Team:Potsdam Bioware/BioBricks

Contents 1 BioBricks 1.1 BioBrick mdnED 1.2 BioBrick mdnA 1.3 BioBrick mdnB 1.4 BioBrick mdnC 1.5 BioBrick mdnD 1.6 BioBrick mdnE 1.7 BioBrick mdnA c-myc gene III 2 Gene III 2.1 BioBrick AraC-TEV 2.2 BioBrick AraC-14_3C protease 2.3 BioBrick ssTorA_CS-TEV_blaFL 2.4 BioBrick ssTorA_CS-14_3C_blaFL

BioBricks

Label number	BioBrick Nickname	Tube label
BBa_K627000	mdnED	1
BBa_K627001	mdnA	2
BBa_K627002	mdnB	3
BBa_K627003	mdnC	4
BBa_K627004	mdnD	5
BBa_K627005	mdnE	6
BBa_K627006	mdnA c-myc gene III	7
BBa_K627007	c-myc gene III	8
BBa_K627008	AraC TEV protease 1	9
BBa_K627009	AraC TEV protease 2	10
BBa_K627010	AraC TEV protease 3	11
BBa_K627011	AraC 14_3C protease	12
BBa_K627012	ssTorA CS-TEV BlaFL	13
BBa_K627013	ssTorA CS-14_3C BlaFL	14
BBa_K627014	A3_Ara_YFP clone 1	15
BBa_K627015	A3_lac_YFP clone 2	16

BioBrick mdnED

Part name: BBa_K627000
Part type: Coding
Short description: ABC transporter and N-acetyltransferase from the mdn-cluster

Full description:
The BioBrick mdnED is a part of the whole microviridin gene (mdn) cluster, which encodes the protease inhibitor microviridin L. Microviridins are tricyclic depsipeptides, which are ribosomally synthesized by the cyanobacteria Microcystis aeruginosa (Ziemert et al., 2010). They have a promising potential for therapy as they can block disease-relevant proteases (Ziemert et al., 2008).

Microviridins are synthesized from a ribosomal precursor peptide (MdnA). Additionally, the microviridin L biosynthesis gene cluster consists of genes encoding an ATP-grasp-type ligase (mdnB and mdnC) and genes, which encode an ABC transporter (mdnE) and a N-acetyltransferase of the GNAT family (mdnD) (Ziemert et al., 2008).

In the following BioBrick mdnED the genes mdnD (N-acetyltransferase of the GNAT family) and mdnE (ABC transporter) is encoded (Ziemert et al., 2008).

Source of the part:
The BioBrick mdnDE as a part of the microviridin gene (mdn) cluster was isolated from Microcystis aeruginosa strain NIES-843.

Design information:
This BioBrick was built by PCR using the following PCR primers
Forward primer: TAAATGAATTCGCGGCCGCTTCTAGATGCCTCAATATACTACTAAAC
Reverse primer: ATTTCTGCAGCGGCCGCTACTAGTATCAGCAAACCCTACTTAATTTC
To insert mdnED in the vector pSB1C3, the resulting PCR product and the vector were digested with the restriction enzymes EcoRI and SpeI.

Because this BioBrick is an expression part, the adenine of mdnE gene's start codon is part of the XbaI recognition site.

References:
Ziemert, N., Ishida, K., Liaimer, A., Hertweck, C. & Dittmann, E. (2008). Ribosomal synthesis of tricyclic depsipeptides in bloom-forming cyanobacteria. Angewandte Chemie (International ed. in English) 47, 7756-9

Ziemert, N., Ishida, K., Weiz, A., Hertweck, C. & Dittmann, E. (2010). Exploiting the natural diversity of microviridin gene clusters for discovery of novel tricyclic depsipeptides. Applied and environmental microbiology 76, 3568-74

Genebank file:
Media: UP_BioBrick_mdnED.gb

BioBrick mdnA

Part name: BBa_K627001
Part type: Coding
Short description: Ribosomal precursor peptide gene (mdnA) from mdn-cluster

Full description:
The BioBrick mdnA is a part of the whole microviridin gene (mdn) cluster, which encodes the protease inhibitor microviridin L. Microviridins are tricyclic depsipeptides, which are ribosomally synthesized by Microcystis aeruginosa (Ziemert et al., 2010). They have a promising potential for therapy as they can block disease-relevant proteases (Ziemert et al., 2008).

Microviridins are synthesized from a ribosomal precursor peptide (MdnA). Additionally, the microviridin L biosynthesis gene cluster consists of genes encoding an ATP-grasp-type ligase (mdnB and mdnC) and genes, which encode an ABC transporter (mdnE) and a N-acetyltransferase of the GNAT family (mdnD) (Ziemert et al., 2008).

The following BioBrick mdnA encodes the ribosomal precursor peptide (MdnA), which is essential for microviridin production (Ziemert et al., 2008).

Because this BioBrick is a RFC10 expression part, the adenine of mdnB gene`s start codon is part of the XbaI recognition site.

Source of the part:
The BioBrick mdnA as a part of the microviridin gene (mdn) cluster was isolated from Microcystis aeruginosa strain NIES-843.

Design information:
This BioBrick was built by PCR using the following PCR primers
Forward primer: TTCCATGGCGCCAGAGGAATCTAGATGGCATATCCCAACGATC
Reverse primer: CTTCTGACTGGGAAGATTATACCGGTTAATACTAGTAGCGGCCGCTGCAGGACGTC
To insert mdnA in the vector pSB1C3, the resulting PCR product and the vector were digested with the restriction enzymes EcoRI and SpeI.

Because this BioBrick is an expression part, the adenine of mdnA gene`s start codon is part of the XbaI recognition site. Further the sequence contains a AgeI recognition site after mdnA.

Experiences:

References:
Ziemert, N., Ishida, K., Liaimer, A., Hertweck, C. & Dittmann, E. (2008). Ribosomal synthesis of tricyclic depsipeptides in bloom-forming cyanobacteria. Angewandte Chemie (International ed. in English) 47, 7756-9

Ziemert, N., Ishida, K., Weiz, A., Hertweck, C. & Dittmann, E. (2010). Exploiting the natural diversity of microviridin gene clusters for discovery of novel tricyclic depsipeptides. Applied and environmental microbiology 76, 3568-74

Genbank file:
Media: UP_Biobrick_mdnA.gb

BioBrick mdnB

Part name: BBa_K627002
Part type: Coding
Short description: ATP-grasp-type ligase from mdn-cluster

Full description:
The BioBrick mdnB is a part of the whole microviridin gene (mdn) cluster, which encodes the protease inhibitor microviridin L. Microviridins are tricyclic depsipeptides, which are ribosomally synthesized by Microcystis aeruginosa (Ziemert et al., 2010). They have a promising potential for therapy as they can block disease-relevant proteases (Ziemert et al., 2008).

Microviridins are synthesized from a ribosomal precursor peptide (MdnA). Additionally, the microviridin L biosynthesis gene cluster consists of genes encoding an ATP-grasp-type ligase (mdnB and mdnC) and genes, which encode an ABC transporter (mdnE) and a N-acetyltransferase of the GNAT family (mdnD) (Ziemert et al., 2008).

The following BioBrick mdnB encodes a ATP-grasp-type ligase (Ziemert et al., 2008).

Because this BioBrick is an expression part, the adenine of mdnB gene`s start codon is part of the XbaI recognition site.

Source of the part:
The BioBrick mdnB as a part of the microviridin gene (mdn) cluster was isolated from Microcystis aeruginosa strain NIES-843.

Design information:
This BioBrick was built by PCR using the following PCR primers
Forward primer: ATTATGAATTCGCGGCCGCTTCTAGATGAAAGAATCGCCTAAAGTTG
Reverse primer: TAATCTGCAGCGGCCGCTACTAGTATCAACCGAAGACTAAAAAATCAGCG
To insert mdnB in the vector pSB1C3, the resulting PCR product and the vector were digested with the restriction enzymes EcoRI and SpeI.

Because this BioBrick is an expression part, the adenine of mdnE gene's start codon is part of the XbaI recognition site.

References:
Ziemert, N., Ishida, K., Liaimer, A., Hertweck, C. & Dittmann, E. (2008). Ribosomal synthesis of tricyclic depsipeptides in bloom-forming cyanobacteria. Angewandte Chemie (International ed. in English) 47, 7756-9

Ziemert, N., Ishida, K., Weiz, A., Hertweck, C. & Dittmann, E. (2010). Exploiting the natural diversity of microviridin gene clusters for discovery of novel tricyclic depsipeptides. Applied and environmental microbiology 76, 3568-74

Genbank file:
Media: UP_BioBrick_mdnB.gb

BioBrick mdnC

Part name: BBa_K627003
Part type: Coding
Short description: ATP-grasp-type ligase from the mdn-cluster

Full description:
The BioBrick mdnC is a part of the whole microviridin gene (mdn) cluster, which encodes the protease inhibitor microviridin L. Microviridins are tricyclic depsipeptides, which are ribosomally synthesized by Microcystis (Ziemert et al., 2010). They have a promising potential for therapy as they can block disease-relevant proteases (Ziemert et al., 2008).

Microviridins are synthesized from a ribosomal precursor peptide (MdnA). Additionally, the microviridin L biosynthesis gene cluster consists of genes encoding an ATP-grasp-type ligase (mdnB and mdnC) and genes, which encode an ABC transporter (mdnE) and a N-acetyltransferase of the GNAT family (mdnD) (Ziemert et al., 2008).

The following BioBrick mdnC encodes the ATP-grasp-type ligase (Ziemert et al., 2008).

Because this BioBrick is a RF10 expression part, the adenine of mdnC gene`s start codon is part of the XbaI recognition site.

Source of the part:
The BioBrick mdnC as a part of the microviridin gene (mdn) cluster was isolated from Microcystis aeruginosa strain NIES-843.

Design information:
This BioBrick was built by PCR using the following PCR primers
Forward primer: TATTTGAATTCGCGGCCGCTTCTAGATGACCGTTTTAATTGTTAC
Reverse primer: ATTTCTGCAGCGGCCGCTACTAGTATTATGAGTTAACTAGGATTTC
To insert mdnC in the vector pSB1C3, the resulting PCR product and the vector were digested with the restriction enzymes EcoRI and SpeI.

Because this BioBrick is a RF10 expression part, the adenine of mdnA gene`s start codon is part of the XbaI recognition site.

References:
Ziemert, N., Ishida, K., Liaimer, A., Hertweck, C. & Dittmann, E. (2008). Ribosomal synthesis of tricyclic depsipeptides in bloom-forming cyanobacteria. Angewandte Chemie (International ed. in English) 47, 7756-9

Ziemert, N., Ishida, K., Weiz, A., Hertweck, C. & Dittmann, E. (2010). Exploiting the natural diversity of microviridin gene clusters for discovery of novel tricyclic depsipeptides. Applied and environmental microbiology 76, 3568-74

Genebank file:
Media: UP_BioBrick_mdnC.gb

BioBrick mdnD

Part name: BBa_K627004
Part type: Coding
Short description: N-acetyltransferase from the mdn-cluster

Full description:
The BioBrick mdnD is a part of the whole microviridin gene (mdn) cluster, which encodes the protease inhibitor microviridin L. Microviridins are tricyclic depsipeptides, which are ribosomally synthesized by Microcystis (Ziemert et al., 2010). They have a promising potential for therapy as they can block disease-relevant proteases (Ziemert et al., 2008).

Microviridins are synthesized from a ribosomal precursor peptide (MdnA). Additionally, the microviridin L biosynthesis gene cluster consists of genes encoding an ATP-grasp-type ligase (mdnB and mdnC) and genes, which encode an ABC transporter (mdnE) and a N-acetyltransferase of the GNAT family (mdnD) (Ziemert et al., 2008).

The following BioBrick mdnD encodes a N-acetyltransferase of the GNAT family (Ziemert et al., 2008).

Because this BioBrick is a RF10 expression part the adenine of mdnD gene's start codon is part of the XbaI recognition site.

Source of the part:
The BioBrick mdnD as a part of the microviridin gene (mdn) cluster was isolated from Microcystis aeruginosa strain NIES-843.

Design information:
This BioBrick was built by PCR using the following PCR primers
Forward primer: TATATGAATTCGCGGCCGCTTCTAGATGAAAGCACTGGAAAAACTG
Reverse primer: ATTTCTGCAGCGGCCGCTACTAGTATCAGCAAACCCTACTTAATTTC
To insert mdnD in the vector pSB1C3, the resulting PCR product and the vector were digested with the restriction enzymes EcoRI and SpeI.

Because this BioBrick is a RF10 expression part the adenine of mdnD gene`s start codon is part of the XbaI recognition site.

References:
Ziemert, N., Ishida, K., Liaimer, A., Hertweck, C. & Dittmann, E. (2008). Ribosomal synthesis of tricyclic depsipeptides in bloom-forming cyanobacteria. Angewandte Chemie (International ed. in English) 47, 7756-9

Ziemert, N., Ishida, K., Weiz, A., Hertweck, C. & Dittmann, E. (2010). Exploiting the natural diversity of microviridin gene clusters for discovery of novel tricyclic depsipeptides. Applied and environmental microbiology 76, 3568-74

Genebank file
Media: UP_BioBrick_mdnD.gb

BioBrick mdnE

Part name: BBa_K627005
Part type: Coding
Short description: ABC transporter from the mdn-cluster

Full description:
The BioBrick mdnE is a part of the whole microviridin gene (mdn) cluster, which encodes the protease inhibitor microviridin L. Microviridins are tricyclic depsipeptides, which are ribosomally synthesized by Microcystis (Ziemert et al., 2010). They have a promising potential for therapy as they can block disease-relevant proteases (Ziemert et al., 2008).

Microviridins are synthesized from a ribosomal precursor peptide (MdnA). Additionally, the microviridin L biosynthesis gene cluster consists of genes encoding an ATP-grasp-type ligase (mdnB and mdnC) and genes, which encode an ABC transporter (mdnE) and a N-acetyltransferase of the GNAT family (mdnD) (Ziemert et al., 2008).

The following BioBrick mdnE encodes an ABC transporter (Ziemert et al., 2008).

Because this BioBrick is a RF10 expression part the adenine of mdnE gene`s start codon is part of the XbaI recognition site.

Source of the part:
The BioBrick mdnE as a part of the microviridin gene (mdn) cluster was isolated from Microcystis aeruginosa strain NIES-843.

Design information:
This BioBrick was built by PCR using the following PCR primers
Forward primer: TAAATGAATTCGCGGCCGCTTCTAGATGCCTCAATATACTACTAAAC
Reverse primer: ATTTCTGCAGCGGCCGCTACTAGTACTATATTCTCACCCATTTTAAG
To insert mdnE in the vector pSB1C3, the resulting PCR product and the vector were digested with the restriction enzymes EcoRI and SpeI.

Because this BioBrick is a RF10 expression part the adenine of mdnE gene`s start codon is part of the XbaI recognition site.

References:
Ziemert, N., Ishida, K., Liaimer, A., Hertweck, C. & Dittmann, E. (2008). Ribosomal synthesis of tricyclic depsipeptides in bloom-forming cyanobacteria. Angewandte Chemie (International ed. in English) 47, 7756-9

Ziemert, N., Ishida, K., Weiz, A., Hertweck, C. & Dittmann, E. (2010). Exploiting the natural diversity of microviridin gene clusters for discovery of novel tricyclic depsipeptides. Applied and environmental microbiology 76, 3568-74

Genebank file
Media: UP_BioBrick_mdnE.gb

BioBrick mdnA c-myc gene III

Part name: BBa_K627006
Part type: Coding
Short description: Fusion part of mdnA gene with c-terminal myc-tag and gene III

Full description:
An appropriate vector containing the BioBrick mdnA-myc-geneIII-fusion gene is a very important milestone of the development of a functional phage display system for screening of a microviridin (mdnA) library. Microviridins are tricyclic depsipeptides from cyanobacteria which are able to bind and inhibit proteases. The gene III protein is a coat protein from the filamentous bacteriophage M13. It appears only 3-5 times on the tip of the phage and is responsible for infection of bacterial cells. After transformation of E. coli with the vector and co-infection with helper phages E. coli cells are able to produce phage particles carrying microviridin on their surface. Using these phages the fundamental suitability of phage display as a screening method for mdnA varieties was indicated. This has great importance for identifying microviridin varieties of therapeutical relevance. The inserted myc sequence enables the easy detection or purification. In our project the successful expression of the mdnA-myc-gene III-fusion protein was determined by ELISA. Subsequent the production of phages carrying mdnA in E. coli was analyzed by phage display.

Source of the part:
The BioBrick mdnA is a part of the microviridin gene (mdn) cluster which was isolated from Microcystis aeruginosa strain NIES-843.
The gene III protein is a coat protein from the filamentous bacteriophage M13.

Design information:
Gene III was amplified from the vector pak100blaKDIR using the following primers
Forward:TAAGCTTCTAGATGGCCGGCGAGCAGAAGCTGATCTCTGAGGAAGACCTGGGTGGTGGCTCTGGTTCC
Reverse: TGCTTAGACGTCCTGCAGCGGCCGCTACTAGTATTAACCGGTAGACTCCTTATTACGCAGTA

The mdnA gene was amplified from the vector pARW089 using the following primers
Forward: TTCCATGGCGCCAGAGGAATCTAGATGGCATATCCCAACGATC
Reverse: CTTCTGACTGGGAAGATTATACCGGTTAATACTAGTAGCGGCCGCTGCAGGACGTC

Gene III was amplified from pak100blaKDIR and mdnA from pARW089 by PCR. The primers were designed to enable the introduction of iGEM. The PCR product gene III was digested by whereas the PCR product mdnA was digested by AgeI. Thus a mdnA-gene III fusion part according to RFC25 was generated whereby AgeI and NgoMIV overhangs are compatible and placed in frame with the protein sequence. The ligation of AgeI and NgoMIV overhangs resulted in a scar coding for the threonine and glycine. Because the introduction of restriction sites before mdnA leaded to a great distance between ribosome binding site and mdnA a second RBS was inserted among SfoI and XbaI recognition sites to ensure a sufficiently expression rate of the mdnA-gene III-fusion gene. Between mdnA and gene III myc sequence was inserted.

Because this BioBrick is an expression part, the adenine of mdnA gene's start codon is part of the XbaI recognition site. Further the sequence contains a AgeI recognition site after gene III.

Experiences:

References:
Smith, G.P. (1985). Filamentous fusion phage: Novel expression vectors that display cloned antigens on the virus surface. Science 228: 1315-17

Ziemert, N., Ishida, K., Liaimer, A., Hertweck, C. & Dittmann, E. (2008). Ribosomal synthesis of tricyclic depsipeptides in bloom-forming cyanobacteria. Angewandte Chemie (International ed. in English) 47, 7756-9

Ziemert, N., Ishida, K., Weiz, A., Hertweck, C. & Dittmann, E. (2010). Exploiting the natural diversity of microviridin gene clusters for discovery of novel tricyclic depsipeptides. Applied and environmental microbiology 76, 3568-74

Genebank file:
Media: UP_Biobrick_mdnA_c-myc_geneIII.gb

Gene III

BioBrick AraC-TEV

Part name: BBa_K627008, BBa_K627009, BBa_K627010
Part type: Device
Short description: Fusion part of pBAD arabinose-inducible induction system and the TEV protease

Full description:
This BioBrick is a 2 part fusion of arabinose-inducible induction system and the TEV protease. TEV protease is the common name for the 27 kDa catalytic domain of the Nuclear Inclusion a endopeptidase (NIa) encoded by the tobacco etch virus (TEV). TEV protease is a useful reagent for cleaving fusion proteins. It recognizes a linear epitope of the general form E-Xaa-Xaa-Y-Xaa-Q-(G/S), with cleavage occurring between Q and G or Q and S. In TEV protease the serine nucleophile of the conventional Ser-Asp-His triad is a cysteine instead. This probably explains why TEV protease is resistant to many commonly used protease inhibitors. At 37°C, the TEV protease is located in inclusion bodies, which leads to an inactive form. Incubated at 30°C, the protease is expressed as soluble type and is highly active. The induction system was amplified via PCR and fused via NgoMIV with the protease.

Source of the part:
Arabinose inducible operon form pBAD_iGEM_express, TEV protease from Gunther Stier et al.

Design Notes
This BioBrick was built by PCR using the following PCR primers:

Primer used for site directed mutagenesis:
Fragment 1:

• r_TEV_ACCAGC: GGAATGTGCAGCTGGTGTCTGACACC
  
• f_TEV_iGEM: ATATAGAATTCGCGGCCGCTTCTAGATGGGAGAAAGCTTGTTTAAGGGA
  

Fragment 2:

• r_TEV_iGEM_BamHI: ATATAGGATCCACTGCAGCGGCCGCTACTAGTTTATTGCGAGTACACCAATTCATTCAT
  
• f_TEV_ACCAGC: GGTGTCAGACACCAGCTGCACATTCC
  

Primer used for assembly PCR of mutated fragments:

• f_TEV_iGEM: ATATAGAATTCGCGGCCGCTTCTAGATGGGAGAAAGCTTGTTTAAGGGA
  
• r_TEV_iGEM_BamHI: TATAGGATCCACTGCAGCGGCCGCTACTAGTTTATTGCGAGTACACCAATTCATTCAT
  

Primers used for amplification of pBAD arabinose-inducible induction system:

• f_AraC_iGEM_HindIII: TATAAGCTTGAATTCGCGGCCGCTTCTAGATTATGACAACTTGACGGCTACATCATT
  
• r_AraC_NgoMIV: ATAGCCGGCCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGCCC
  

Primers used for amplification and modification of TEV protease:

• f_TEV_AraFusion_NgoMIV: ATATTGCCGGCATGGGAGAAAGCCTGTTTAAGGGA
  
• r_TEV_iGEM_BamHI: ATATAGGATCCACTGCAGCGGCCGCTACTAGTTTATTGCGAGTACACCAATTCATTCAT
  

Experience:

References:
Cabrita, L. D., Gilis, D., Robertson, A. L., Dehouck, Y., Rooman, M. and Bottomley, S. P. (2007). Enhancing the stability and solubility of TEV protease using in silico design. Protein Sci. 16: 2360-2367

Kapust, R. B., Tözsér, J., Fox, J. D., Anderson, D. E., Cherry, S., Copeland, T. D., and Waugh, D. S. (2001). Tobacco etch virus protease: Mechanism of autolysis and rational design of stable mutants with wild-type catalytic proficiency. Prot. Eng. 14: 993-1000.

Lucast, L. J., Batey, R. T., and Doudna, J. A. (2001). Large-scale purification of a stable form of recombinant tobacco etch virus protease. Biotechniques 30: 544-550.

Genebank file
Media:BioBrick_AraC-TEV_comp.gb

Three parts are existing.

BioBrick AraC-14_3C protease

Part name: BBa_K627011
Part type:Device
Short description: Fusion part of arabinose-inducible induction system and the HRV 14_3C protease

Full description:
This BioBrick is a 2 part fusion of arabinose-inducible induction system and the HRV 14_3C protease. The recombinant type 14_3C protease from human rhinovirus (HRV 3C) recognizes the same cleavage site as the native enzyme: LeuGluValLeuPheGln↓GlyPro.
The small, 22 kDa size of the protease got its optimal activity at 4°C but is still very active at 37°C. It is commonly used for an easy tag removal after the purification of recombinant proteins carrying his-tag. The 14_3C works with a catalytic triade, containing the amino acid residues Ser-Asp-His at its active site.

The arabinose-inducible induction system was amplified via PCR from the pBAD_iGEMexpress vector and fused via NgoMIV with the HRV 14_3C protease. An effective induction can be accomplished with 2 mM up to 25 mM arabinose.

Source of the part:
Arabinose inducible operon form pBAD_iGEM_express was ampilied via PCR, 14_3C protease was isolated from the genome of human rhinovirus 14_3C and mutated with primers listed in part description BBa: to remove all iGEM restriction sites inside the protease gene.

Design Notes:
This BioBrick was built by PCR using the following PCR primers:
Site directed mutagenesis of HRV 14 3C protease:
Fragment 1:

• f_14_3C_iGEM: ATATAGAATTCGCGGCCGCTTCTAGATGGGACCAAACACAGAATTTGCACTATCC
• r_14_3C_ACCAGC: ACCATTTGCTGGTACATCATCACCAGG

Fragment 2:

• f_14_3C_ACCAGC: CCTGGTGATGATGTACCAGCAAATGGT
• r_14_3C_tm_XbaI208_A-T: CACTGTAAGCTCAAGATTAATGTTCTC

Fragment 3:

• f_14_3C_tm_Xba208_A-T: GAGAACATTAATCTTGAGCTTACAGTG
• r_14_3C_tm_XbaI280_A-T: ATCCACACCTTCGAGATCTTCTGATAT

Fragment 4:

• f_14_3C_tm_Xba280_A-T: ATATCAGAAGATCTCGAAGGTGTGGAT
• r_14_3C_iGEM_BamHI: ATATAGGATCCACTGCAGCGGCCGCTACTAGTTTTGTTTCTCTACAAAATATTGTTTTTTAAGTTGAGCTGA

Primers used for first assembly PCR of mutated fragments:
Fragment 5, containing Fragment 1 and 2:

• f_14_3C_iGEM: ATATAGAATTCGCGGCCGCTTCTAGATGGGACCAAACACAGAATTTGCACTATCC
• r_14_3C_tm_Xba208_A-T: CACTGTAAGCTCAAGATTAATGTTCTC

Fragment 6, containing Fragment 3 and 4:

• f_14_3C_tm_Xba208_A-T: GAGAACATTAATCTTGAGCTTACAGTG
• r_14_3C_iGEM_BamHI: ATATAGGATCCACTGCAGCGGCCGCTACTAGTTTTGTTTCTCTACAAAATATTGTTTTTTAAGTTGAGCTGA

Primer used for final assembly PCR of mutated fragments:
Complete mutated 14_3C protease, containing Fragment 5 and 6:

• f_14_3C_iGEM: ATATAGAATTCGCGGCCGCTTCTAGATGGGACCAAACACAGAATTTGCACTATCC
• r_14_3C_iGEM_BamHI: ATATAGGATCCACTGCAGCGGCCGCTACTAGTTTTGTTTCTCTACAAAATATTGTTTTTTAAGTTGAGCTGA

Primers used for amplification of the pBAD arabinose-inducible induction system:

• f_AraC_iGEM_HindIII: TATAAGCTTGAATTCGCGGCCGCTTCTAGATTATGACAACTTGACGGCTACATCATT
• r_AraC_NgoMIV: ATAGCCGGCCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGCCC

Primers used for amplification and modification of HRV 14 3C protease:

• f_14_3C_AraFusion_NgoMIV: ATATTGCCGGCATGGGACCAAACACAGAATTTGCACTATCC
• r_14_3C_iGEM_BamHI: ATATAGGATCCACTGCAGCGGCCGCTACTAGTTTTGTTTCTCTACAAAATATTGTTTTTTAAGTTGAGCTGA

Experience:

References:
Combination of Two Separate Binding Domains Defines Stoichiometry between Type III Secretion System Chaperone IpgC and Translocator Protein IpaB, Ravi Kumar Lokareddy, Michele Lunelli, Björn Eilers, Vivien Wolter, and Michael Kolbe, December 17, 2010 The Journal of Biological Chemistry, 285, 39965-39975.

Cleavage of Small Peptides In Vitro by Human Rhinovirus 14 3C Protease expressed in Escherichia coli, MICHAEL G. CORDINGLEY,* R. BRUCE REGISTER, PIA L. CALLAHAN, VICTOR M. GARSKY,AND RICHARD J. COLONNO JOURNAL OF VIROLOGY, Dec. 1989, p. 5037-5045

Genebank file:
Media:BioBrick_AraC-14_3C.gb

BioBrick ssTorA_CS-TEV_blaFL

Part name: BBa_K627012
Part type: Composite Part
Short description: Fusion of ssTorA, a cleavage site for TEV protease and beta lactamase

Full description:
This construct contains the cleavage site for the TEV protease flanked by the sequence of beta-lactamase and the TorA signal sequence for the TAT (twin arginine translocation) pathway, thus in case of the expression of the complete construct the beta lactamase can be transported into periplasm and provide ampicillin resistance. The TorA signal-sequence originates from the enzyme Trimethylamin-N-Oxid-Reduktase, which needs to be folded in the cytoplasm. The beta lactamase is an enzyme which cleaves lactam rings and makes bacteria resistant to antibiotics like ampicillin and penicillin. The cleavage site for the TEV protease was created via oligo hybridization and ligated into the construct with cleavage site for XhoI and NheI, which makes this part modular and easy adaptable for any other protease.

Source
TorA signal sequence and the lactamase was amplified via PCR from the vector pJC354, which originates from two iGEM compatible BioBricks: BBa_K208005 and BBa_I757010. The cleavage site was created, based on the information of the Brenda enzymes database, via 2 oligonucleotides ordered from SigmaAldrich.

Design Notes:
This BioBrick was built by PCR using the following PCR primers:

• p_TorA-f: CTTCTAGATGAACAATAACGATCTCTTTCAGGCATC
• o_Bla_igem_r: CTACTAGTATTAACCGGTCCAATGCTTAATCAGTGAGGCAC

Experience

References
ssTorA - http://partsregistry.org/Part:BBa_K208005
blaFL - http://partsregistry.org/Part:BBa_I757010

Genebank file
Media:BioBrick_ssTorA_CS-TEV_blaFL.gb

BioBrick ssTorA_CS-14_3C_blaFL

Part name: BBa_K627013
Part type: Composite Part
Short description: Fusion of ssTorA, a cleavage site for HRV 14_3C protease and beta lactamase

Full description:
This construct contains the cleavage site for the HRV 14_3C protease flanked by the sequence of beta-lactamase and the TorA signal sequence for the TAT (twin arginine translocation) pathway, thus in case of the expression of the complete construct the beta lactamase can be transported into periplasm and provide ampicillin resistance. The TorA signal-sequence originate from the enzyme Trimethylamin-N-Oxid-Reduktase, which needs to be folded in the cytoplasm. The beta lactamase is an enzyme which cleaves lactam rings and makes bacteria resistant to antibiotics like ampicillin and penicillin. The cleavage site for the HRV 14_3C protease was created via oligo hybridization and ligated into the construct with cleavage site for XhoI and NheI, which makes this part modular and easy adaptable for any other protease.

Source
TorA signal sequence and the lactamase was amplified via PCR from the vector pJC354, which originates from two iGEM compatible BioBricks: BBa_K208005 and BBa_I757010. The cleavage site was created, based on the information of the Brenda enzymes database, via 2 oligonucleotides ordered from SigmaAldrich.

Design Notes:
This BioBrick was built by PCR using the following PCR primers:

• p_TorA-f: CTTCTAGATGAACAATAACGATCTCTTTCAGGCATC
• o_Bla_igem_r: CTACTAGTATTAACCGGTCCAATGCTTAATCAGTGAGGCAC

Experience

References
ssTorA - http://partsregistry.org/Part:BBa_K208005
blaFL - http://partsregistry.org/Part:BBa_I757010

Genebank files
Media:BioBrick_ssTorA_CS-14_3C_blaFL.gb