Team:Washington/Primers

From 2011.igem.org

(Difference between revisions)
(→TABLE TO BE FILLED OUT)
Line 30: Line 30:
==TABLE TO BE FILLED OUT==
==TABLE TO BE FILLED OUT==
-
LEGEND:
 
-
*Amplification Success (S, M, N):  Was the amplification successful. 
 
-
**S = Single Band at Desired Size
 
-
**M = Multiple Bands, but one at desired length
 
-
**N = No band at desired length
 
-
*Template Part #:  The Registry Number of the Part being amplified from
 
-
*Template Form:  The source form of the template DNA
 
-
**Miniprep (M)
 
-
**Colony (C)
 
-
**PCR Product (P)
 
-
*Template Source:  Where the template is originally from, such as 2011 Parts Kits, Synthesized Gene, Genomic, etc
 
-
*Forward Primer (5'->3'):  Full sequence of the Forward primer used
 
-
*Reverse Primer (5'->3'):    Full sequence of the Reverse primer used
 
-
*Annealing Temperature (Celsius):  The annealing temperature used in the PCR reaction
 
-
*Extension Time (seconds):  The extension time used in the PCR reaction
 
-
*Percent DMSO:  Was DMSO added, if not 0, if so at what %
 
-
*Polymerase Used:  Which polymerase enzyme was used (e.g. Phusion, Taq, Vent, Pfu, etc)
 
-
*Primer Name:  The name of the primer ordered
 
-
*Additional Notes:  Any additional relevant information
 
-
 
 +
=PCR Conditions and Primers of Registry Parts=
 +
Please fill out for every PCR reaction done on a registry part (both new and old).
{| class="wikitable sortable collapsible" border="1" cellpadding="2" style="text-align: center; width: 200px;"
{| class="wikitable sortable collapsible" border="1" cellpadding="2" style="text-align: center; width: 200px;"
 +
|+'''PCR Conditions and Primers of Registry Parts'''
|-
|-
! scope="col" | Amplification Success<br>(S, M, N)
! scope="col" | Amplification Success<br>(S, M, N)
Line 68: Line 51:
! scope="col" class="unsortable" | Additional Notes
! scope="col" class="unsortable" | Additional Notes
|-
|-
-
| S || TBD || M || Synthesized Gene || EX_Decarb_F || RedDecarb_SP_2 || 60 || 30 || 0 || Phusion || GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCCGCAGCTGGAA || CCAATGCATTGGTTCTGCAGCGGCCGCTACTAGTATCAGTGGTGGTGGTG || Original reverse primer was missing extra nucleotides at end, so amplification worked, cloning didn't
+
| S || BBa_XYZ001 || M || Synthesized Gene || EX_Decarb_F || RedDecarb_SP_2 || 60 || 30 || 0 || Phusion || GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCCGCAGCTGGAA || CCAATGCATTGGTTCTGCAGCGGCCGCTACTAGTATCAGTGGTGGTGGTG || Original reverse primer was missing extra nucleotides at end, so amplification worked, cloning didn't
|-
|-
| Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill
| Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill
|-
|-
|}
|}
 +
 +
LEGEND:
 +
*Amplification Success (S, M, N):  Was the amplification successful. 
 +
**S = Single Band at Desired Size
 +
**M = Multiple Bands, but one at desired length
 +
**N = No band at desired length
 +
*Template Part #:  The Registry Number of the Part being amplified from
 +
*Template Form:  The source form of the template DNA
 +
**Miniprep (M)
 +
**Colony (C)
 +
**PCR Product (P)
 +
*Template Source:  Where the template is originally from, such as 2011 Parts Kits, Synthesized Gene, Genomic, etc
 +
*Forward Primer (5'->3'):  Full sequence of the Forward primer used
 +
*Reverse Primer (5'->3'):    Full sequence of the Reverse primer used
 +
*Annealing Temperature (Celsius):  The annealing temperature used in the PCR reaction
 +
*Extension Time (seconds):  The extension time used in the PCR reaction
 +
*Percent DMSO:  Was DMSO added, if not 0, if so at what %
 +
*Polymerase Used:  Which polymerase enzyme was used (e.g. Phusion, Taq, Vent, Pfu, etc)
 +
*Primer Name:  The name of the primer ordered
 +
*Additional Notes:  Any additional relevant information

Revision as of 02:37, 10 September 2011


Contents

EVERYONE PLEASE ENTER AND FILL OUT THE TABLE

For info on Wiki Tables


EXAMPLE TABLE (DO NOT MODIFY)

Sortable and collapsible table
Alphabetic Numeric Date Unsortable
d 20 2008-11-24 This
b 8 2004-03-01 column
a 6 1979-07-23 cannot
c 4.2 1492-12-08 be
e 0 1601-08-13 sorted.


TABLE TO BE FILLED OUT

PCR Conditions and Primers of Registry Parts

Please fill out for every PCR reaction done on a registry part (both new and old).

PCR Conditions and Primers of Registry Parts
Amplification Success
(S, M, N) 		Template Part # Template Form
(M, C, P) 		Template Source Forward Primer Name Reverse Primer Name Annealing Temperature
(Celsius) 		Extension Time
(seconds) 		Percent DMSO Polymerase Used Forward Primer
(5'->3') 		Reverse Primer
(5'->3') 		Additional Notes
S BBa_XYZ001 M Synthesized Gene EX_Decarb_F RedDecarb_SP_2 60 30 0 Phusion GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCCGCAGCTGGAA CCAATGCATTGGTTCTGCAGCGGCCGCTACTAGTATCAGTGGTGGTGGTG Original reverse primer was missing extra nucleotides at end, so amplification worked, cloning didn't
Fill Fill Fill Fill Fill Fill Fill Fill Fill Fill Fill Fill Fill

LEGEND:

  • Amplification Success (S, M, N): Was the amplification successful.
    • S = Single Band at Desired Size
    • M = Multiple Bands, but one at desired length
    • N = No band at desired length
  • Template Part #: The Registry Number of the Part being amplified from
  • Template Form: The source form of the template DNA
    • Miniprep (M)
    • Colony (C)
    • PCR Product (P)
  • Template Source: Where the template is originally from, such as 2011 Parts Kits, Synthesized Gene, Genomic, etc
  • Forward Primer (5'->3'): Full sequence of the Forward primer used
  • Reverse Primer (5'->3'): Full sequence of the Reverse primer used
  • Annealing Temperature (Celsius): The annealing temperature used in the PCR reaction
  • Extension Time (seconds): The extension time used in the PCR reaction
  • Percent DMSO: Was DMSO added, if not 0, if so at what %
  • Polymerase Used: Which polymerase enzyme was used (e.g. Phusion, Taq, Vent, Pfu, etc)
  • Primer Name: The name of the primer ordered
  • Additional Notes: Any additional relevant information
Retrieved from "http://2011.igem.org/Team:Washington/Primers"