Team:Cambridge/Experiments/Squid Dissection and Tissue Sample Improved Protocol

From 2011.igem.org

(Difference between revisions)
(Design of Positive Control Primers)
(Blanked the page)
 
(23 intermediate revisions not shown)
Line 1: Line 1:
-
{{Template:Team:Cambridge/CAM_2011_TEMPLATE_HEAD}}
 
-
==Amplification of Reflectin Genes from the Squid Genomic DNA - Part 2==
 
-
 
-
Two new protocols for genomic DNA extraction were used in order to improve yield and purity of DNA. In addition to three sets of primers allowing for amplification of reflectin, an extra 'positive control' pair of primers was used in the PCR reaction.
 
-
 
-
===DNA Extraction===
 
-
 
-
As the [[Team:Cambridge/Experiments/Squid_Dissection_and_Tissue_Sample | previous attempt]] to amplify reflectin genes from ''Loligo vulgaris'' and ''Loligo opalescens'' failed mainly due to low concentration of template DNA, we decided to repeat the experiment, using two, presumably more efficient, new DNA extraction protocols:
 
-
#[http://www.sigmaaldrich.com/life-science/molecular-biology/dna-and-rna-purification/mammalian-genomic-dna-miniprep-kit.html Sigma GenElute™ Mammalian Genomic DNA Miniprep Kit] using 'Mammalian Tissue Preparation' procedure
 
-
#[[Team:Cambridge/Protocols/Extraction_of_cleaner_genomic_DNA_from_squid | Improved version of the previously applied zebra fish protocol]]
 
-
 
-
Initial steps of the extraction procedure included:
 
-
*Tissue from L.opalescens was homogenized using a pestle and a mortar under liquid nitrogen. In this experiment, we did not extract genomic DNA from the second species, L. vulgaris, in order to save tissue material and reagents.
 
-
*Followingly, a spatula of powdered tissue was transferred to two reaction tubes with different concentrations of Proteinase K:
 
-
:'''GenElute protocol''' - 180 µl of Lysis Solution T and 20 µl of Proteinase K stock solution
 
-
:''final concentration of Proteinase K = 2 mg/ml''
 
-
:'''Zebra fish protocol''' - 198 µl of DNA extraction buffer and 2 µl of Proteinase K stock solution
 
-
:''final concentration of Proteinase K = 200 µl/ml''
 
-
*Samples were kept in a shaking water bath at 50-55°C
 
-
 
-
===Measuring the Concentration and Purity of Extracted DNA===
 
-
 
-
We measured the DNA concentration in the supernatant obtained with the GenElute Kit using NanoDrop Spectrophotometer.
 
-
*A260 = 3.89 and the calculated DNA content was roughly 194.5 µg/ml.
 
-
:''DNA absorbs light most strongly at 260 nm and the absorbance value at this wavelength can be used to estimate the DNA using the following formula derived from Beer's Law:''
 
-
::::::'''''Concentration (µg/ml) = (A260 reading - A320 reading) x 50''''' 
 
-
:''A320 provides a general measurement of the turbidity of the sample, but excessive values may indicate non-specific contamination. ''
 
-
:''A320 of our sample was negligibly low so we used only A260 value for calculating the concentration.''
 
-
*However, elevated absorbance at 230nm and a pink colouration of the solution indicates impurities.
 
-
:''Guanidium salt used to facilitate DNA binding to silica column absorb strongly at 230 nm, thus high absorbances at this wavelength can be indicative of carry-over of this compound into the sample. Pink colouration is most probably caused by a high level of melanin in the sample, as squid tissues are considerably rich in this pigment.''
 
-
 
-
===Design of Positive Control Primers===
 
-
 
-
In addition to three sets of primers allowing for the amplification of genes related to A1, A2 and B1 reflectins from ''Loligo pealei'', we also decided to use an additional pair of primers that enabled as to perform a positive control reaction. For this purpose, we relied on primers that had been previously reported to successfully facilitate amplification of a 710-bp fragment of a mitochondial cytochrome c oxidase subunit I across a broad array of invertebrates, also including ''Loligo pealei'' (Vrijenhoek, 1994).
 
-
 
-
{| border="1" align="center"
 
-
! colspan="6" | Positive control primers
 
-
|-
 
-
|5' GGTCAACAAATCATAAAGATATTGG 3'
 
-
|5' TAAACTTCAGGGTGACCAAAAAATCA 3'
 
-
|}
 
-
 
-
 
-
• We decided to conduct PCR using the primers we previously designed. We also added an additional pair of primers that allowed to amplify a mitochondrial gene, thus it served as a positive control.
 
-
• Template used in all: L.opalsecns genomic DNA A1 tube extracted with DNA Kit from Sigma and different sets of primers:
 
-
○ A1
 
-
○ A2
 
-
○ B1
 
-
○ Positive control (upload sequences of primers and give reference to a relevant paper) - mitochondrial cytochrome c oxidase subunit I - a pair of primers that allows for amplification of a 710-bp fragment of COI across a broad array of invertebrates
 
-
 
-
LCO1490:
 
-
HC02198:
 
-
 
-
• Picture of PCR - again no trace of amplified rflectin - no detectable primers and template DNA
 
-
○ Order of samples 1:A1, 2:A2, 3:B1, 4:+, 5:Ladder IV
 
-
○ No visible bands in the gel (apart from the Ladder IV)
 
-
○ Positive control does not work - although in the cited paper, successful use in Loligo pealei is shown
 
-
○ Suggests that the prepared DNA was not sufficiently clean
 
-
• As we read in some papers (reference), difficult to work with genomic DNA from squids and other cephalopods.
 
-
 
-
===References===
 
-
#'''Vrijenhoek R. (1994)''' DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. ''Molecular Marine Biology and Biotechnology,'' 3(5): 294-299.
 
-
 
-
{{Template:Team:Cambridge/CAM_2011_TEMPLATE_FOOT}}
 

Latest revision as of 11:48, 15 September 2011