Team:Edinburgh/Sequences

From 2011.igem.org

(Difference between revisions)
(Plac LacZ insert (clone 2))
Line 61: Line 61:
* Sequence based on our actual sequencing data... but some noisy data has been ignored and sequence based on the above.
* Sequence based on our actual sequencing data... but some noisy data has been ignored and sequence based on the above.
* Sequence includes BioBrick prefix and suffix (blue) as well as the BglII site (bold), which is partly in the prefix
* Sequence includes BioBrick prefix and suffix (blue) as well as the BglII site (bold), which is partly in the prefix
-
* Both forward and reverse sequencing reactions failed to give good info about the suffix; this seems a little suspicious to me [AC], but I have simply added the standard suffix.
+
* Both forward and reverse sequencing reactions failed to give good info about the suffix; probably due to the pesky NotI site, but I have simply added the standard suffix.

Revision as of 17:19, 10 June 2011

It may or may not be useful to have annotated nucleotide sequences of various stuff that we use. Some of this information can be retrieved from the Registry, but it may be useful to have it in a more nicely usable form. Copying DNA sequences from the Registry using the web-browser's normal copy function is strangely broken...

In any case this is good practice for gene annotation and thinking about reverse complimentary sequences and such.


Contents

Biobrick prefix, suffix, scar

  • gaattcgcggccgcttctagag - prefix, long
  • gaattcgcggccgcttctag - prefix, short
  • tactagtagcggccgctgcag - suffix
  • tactag - scar, short
  • tactagag - scar, long


Restriction sites

  • gaattc - EcoRI (prefix 1)
  • tctaga - XbaI (prefix 2)
  • actagt - SpeI (suffix 1)
  • ctgcag - PstI (suffix 2)
  • gcggccgc - NotI (in both prefix and suffix)
  • agatct - BglII (not part of RFC10, we use it internally after the prefix)


pSB1C3 vector

  • This is the official sequence from the Registry ([http://partsregistry.org/wiki/index.php?title=Part:pSB1C3 here])
  • Red is CmlR coding sequence ([http://en.wikipedia.org/wiki/Chloramphenicol_acetyltransferase chloramphenicol acetyltransferase])
  • Green is the the verification primer binding sites
  • Blue is restriction sites for the 4 main enzymes (EcoRI, XbaI, SpeI, PstI)

tactagtagcggccgctgcagtccggcaaaaaagggcaaggtgtcaccaccctgccctttttctttaaaaccgaaaagattacttcgcgttatgcaggct tcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggata acgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacga gcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcct gttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgt aggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaag acacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactac ggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccg ctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctca gtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatc taaagtatatatgagtaaacttggtctgacagctcgaggcttggattctcaccaataaaaaacgcccggcggcaaccgagcgttctgaacaaatccagat ggagttctgaggtcattactggatctatcaacaggagtccaagcgagctcgatatcaaattacgccccgccctgccactcatcgcagtactgttgtaatt cattaagcattctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcc catggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattc tcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcac tccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacg aaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaata tccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatc cagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagtt ggaacctcttacgtgcccgatcaactcgagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggca gaatttcagataaaaaaaatccttagctttcgctaaggatgatttctggaattcgcggccgcttctagag


Plac LacZ insert (clone 2)

  • A modified version (seems to lack about 45 bases at the start) of [http://partsregistry.org/wiki/index.php?title=Part:BBa_J33207 BBa_J33207]
  • Sequence based on our actual sequencing data... but some noisy data has been ignored and sequence based on the above.
  • Sequence includes BioBrick prefix and suffix (blue) as well as the BglII site (bold), which is partly in the prefix
  • Both forward and reverse sequencing reactions failed to give good info about the suffix; probably due to the pesky NotI site, but I have simply added the standard suffix.


gaattcgcggccgcttctagagatctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgc ccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggt ttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtat gttgtgtgaaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactggga aaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacag ttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtgatactagtagcggccgctgcag



This was the old Navbox for Edinburgh; now it's obsolete...

Edinburgh 2011
Project documentation: Project - BioSandwich - Parts - Modeling - Lab Notebook - Safety - Team - Attributions
Pages for members: Wiki Watch - Useful Links - Sequences - Primers - Practices - Official Profile (has email addresses)
(edit this navigation box)