"

From 2011.igem.org

Revision as of 10:54, 7 September 2011 (view source) Allancrossman (Talk | contribs) (→References) ← Older edit		Latest revision as of 11:45, 17 September 2011 (view source) Allancrossman (Talk | contribs) (Redirected page to Team:Edinburgh/BioSandwich)
(27 intermediate revisions not shown)
Line 1:		Line 1:
-	==BBF RFC xx: "BioSandwich" - a homology based assembly method using a library of standard parts==	+	#redirect [[Team:Edinburgh/BioSandwich]]
-		+
-	Chris French, Allan Crossman<br>	+
-	September, 2011	+
-		+
-	==1. Purpose==	+
-		+
-	This Request for Comments (RFC) describes a strategy for using homology-based	+
-	assembly methods to assemble parts from a library in any order.	+
-		+
-	==2. Relation to other BBF RFCs==	+
-		+
-	BBF RFC xx does not update or replace any earlier BBF RFC.	+
-		+
-	==3. Copyright Notice==	+
-		+
-	Copyright (C) The BioBricks Foundation (2011). All Rights Reserved.	+
-		+
-	==4. Background==	+
-		+
-	One of the main aspects of synthetic biology is the assembly of standard	+
-	modular parts from a library to produce larger constructs. There are two main	+
-	types of assembly strategy: hierarchical and homology-based.	+
-		+
-	The RFC10 format, which is standard for iGEM projects, is based on	+
-	heirarchical assembly methods such as Standard Assembly and Three Antibiotic	+
-	Assembly. The main advantage of RFC10 is flexibility: any combination of parts	+
-	can be assembled in any order. The main disadvantage is speed.	+
-		+
-	Many iGEM teams now use homology-based assembly strategies, such as Gibson	+
-	Assembly. These methods use PCR to create parts that have homologous ends.	+
-	They are then assembled using the method of Gibson et al (2009). This method	+
-	is relatively fast. However, the order of the parts in the final construct is	+
-	entirely determined by the primers chosen for the initial PCR reactions. If a	+
-	different order is desired, parts have to be remade with new PCR primers.	+
-		+
-	BioSandwich is a hybrid that combines many of the benefits of hierarchical	+
-	assembly and homology-based assembly. In particular, it is useful for creating	+
-	different combinations of the same parts in different orders.	+
-		+
-	==5. Outline==	+
-		+
-	BioSandwich parts are reusable because they come in a standard format (much	+
-	like ordinary BioBricks) with restriction sites flanking the part. The	+
-	restriction sites are BglII (agatct) in the prefix, and SpeI (actagt) in the	+
-	suffix. However, these restriction sites are not used directly for assembly;	+
-	instead they are used to attach short (~35 bp) oligonucleotides (hereafter	+
-	"spacers"). These spacers serve two purposes:	+
-		+
-	* They create homology between the end of one part and the start of another; this allows homology-based assembly.	+
-	* They can incorporate short meaningful sequences such as ribosome binding sites, linkers for fusion proteins, etc.	+
-		+
-	Any lab using BioSandwich will want to keep a small library of different	+
-	spacers for different purposes. Once (carefully chosen) spacers have been	+
-	attached to each part, homology based assembly can be carried out in a single	+
-	reaction. Precisely which spacers have been attached to which parts will	+
-	determine the order of the parts in the final assembly.	+
-		+
-	==6. Formats==	+
-		+
-	===6.1. Normal Parts===	+
-		+
-	Parts must be free of internal BglII restriction sites (agatct) and SpeI sites	+
-	(actagt). Each part must be made with a BglII site at the start, and a SpeI	+
-	site at the end. If compliance with RFC10 is desired, the full format becomes:	+
-	<pre>	+
-	gaattcgcggccgcttctagagatct NNN NNN NNN NNt actagtagcggccgctgcag	+
-	</pre>	+
-	After cutting with BglII and SpeI, we have the following (shown in frame,	+
-	which is relevant for fusion proteins):	+
-	<pre>	+
-	5'    ga tct NNN NNN NNN NNt a        3'	+
-	3'        a nnn nnn nnn nna tga tc    5'	+
-	</pre>	+
-	When a part is used for fusion proteins, the "t" base at the start of the	+
-	RFC10 suffix becomes the final base of the final codon in the part. Design of	+
-	the part should take this into account. This is often done by making this	+
-	final codon GGT, coding for an innocuous glycine residue. (If a fusion protein	+
-	is not being made, no such consideration is needed. If RFC10-compliance is not	+
-	required, this "t" base can be replaced with anything.)	+
-		+
-	===6.2. Normal Spacers===	+
-		+
-	Spacers are designed as a set of oligonucleotides that can be attached to any	+
-	part via the part's restriction sites. Each type of spacer will be attached	+
-	upstream of one part and downstream of another. It is necessary to create	+
-	three different single-stranded oligonucleotides (spacer oligos or "spoligos")	+
-	for each spacer so as to allow annealing and ligation at the restriction	+
-	sites. They should be designed so that the spacer's non-ligating ends are blunt.	+
-		+
-	The format for the upstream spacers is as follows (both strands shown):	+
-	<pre>	+
-	5'    ct agc NNN NNN NNN g        3'              (forward spoligo)	+
-	3'    ga tcg nnn nnn nnn cct ag    5'              (reverse spoligo ONE)	+
-	</pre>	+
-	The format for the downstream spacers is:	+
-	<pre>	+
-	5'    ct agc NNN NNN NNN g        3'              (forward spoligo)	+
-	3'        g nnn nnn nnn c        5'              (reverse spoligo TWO)	+
-	</pre>	+
-	Note that the forward spoligo is used for both upstream and downstream	+
-	attachment.	+
-		+
-	The content of different spacers should be varied to avoid homology. It is	+
-	recommended that non-coding spacers have an in-frame stop codon, in case they	+
-	are to be used after a coding part which lacks one.	+
-		+
-	===6.3 Vector Part===	+
-		+
-	A vector is made as a PCR product with a BglII site (agatct) at the 5' end and	+
-	an XbaI site (tctaga) at the 3' end. Since XbaI produces sticky-ends	+
-	compatible with SpeI, the vector is compatible with standard spacers.	+
-		+
-	If one wishes the final products (after insertion into the vector) to be	+
-	RFC10-compliant, the format for a vector is as follows:	+
-	<pre>	+
-	agatct [nnn] tactagtagcggccgctgcag [ori, cmlR, etc] gaattcgcggccgcttctaga	+
-	</pre>	+
-	Note that a few additional bases must also be present at the 5' and 3' ends to	+
-	allow the restriction enzymes space to work. When spacers are to be annealed,	+
-	the vector is cut with BglII and XbaI (not SpeI).	+
-		+
-	===6.4. Start Spacer===	+
-		+
-	For compliance with RFC10, the spacer that connects the vector to the first	+
-	part must be in the following format:	+
-		+
-	Spoligos attaching upstream of first part:	+
-	<pre>	+
-	5'    ctagag NNNNNNNN g        3'              (forward spoligo)	+
-	3'    gatctc nnnnnnnn cctag    5'              (reverse spoligo ONE)	+
-	</pre>	+
-	Spoligos attaching downstream of vector:	+
-	<pre>	+
-	5'    ctagag NNNNNNNN g        3'              (forward spoligo)	+
-	3'        tc nnnnnnnn c        5'              (reverse spoligo TWO)	+
-	</pre>	+
-	This format ensures that the final product contains a standard RFC10 prefix	+
-	and suffix.	+
-		+
-	==7. Assembly==	+
-		+
-	===7.1. Digestion of Parts and Vector===	+
-		+
-	Each part must be digested separately.	+
-		+
-	* Parts: digest with BglII and SpeI in NEB Buffer 2	+
-	* Vector: digest with BglII and XbaI in NEB Buffer 2 or 3	+
-		+
-	Each tube gets:	+
-	<pre>	+
-	36 uL    Water	+
-	5 uL    DNA	+
-	5 uL    Buffer	+
-	2 uL    Enzyme 1	+
-	2 uL    Enzyme 2	+
-	</pre>	+
-	The digestions are then left for 2 hours at 37 C. Afterwards they are purified	+
-	with 5 uL glass beads, and eluted to 10 uL EB (protocol).	+
-		+
-	===7.2. Ligation of Parts and Vector to Spacers===	+
-		+
-	The parts and vector must now be ligated to the correct spacers, as follows.	+
-		+
-	Each tube gets:	+
-	<pre>	+
-	10 uL    Water	+
-	5 uL    DNA	+
-	1 uL    Spacer pair #1	+
-	1 uL    Spacer pair #2	+
-	2 uL    Ligase buffer	+
-	1 uL    T4 DNA ligase	+
-	</pre>	+
-	Tubes should then be left for 9 hours at 16 C. They must then be purified.	+
-		+
-	===7.3. Homology-Based Assembly===	+
-		+
-	The parts can now be assembled using a number of different homology-based	+
-	assembly methods, including Gibson Assembly, Overlap Extension PCR, Circular	+
-	Polymerase Extension Cloning, and others.	+
-		+
-	==8. Authors' contact information==	+
-		+
-	Chris French: c.french@ed.ac.uk<br>	+
-	Allan Crossman: igem@nothinginbiology.com	+
-		+
-	==References==	+
-		+
-	Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, Smith HO (2009)	+
-	Enzymatic assembly of DNA molecules up to several hundred kilobases. ''Nature	+
-	Methods'' '''6''':343-345 (doi: 10.1038/nmeth.1318).	+
-		+
-	__NOTOC__	+

---

Latest revision as of 11:45, 17 September 2011

1. redirect Team:Edinburgh/BioSandwich