20 μl of freshly prepared 0,1% SDS+ 40 μl of Chloroform (under fume hood)

- 0,1 ml of the samples are taken and transferred to the Zbuffer

- mix the solution by vortexing for 10 s ( all samples equal vortexing time)

- transferring of 100 μl supernatant to 96 well plate (for photometer)

- initiation of assay with 20 μl of ONPG (4mg/ml) NOTE START TIME

- incubation at 37 °C

- stop reaction with 50 μl of 1 M Na2CO3 NOTE STOP TIME

- measurement of Abs (420nm) and Abs (550nm)

Miller Assay tabelle 11.9.2011.jpg


Results

Miller Assay diagramm 11.9.2011.jpg

Problems: 1. cells had a party over night: three LED (blue on, red on, red off) were on alternatively 2. did cells really grow?

12-09-2011

People: Thorsten, Anna

Cloning

AND-Gate: Picking of colonies

Transformation and ligation efficiency of control was several thousand clones. Vector controls were lawn due to usage of CAM-plasmid contaminated electorcompetent DH5 alpha. All contaminated DH5alpha from 01-07-11 have been discarded.

3 clones of each plate have been picked and inoculated in 5 ml LB/cam o/n.

Other Work

sequencing of clones

Sequence of Blue light promotor with downstream RBS+lacZ is correct.

Sequence of first 1000 bp of PCR-Product shows one possible silent mutation in PcyA (Phycocyanobilin:ferredoxin oxidoreductase) gen on Position 45 T->C. Resulting triplet is CCC instead of CCT, which both code for proline.

Rest of PCR product should be sequenced aswell? Two more primers would be necessary to cover whole sequence.

Or: functionality check using CP919 strain should result in comparable Miller Unit output between PCR product only and red light original part K322127 as CP919 is Φ(OmpC-lacZ)10-25

Testing

Miller Assay with blue light construct

two cultures in LB medium:

blue light - lacZ on pSB1A2 in DH5alpha with three incubation conditions: lighted in room light, dark and blue light

cpH8 in DH5 alpha as a control under room light

conditions of bacterial growth: 23,5 °C, shaken, both cultures grown in the dark prior to the experiment, two hours before the experiments: cultures were subdivided and lit as described

volume of bacterial suspension used: 50 µl (or dilutions with LB medium)

incubation time for Miller Assay: 5 min (37 °C)


Start of Assay: - measurement of Abs(600nm)

- new eppi with 0,5 ml of Zbuffer + 20 μl of freshly prepared 0,1% SDS+ 40 μl of Chloroform (under fume hood) in 2 ml tube

- 50 μl (as a dilution 25 µl + 25 µl LB medium or 10 μl + 40 μl LB medium) of the samples are taken and transferred to the Zbuffer

- mix the solution by vortexing for 10 s (all samples with equal vortexing time)

- transferring of 100 μl supernatant to 96 well plate (for photometer)

- initiation of assay with 20 μl of ONPG (4mg/ml) = START

- incubation at 37 °C

- stop reaction with 50 μl of 1 M Na2CO3 = STOP after exactely 5 min

- measurement of Abs (420nm) and Abs (550nm)

- when solution was too yellow (OD > 2.0), stopped mixtures were diluted 1 : 7 in dd H2O

Miller Assay tabelle 12.9.2011.jpg


Results

Miller Assay Diagramm 12.9.2011.jpg

Problems: 1. did cells grow up to 20 h and act normally?

13-09-2011

People: Simon, Anna, Alex, Thorsten

Other Work

Electrocompetent cells

new electrocompetent cells (DH5alpha) were made by the following protocol:
20 ml LB medium was inoculated with 1 µl electrocompetent DH5alpha (kindly provided by Andrea Mückl)
350 ml LB medium were inoculated with 15 ml of the overnight culture and incubated at 37°C until a OD(600) of 0,7 was reached
the medium was distributed on falcons and the cells were centrifuged at 4500 rpm for 20 min at 4°C
after discarding the supernatant 350 ml of sterile ice-cold 10% glycerol was added and the pellets were resuspended using a pipet
the resuspension was centrifuged at 4500 rpm at 4°C for 11 minutes
after discarding the supernatant the cells were resuspended again in 350 ml of ice-cold 10% glycerol (cells kept chilled all the time)
and again centrifuged at 4500 rpm at 4°C for 11 minutes
the supernatant was discarded and the cells were resuspended in the remaining supernatant
the cells were dispensed in 40 µl aliquots and stored at -80°C for further use


Cloning

AND-Gate

Minipreps of picked cones on 12-09-11 were done according to Metabion's instructions. Concentrations:

2a: c = 68.5 ng/µl

2b: c = 68.0 ng/µl

3a: c = 118 ng/µl

3b: c = 65.0 ng/µl

5a: c = 122 ng/µl

5b: c = 71.5 ng/µl

6a: c = 122 ng/µl

6b: c = 119 ng/µl

6c: c = 51.0 ng/µl

After restriction digest using E and P, samples were separated on a 0.8 % gel:

110913 analytischer verdau and-gate Thorsten.jpg

Vector prep pSB1A3 and pSB1C3

The restricted vectors ID10 pSB1A3 and ID12 pSB1C3 from 30-08-2011 were applied onto a 1 % agarose gel and prepped using the Wizard SV gel purification kit.
The vector pSB1A3 was single cut, while pSB1C3 was cut with E and P (from K322127). The expected lengths are about 2 kbp for pSB1C3 and about 3 kbp for pSB1A3, as it also contains a RFP cassette.
The measured concentrations were 12.5 ng/µl for pSB1A3 and 11.5 ng/µl for pSB1C3, in a resuspended volume of 50 µl.

110913 Verdau pSB1A2 und pSB1C3 Thorsten nach Schnitt bearbeitet.jpg

Testing

no Miller Assay today

Inoculation of o/n-cultures for tomorrow´s Miller Assay

10 ml LB+antibiotic in 50 ml-falcon tube

add 20 µl (= 1:1000 dilution) of yesterday´s o/n-cultures:

in LB medium:

  • bluelight + lacZ in DH5a (Amp)
  • neg. contr. Cph8 in DH5a (Kan)


in M9 medium:

  • redlight + lacZ (trunc.) in DH5a (Cam)
  • neg. contr. Cph8 in DH5a (Kan)


Wrap falcons with aluminium foil, so growth can occur in the dark!

Shake o/n @ 37°C, 180 rpm

Other Work

1. preparation of Zbuffer and Na2CO3 solution for next day

2. Transformations:

chemical transformation of pSB1AK8 T7prom RBS lacZ (plasmid from clone 2c, 09.09.2011) in BL21 DE3. The BL21 cells we received from Lars Mitschke turned out to be chemically competent cells. Transformation was performed based on a protocol from openwetware.org. For detailed description of the protocoll see Methods.
electroporation of Part R2 (= RBS + lacZ) in pSB1A2 using today's and the old electrocompetent DH5alpha cells.

Sequencing results

pSB1AK8_T7prom_RBS_lacZ_VF2_110909_clone_2c-GATC-VF2-545457: Sequence shows one missing T in scar between T7promoter and RBS of lacZ. Rest of sequence is fine.