Team:KIT-Kyoto/Notebook/LabNoteJ/DIAP2-MALT8

{{Template:KIT-Kyoto/Notebook}}
{{Template:KIT-Kyoto/menu1}}

<BR>

<div id=NAKAMI>
{| style="color:#000080;background-color:transparent;" cellpadding="3" cellspacing="1" border="0" bordercolor="#0000FF" width="900px" align="center"
!align="left"|[[Team:KIT-Kyoto|Home]] > [[Team:KIT-Kyoto/Notebook|Notebook]] > [[Team:KIT-Kyoto/Notebook/LabNote|Lab Note]] > [[Team:KIT-Kyoto/Notebook/LabNoteJ/DIAP2-MALT8|August]]
!align="right"|Language：[[Team:KIT-Kyoto/Notebook/LabNote/DIAP2-MALT8|English]]/[[Team:KIT-Kyoto/Notebook/LabNoteJ/DIAP2-MALTJ8|Japanese]]
|}

==''8th, August''==
<b>Member</b>
<br>
:Matsunami, Yokoigawa
<br>
:To amplify API2-MALT1 cDNA and DIAP2cDNA, PCR reactions were carried out by using the following primers and under the following conditions.
<br>
:API2-MALT1
::F primer:GCCGCTCGAGAACATAGTAGAAAACAGCAT<br>
::Tm value　57.8°C<br>
::R　primer:GCCGGCTAGCTCATTTTTCAGAAATTCTGA<br>
::Tm value　56.5°C<br>
::amplicon size　　3131 bp<br>

:DIAP2
::F primer:GCTTCTCGAGACGGAGCTGGGCATGGAGCT<br>
::Tm value　69°C<br>
::R primer:GCCGTCTAGATCACGAAAGGAACGTGCGCA<br>
::Tm value　66.4°C<br>
::amplicon size　　1514 bp
<br>

:1.API2-MALT1<br>
:<table border="0"><tr><td>
:<table border="0" width="150px">
:<tr><td align=center>PCR reaction</td></tr>
:</table>
:<table border=1 width="250px">
:<tr><td width="150px" align=center>10 µM Primer F</td><td width="100px"  align=right>0.4 µl</td></tr>
:<tr><td align=center>10 µM Primer R</td><td align=right>0.4 µl</td></tr>
:<tr><td align=center>Template DNA</td><td align=right>1 µl</td></tr>
:<tr><td align=center>10 x Ex Taq Buffer</td><td align=right>2 µl</td></tr>
:<tr><td align=center>Takara Ex Taq</td><td align=right>0.1 µl</td></tr>
:<tr><td align=center>2.0 mM dNTPs</td><td align=right>2 µl</td></tr>
:<tr><td align=center>ddH<sub>2</sub>O</td><td align=right>14.1 µl</td></tr>
:<tr><td>&nbsp;</td><td align=right>total 20 µl</td></tr>
:</table>
:</td><TD></TD><TD></TD><td>
:<table border="0" width="100px">
:<tr><td align=center>Cycle</td></tr>
:</table>
:<table border=1 width="400px">
:<tr><td width="100px" align=center>Pre-Denature</td><td width="100px"  align=center>94°C</td><td width="100px" align=center>2min</td><td width="100px">&nbsp;</td></tr>
:<tr><td align=center>Denature</td><td align=center>94°C</td><td align=center>30sec</td><td align=center rowspan=3>37 Cycle</td></tr>
:<tr><td align=center>Anneling</td><td align=center>51.5°C</td><td align=center>30sec</td></tr>
:<tr><td align=center>Extension</td><td align=center>72°C</td><td align=center>3min20sec</td></tr>
:<tr><td align=center>+Extension</td><td align=center>72°C</td><td align=center>10min</td><td width="100px">&nbsp;</td></tr>
:<tr><td align=center>End</td><td align=center>4°C</td><td align=center>keep</td><td width="100px">&nbsp;</td></tr>
:</table>
:</td></tr>
:</table>
<br>
:2.DIAP2<br>
:<table border="0"><tr><td>
:<table border="0" width="150px">
:<tr><td align=center>PCR reaction</td></tr>
:</table>
:<table border=1 width="250px">
:<tr><td width="150px" align=center>10 µM Primer F</td><td width="100px"  align=right>0.4 µl</td></tr>
:<tr><td align=center>10 µM Primer R</td><td align=right>0.4 µl</td></tr>
:<tr><td align=center>Template DNA</td><td align=right>1 µl</td></tr>
:<tr><td align=center>10 x Ex Taq Buffer</td><td align=right>2 µl</td></tr>
:<tr><td align=center>Takara Ex Taq</td><td align=right>0.1 µl</td></tr>
:<tr><td align=center>2.0 mM dNTPs</td><td align=right>2 µl</td></tr>
:<tr><td align=center>ddH<sub>2</sub>O</td><td align=right>14.1 µl</td></tr>
:<tr><td>&nbsp;</td><td align=right>total 20 µl</td></tr>
:</table>
:</td><TD></TD><TD></TD><td>
:<table border="0" width="100px">
:<tr><td align=center>Cycle</td></tr>
:</table>
:<table border=1 width="400px">
:<tr><td width="100px" align=center>Pre-Denature</td><td width="100px" align=center>94°C</td><td width="100px" align=center>2min</td><td width="100px">&nbsp;</td></tr>
:<tr><td align=center>Denature</td><td align=center>94°C</td><td align=center>30sec</td><td align=center rowspan=3>37 Cycle</td></tr>
:<tr><td align=center>Anneling</td><td align=center>56.9°C</td><td align=center>30sec</td></tr>
:<tr><td align=center>Extension</td><td align=center>72°C</td><td align=center>1min40sec</td></tr>
:<tr><td align=center>+Extension</td><td align=center>72°C</td><td align=center>10min</td><td width="100px">&nbsp;</td></tr>
:<tr><td align=center>End</td><td align=center>4°C</td><td align=center>keep</td><td width="100px">&nbsp;</td></tr>
:</table>
:</td></tr>
:</table>
<br>

==''9th, August''==
<b>Member</b>
<br>
:Matsunami, Yokoigawa
<br>
:1. We carried out agarose gel electrophoresis to detect the PCR products. 
:2. We transformed E. coli XL-1 blue with the plasmid pUAST-flag. 
<br>
<b>Results</b>
:1. Image of the agarose gel. <BR>
:<html><body>
<IMG src="https://static.igem.org/mediawiki/2011/b/bc/2011.08.09_API2-MALT1.DIAP2.JPG" width="250px" height="250px" border="0">
</body></html>
<br>
:Lane 1；size marker(1 kbp ladder）
:Lane 2；the amplified API2-MALT1 cDNA fragment
:Lane 3；the amplified DIAP2 cDNA fragment 

:Sizes of the fragments were different from the expected sizes.
<br>
:2. The transformed bacterial colonies were detected.
<br>

==''10th, August''==
<b>Member</b>
<br>
:Matsunami
<br>
:1.  I have repeated the PCR reactions to amplify API2-MALT1 cDNA and DIAP2 cDNA under the same conditions as those carried out on 8th, August.
:2. I picked up the colonies and grew them in liquid culture.
<br>
<b>Results</b>
:2. I have successfully grown the transformed bacteria.
<br>

==''11th, August''==
<b>Member</b>
<br>
:Matsunami
<br>
:I have isolated the plasmid DNAs (pUAST flag ) by alkaline-lysis method and electrophoresed them in agarose gel.
<br>
<b>Results</b>
:Image of the agarose gel.<BR>
:<html><body>
<IMG src="https://static.igem.org/mediawiki/2011/2/21/2011.08.11_API2-MALT1.DIAP2.JPG" width="250px" height="250px" border="0">
</body></html>
<br>
:Lane 1； size marker （1 Kbp ladder）
:Lanes 2～9；pUAST-flag
:Lane 10；The authentic pUAST-flag vector
:Lane 11；the amplified API2-MALT1 cDNA fragment
:Lane 12；the amplified DIAP2 cDNA fragment

<br>

==''12th, August''==
<b>Member</b>
<br>
:Matsunami, Yokoigawa
<br>
:1. Amounts of the isolated plasmid DNA samples were quantified by measuring the absorbance at OD260.
:2. We grew the transformed bacteria (25 ml x 2) and the plasmid pUAST-flag DNA was isolated by Midi-prep (Invitrogen).
<br>
<b>Results</b>
:1. The absorbance at OD260 of two independent plasmid DNA samples are shown in Table 1.
<br>
:Table 1 (OD260)
:sample 1
:<table border=1 width="500px">
:<tr><td width="100px" align=rjght>0.189</td><td width="100px" align=rjght>0.208</td><td width="100px" align=rjght>0.192</td><td width="100px" align=rjght>0.190</td><td width="100px" align=rjght>0.191</td></tr>
:</table>
:Average value was 0.194.
:Concentration of DNA was 0.970 µg/µl.<br>
<br>
:sample 2
:<table border=1 width="500px">
:<tr><td width="100px" align=rjght>0.282</td><td width="100px" align=rjght>0.276</td><td width="100px" align=rjght>0.278</td><td width="100px" align=rjght>0.269</td><td width="100px" align=rjght>0.269</td></tr>
:</table>
:Average value was 0.275. 
:Concentration of DNA was 1.37 µg/µl. 
<br>
2. Image of the agarose gel.<BR>
:<html><body>
<IMG src="https://static.igem.org/mediawiki/2011/3/30/2011.08.14_%E6%9D%BE%E6%B5%AA.JPG" width="250px" height="250px" border="0">
</body></html>
<br>
:Lane 1: DNA size marker (1Kb ladder)
:Lane 6: sample 1
:Lane 7: sample 2
:Lane 8: The authentic pUAST-flag vector 
:DNAs from samples 1 and 2 migrated to the same positions as the pUAST-flag. 

<br>

==''15th, August''==
<b>Member</b>
<br>
:Matsunami, Yokoigawa 
<br>
:We have tried different Annealing conditions to amplify API2-MALT1 cDNA and DIAP2 cDNA. The other conditions for the PCR reactions were same as those carried out on 8th, August. 

:API2-MALT1<br>
:<table border=1 width="200px">
:<tr><td width="100px" align=center>Anneling</td><td align=center>58.9°C</td></tr>
:</table>

:DIAP2<br>
:<table border=1 width="200px">
:<tr><td width="100px" align=center>Anneling</td><td align=center>53°C</td></tr>
:</table>

:PCR products were applied to the agarose gel electrophoresis.
<br>
<b>Results</b>
:Image of the agarose gel.<BR>
:<html><body>
<IMG src="https://static.igem.org/mediawiki/2011/0/0c/2011.08.15_API2-MALT1.DIAP2.JPG" width="250px" height="250px" border="0">
</body></html>
<br>
:Lane 1；DNA size marker（1 Kbp ladder）
:Lane 2；API2-MALT1 cDNA
:Lane 3；DIAP2 cDNA
:Size of the amplified fragments for API2-MALT1was different from the expected size and multiple DNA fragments were detected for the DIAP2. 

<br>

==''16th, August''==
<b>Member</b>
<br>
:Matsunami 
<br>
:Again different annealing conditions were tested.

:API2-MALT1<br>
:<table border=1 width="200px">
:<tr><td width="100px" align=center>Anneling</td><td align=center>53°C</td></tr>
:</table>

:DIAP2<br>
:<table border=1 width="200px">
:<tr><td width="100px" align=center>Anneling</td><td align=center>58.9°C</td></tr>
:</table>

:PCR products were applied to the agarose gel electrophoresis.
<br>
<b>Results</b>
:Image of the agarose gel.<BR>
:<html><body>
<IMG src="https://static.igem.org/mediawiki/2011/c/c3/2011.08.16_API2-MALT1.DIAP2.JPG" width="250px" height="250px" border="0">
</body></html>
<br>
:Lane 1；DNA size marker（1 Kbp ladder）
:Lanes 2 and 3；API2-MALT1 cDNA
:Lane 4；DIAP2 cDNA
:In lane 3, the DNA fragment with the expected size (3 kb) with the additional 2kb fragment was detected for API2-MALT1. Multiple :DNA fragments were still detected for the DIAP2.

<br>

==''17th, August''==
<b>Member</b>
<br>
:Matsunami, Yokoigawa 
<br>
:Again different annealing conditions were tested.

:API2-MALT1<br>
:<table border=1 width="200px">
:<tr><td width="100px" align=center>Anneling</td><td align=center>53.5°C</td></tr>
:</table>

:DIAP2<br>
:<table border=1 width="200px">
:<tr><td width="100px" align=center>Anneling</td><td align=center>50.5°C</td></tr>
:</table>

:PCR products were applied to the agarose gel electrophoresis.
<br>
<b>Results</b>
:Image of the agarose gel.<BR>
:<html><body>
<IMG src="https://static.igem.org/mediawiki/2011/9/98/2011.08.17_API2-MALT1.DIAP2.JPG" width="250px" height="250px" border="0">
</body></html>
<br>
:Lane 1；DNA size marker（1 Kbp ladder）
:Lanes 2 and 3；API2-MALT1 cDNA
:Lane 4；DIAP2 cDNA
:Size of the amplified fragments for API2-MALT1was different from the expected size and amplified DNA fragments were barely detectable for the DIAP2.

<br>

==''23rd, August''==
<b>Member</b>
<br>
:Matsunami
<br>
:Again different annealing conditions were tested.

:API2-MALT1<br>
:<table border=1 width="200px">
:<tr><td width="100px" align=center>Anneling</td><td align=center>53°C</td></tr>
:</table>

:DIAP2<br>
:<table border=1 width="200px">
:<tr><td width="100px" align=center>Anneling</td><td align=center>50.5°C</td></tr>
:</table>

:PCR products were applied to the agarose gel electrophoresis.
<br>
<b>Results</b>
:Image of the agarose gel.<BR>
:<html><body>
<IMG src="https://static.igem.org/mediawiki/2011/6/68/2011.08.23_API2-MALT1.DIAP2.JPG" width="250px" height="250px" border="0">
</body></html>
<br>
:Lane 1；DNA size marker（1 Kbp ladder）
:Lanes 2 and 3；API2-MALT1 cDNA
:Lanes 4 and 5；DIAP2 cDNA

:Again the DNA fragments with the expected sizes were not detected.

<br>

==''24th, August''==
<b>Member</b>
<br>
:Matsunami
<br>
:We have decreased the amount of the template API2-MALT1DNA by diluting 10 X and 100X, then used for the PCR reactions under the following conditions.

:<table border="0"><tr><td>
:<table border="0" width="150px">
:<tr><td align=center>PCR reaction</td></tr>
:</table>
:<table border=1 width="250px">
:<tr><td width="150px" align=center>10 µM Primer F</td><td width="100px"  align=right>0.4 µl</td></tr>
:<tr><td align=center>10 µM Primer R</td><td align=right>0.4 µl</td></tr>
:<tr><td align=center>Template DNA</td><td align=right>1 µl</td></tr>
:<tr><td align=center>10 x Ex Taq Buffer</td><td align=right>2 µl</td></tr>
:<tr><td align=center>Takara Ex Taq</td><td align=right>0.1 µl</td></tr>
:<tr><td align=center>2.0 mM dNTPs</td><td align=right>2 µl</td></tr>
:<tr><td align=center>ddH<sub>2</sub>O</td><td align=right>14.1 µl</td></tr>
:<tr><td>&nbsp;</td><td align=right>total 20 µl</td></tr>
:</table>
:</td><TD></TD><TD></TD><td>
:<table border="0" width="100px">
:<tr><td align=center>Cycle</td></tr>
:</table>
:<table border=1 width="400px">
:<tr><td width="100px" align=center>Pre-Denature</td><td width="100px"  align=center>94°C</td><td width="100px"  align=center>2min</td><td width="100px">&nbsp;</td></tr>
:<tr><td align=center>Denature</td><td align=center>94°C</td><td align=center>30sec</td><td align=center rowspan=3>37 Cycle</td></tr>
:<tr><td align=center>Anneling</td><td align=center>51.5°C</td><td align=center>30sec</td></tr>
:<tr><td align=center>Extension</td><td align=center>72°C</td><td align=center>3min20sec</td></tr>
:<tr><td align=center>+Extension</td><td align=center>72°C</td><td align=center>10min</td><td width="100px">&nbsp;</td></tr>
:<tr><td align=center>End</td><td align=center>4°C</td><td align=center>keep</td><td width="100px">&nbsp;</td></tr>
:</table>
:</td></tr>
:</table>

:PCR products were applied to the agarose gel electrophoresis.
<br>
<b>Results</b>
:Image of the agarose gel.<BR>
:<html><body>
<IMG src="https://static.igem.org/mediawiki/2011/e/e6/2011.08.24_API2-MALT1_10.100%E5%80%8D%E5%B8%8C%E9%87%88.JPG" width="250px" height="250px" border="0">
</body></html>
<br>
:Lane 2；DNA size marker（1 Kbp ladder）
:Lanes 3~6；API2-MALT1 cDNA (10 X diluted)
:Lanes 8~11；API2-MALT1 cDNA(100 X diluted)
:No amplified DNA was detected.

<br>

==''25th, August''==
<b>Member</b>
<br>
:Matsunami
<br>
:Again different annealing conditions were tested.  

:API2-MALT1<br>
:<table border=1 width="200px">
:<tr><td width="100px" align=center>Anneling</td><td align=center>51.5°C</td></tr>
:</table>

:DIAP2<br>
:<table border=1 width="200px">
:<tr><td width="100px" align=center>Anneling</td><td align=center>50.5°C</td></tr>
:</table>

:PCR products were applied to the agarose gel electrophoresis.
<br>
<b>Results</b>
:Image of the agarose gel<BR>
:<html><body>
<IMG src="https://static.igem.org/mediawiki/2011/7/72/2011.08.25_API2-MALT1.DIAP2.JPG" width="250px" height="250px" border="0">
</body></html>
<br>
:Lane 1；DNA size marker（1 Kbp ladder）
:Lanes 2 and 3；API2-MALT1 cDNA
:Lanes 4 and 5；DIAP2 cDNA
:No PCR product was detected for API2-MALT1. The PCR products with the expected size (1.5 kb) were detected for DIAP2. 

<br>

==''29th, August''==
<b>Member</b>
<br>
:Takeda、Yokoigawa
<br>
:The PCR products for DIAP2 was treated wit phenol-chloroform and then digested with the XhoI for 20 hours at 37°C. 

:DIAP2<br>
:<table border="0"><tr><td>
:<table border="0">
:<tr><td>DIAP2</td></tr>
:</table>
:<table border="1" width="250">
:<tr><td width="150px" align="center">PCR　reaction in ddH<sub>2</sub>O</td><td width="100px" align="right">44 µl</td></tr>
:<tr><td align="center">10 x H Buffer</td><td align="right">5 µl</td></tr>
:<tr><td align="center"><i>Xho</i>Ⅰ</td><td align="right">1 µl</td></tr>
:<tr><td>&nbsp;</td><td align="right">total 50 µl</td></tr>
:</table>
:</td><td></td><td></td><td>
:<table border="0">
:<tr><td>pUAST-flag vector</td></tr>
:</table>
:<table border="1" width="350">
:<tr><td width="250px" align="center">pUAST-flag vector(500 ng/µl)</td><td width="100px" align="right">10 µl</td></tr>
:<tr><td align="center">ddH<sub>2</sub>O</td><td align="right">34 µl</td></tr>
:<tr><td align="center">10 x H Buffer</td><td align="right">5 µl</td></tr>
:<tr><td align="center"><i>Xho</i>Ⅰ</td><td align="right">1 µl</td></tr>
:<tr><td>&nbsp;</td><td align="right">total 50 µl</td></tr>
:</table>
:</td></tr>
:</table>

<br>

==''30th, August''==
<b>Member</b>
<br>
:Takeda, Yokoigawa 
<br>
:The PCR products for DIAP2 was treated wit phenol-chloroform and then digested with the XhoI for 20 hours at 37°C.

:<table border="0"><tr><td>
:<table border="0">
:<tr><td>DIAP2</td></tr>
:</table>
:<table border="1" width="250">
:<tr><td width="150px" align="center">PCR reaction in ddH<sub>2</sub>O</td><td width="100px" align="right">44 µl</td></tr>
:<tr><td align="center">10 x M Buffer</td><td align="right">5 µl</td></tr>
:<tr><td align="center"><i>Xba</i>Ⅰ</td><td align="right">1 µl</td></tr>
:<tr><td>&nbsp;</td><td align="right">total 50 µl</td></tr>
:</table>
:</td><td></td><td></td><td>
:<table border="0">
:<tr><td>pUAST-flag vector</td></tr>
:</table>
:<table border="1" width="350">
:<tr><td width="250px" align="center">pUAST-flag vector(500 ng/µl)</td><td width="100px" align="right">10 μl</td></tr>
:<tr><td align="center">ddH<sub>2</sub>O</td><td align="right">34 µl</td></tr>
:<tr><td align="center">10 x H Buffer</td><td align="right">5 µl</td></tr>
:<tr><td align="center"><i>Xho</i>Ⅰ</td><td align="right">1 µl</td></tr>
:<tr><td>&nbsp;</td><td align="right">total 50 µl</td></tr>
:</table></td></tr></table>

<br>

==''30th, August''==
<b>Member</b>
<br>
:Takeda, Yokoigawa 
<br>
:The restriction enzyme-digested PCR fragments and pUAST-flag DNA were extracted from the agarose gel by [http://www.qiagen.com/products/dnacleanup/gelpcrsicleanupsystems/qiaquickgelextractionkit.aspx QIAquick Gel Extraction Kit].
<br>
<b>Results</b>
:Image of agarose gel after DNA fragment isolation. <br>
:<html><body>
<IMG src="https://static.igem.org/mediawiki/2011/2/27/2011.08.31_%E6%A8%AA%E4%BA%95%E5%B7%9DpUAST-flag-vector.JPG" width="240px" height="280px" border="0">
</body></html>
<br>
:The amount of the purified pUAST-flag vector was 45.0375 ng/µl. 
:PCR products for DIAP2 Was not successfully recovered from the agarose gel. 

<br>

</div>