Team:Washington/Primers

From 2011.igem.org

(Difference between revisions)
(Created page with "{{Template:Team:Washington/Templates/Top}} =EVERYONE PLEASE ENTER AND FILL OUT THE TABLE= For info on [http://en.wikipedia.org/wiki/Help:Table#Sorting Wiki Tables] ==EXAMPL...")
Line 31: Line 31:
==TABLE TO BE FILLED OUT==
==TABLE TO BE FILLED OUT==
LEGEND:
LEGEND:
 +
*Amplification Success (S, M, N):  Was the amplification successful. 
 +
**S = Single Band at Desired Size
 +
**M = Multiple Bands, but one at desired length
 +
**N = No band at desired length
*Template Part #:  The Registry Number of the Part being amplified from
*Template Part #:  The Registry Number of the Part being amplified from
*Template Form:  The source form of the template DNA
*Template Form:  The source form of the template DNA
Line 43: Line 47:
*Percent DMSO:  Was DMSO added, if not 0, if so at what %
*Percent DMSO:  Was DMSO added, if not 0, if so at what %
*Polymerase Used:  Which polymerase enzyme was used (e.g. Phusion, Taq, Vent, Pfu, etc)
*Polymerase Used:  Which polymerase enzyme was used (e.g. Phusion, Taq, Vent, Pfu, etc)
-
*Amplification Success (S, M, N):  Was the amplification successful. 
 
-
**S = Single Band at Desired Size
 
-
**M = Multiple Bands, but one at desired length
 
-
**N = No band at desired length
 
*Primer Name:  The name of the primer ordered
*Primer Name:  The name of the primer ordered
*Additional Notes:  Any additional relevant information
*Additional Notes:  Any additional relevant information
Line 52: Line 52:
-
{| class="wikitable sortable collapsible" border="1" cellpadding="2"
+
{| class="wikitable sortable collapsible" border="1" cellpadding="2" style="text-align: center; width: 200px;"
|-
|-
-
! scope="col"  width="100pt" | Template Part #
+
! scope="col" | Amplification Success<br>(S, M, N)
-
! scope="col"  width="100pt" | Template Form (M, C, P)
+
! scope="col"  width="150pt" | Template Part #
 +
! scope="col"  width="100pt" | Template Form<br> (M, C, P)
! scope="col"  width="100pt" | Template Source
! scope="col"  width="100pt" | Template Source
-
! scope="col"  width="100pt" | Forward Primer (5'->3')
+
! scope="col"  width="100pt" | Forward Primer<br> (5'->3')
-
! scope="col"  width="100pt" | Reverse Primer (5'->3')
+
! scope="col"  width="100pt" | Reverse Primer <br>(5'->3')
-
! scope="col"  width="100pt" | Annealing Temperature (Celsius)
+
! scope="col"  width="100pt" | Annealing Temperature<br> (Celsius)
-
! scope="col" | Extension Time (seconds)
+
! scope="col" | Extension Time <br>(seconds)
! scope="col" | Percent DMSO
! scope="col" | Percent DMSO
! scope="col" | Polymerase Used
! scope="col" | Polymerase Used
-
! scope="col" | Amplification Success (S, M, N)
 
! scope="col"  class="unsortable" | Forward Primer Name
! scope="col"  class="unsortable" | Forward Primer Name
! scope="col"  class="unsortable" | Reverse Primer Name
! scope="col"  class="unsortable" | Reverse Primer Name
! scope="col" class="unsortable" | Additional Notes
! scope="col" class="unsortable" | Additional Notes
|-
|-
-
| TBD || M || Synthesized Gene || GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCCGCAGCTGGAA || CCAATGCATTGGTTCTGCAGCGGCCGCTACTAGTATCAGTGGTGGTGGTG || 60 || 30 || 0 || Phusion || S || EX_Decarb_F || RedDecarb_SP_2 || Original reverse primer was missing extra nucleotides at end, so amplification worked, cloning didn't
+
| S || TBD || M || Synthesized Gene || GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCCGCAGCTGGAA || CCAATGCATTGGTTCTGCAGCGGCCGCTACTAGTATCAGTGGTGGTGGTG || 60 || 30 || 0 || Phusion || EX_Decarb_F || RedDecarb_SP_2 || Original reverse primer was missing extra nucleotides at end, so amplification worked, cloning didn't
|-
|-
| Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill
| Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill
|-
|-
|}
|}

Revision as of 21:08, 9 September 2011


EVERYONE PLEASE ENTER AND FILL OUT THE TABLE

For info on Wiki Tables


EXAMPLE TABLE (DO NOT MODIFY)

Sortable and collapsible table
Alphabetic Numeric Date Unsortable
d 20 2008-11-24 This
b 8 2004-03-01 column
a 6 1979-07-23 cannot
c 4.2 1492-12-08 be
e 0 1601-08-13 sorted.


TABLE TO BE FILLED OUT

LEGEND:

  • Amplification Success (S, M, N): Was the amplification successful.
    • S = Single Band at Desired Size
    • M = Multiple Bands, but one at desired length
    • N = No band at desired length
  • Template Part #: The Registry Number of the Part being amplified from
  • Template Form: The source form of the template DNA
    • Miniprep (M)
    • Colony (C)
    • PCR Product (P)
  • Template Source: Where the template is originally from, such as 2011 Parts Kits, Synthesized Gene, Genomic, etc
  • Forward Primer (5'->3'): Full sequence of the Forward primer used
  • Reverse Primer (5'->3'): Full sequence of the Reverse primer used
  • Annealing Temperature (Celsius): The annealing temperature used in the PCR reaction
  • Extension Time (seconds): The extension time used in the PCR reaction
  • Percent DMSO: Was DMSO added, if not 0, if so at what %
  • Polymerase Used: Which polymerase enzyme was used (e.g. Phusion, Taq, Vent, Pfu, etc)
  • Primer Name: The name of the primer ordered
  • Additional Notes: Any additional relevant information


Amplification Success
(S, M, N)
Template Part # Template Form
(M, C, P)
Template Source Forward Primer
(5'->3')
Reverse Primer
(5'->3')
Annealing Temperature
(Celsius)
Extension Time
(seconds)
Percent DMSO Polymerase Used Forward Primer Name Reverse Primer Name Additional Notes
S TBD M Synthesized Gene GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCCGCAGCTGGAA CCAATGCATTGGTTCTGCAGCGGCCGCTACTAGTATCAGTGGTGGTGGTG 60 30 0 Phusion EX_Decarb_F RedDecarb_SP_2 Original reverse primer was missing extra nucleotides at end, so amplification worked, cloning didn't
Fill Fill Fill Fill Fill Fill Fill Fill Fill Fill Fill Fill Fill