Team:Washington/Primers
From 2011.igem.org
(Difference between revisions)
(→Tool) |
(→Tool) |
||
Line 53: | Line 53: | ||
[http://excel2wiki.net/index.php Excel to wiki format tool] | [http://excel2wiki.net/index.php Excel to wiki format tool] | ||
- | Recreate the table exactly | + | Recreate the table exactly in excel and fill in with data |
Copy the all the data (no header) into the box | Copy the all the data (no header) into the box |
Revision as of 18:50, 13 September 2011
For info on Wiki Tables
Contents |
PCR Conditions and Primers of Registry Parts
Please fill out for every PCR reaction done on a registry part (both new and old).
Amplification Success (S, M, N) | Template Part # | Template Form (M, C, P) | Template Source | Forward Primer Name | Reverse Primer Name | Annealing Temperature (Celsius) | Extension Time (seconds) | Percent DMSO | Polymerase Used | Forward Primer (5'->3') | Reverse Primer (5'->3') | Additional Notes |
---|---|---|---|---|---|---|---|---|---|---|---|---|
S | BBa_XYZ001 | M | Synthesized Gene | EX_Decarb_F | RedDecarb_SP_2 | 60 | 30 | 0 | Phusion | GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCCGCAGCTGGAA | CCAATGCATTGGTTCTGCAGCGGCCGCTACTAGTATCAGTGGTGGTGGTG | Original reverse primer was missing extra nucleotides at end, so amplification worked, cloning didn't |
Fill | Fill | Fill | Fill | Fill | Fill | Fill | Fill | Fill | Fill | Fill | Fill | Fill |
LEGEND
- Amplification Success (S, M, N): Was the amplification successful.
- S = Single Band at Desired Size
- M = Multiple Bands, but one at desired length
- N = No band at desired length
- Template Part #: The Registry Number of the Part being amplified from
- Template Form: The source form of the template DNA
- Miniprep (M)
- Colony (C)
- PCR Product (P)
- Template Source: Where the template is originally from, such as 2011 Parts Kits, Synthesized Gene, Genomic, etc
- Forward Primer (5'->3'): Full sequence of the Forward primer used
- Reverse Primer (5'->3'): Full sequence of the Reverse primer used
- Annealing Temperature (Celsius): The annealing temperature used in the PCR reaction
- Extension Time (seconds): The extension time used in the PCR reaction
- Percent DMSO: Was DMSO added, if not 0, if so at what %
- Polymerase Used: Which polymerase enzyme was used (e.g. Phusion, Taq, Vent, Pfu, etc)
- Primer Name: The name of the primer ordered
- Additional Notes: Any additional relevant information
Tool
Recreate the table exactly in excel and fill in with data
Copy the all the data (no header) into the box
Copy the code starting with the line that looks like |- do not copy header stop copying at |- as well
Paste into this page's code
EXAMPLE TABLE (DO NOT MODIFY)
Alphabetic | Numeric | Date | Unsortable |
---|---|---|---|
d | 20 | 2008-11-24 | This |
b | 8 | 2004-03-01 | column |
a | 6 | 1979-07-23 | cannot |
c | 4.2 | 1492-12-08 | be |
e | 0 | 1601-08-13 | sorted. |