Team:Freiburg/Notebook/19 July

• < home >
• < team >
  • → members
  • → attributions
  • → freiburg
• < project >
  • → description
  • → results
  • → modeling
  • → notebook
  • → sample data
• < human practices >
  • → oath
  • → ethics
  • → safety
• < gallery >
• < sponsors >
• < to the forums >

green light receptor

Testdigest with PvuI

Investigators:Julia

digested were Minipreps of Ligationreaction with CcaS.
The Enzym PvuI should cut into two fragments, one of 1666bp, the other 582 bp and vector at 2kb.
Protocol:

for Mastermix of 7 reactions:

30µl H2O
7µl NEB buffer 3
7µl BSA 10x
2µl PvuI

give 3µl of DNA sample to 7µl Mastermix, digest for one hour.
Add 1µl loading dye buffer(6x)a nd let the gel run.

Gelpicture

blue light receptor

Theoretical Gibson-Assembly

Investigators: Sandra, Sophie

Primer Degin for Blue light sensor (lovTAP) + trp promotor (BBa_K322999) and tetR Gen + tetO promotor (BBa_Q04400).

• LOVtap-Trp_up: gaattcgcggccgcttctagtcacacaggaaagtactatgt
  
• LOVtap-Trp_dw: tacttttatctaatctggacatctagtatttctcctctttgtcgataccctttttacgtg
  
• TetR-TetO_up: aaagaggagaaatactagatgtccagattag
  
• TetR-TetO_dw^: ctgcagcggccgctactag
  

^we also have another primer for this one, but we are not sure about the length/melting temperature. Might be changed.

red light receptor

NAME OF YOUR EXPERIMENT

Investigators:Jakob

Testdigest

For one reaction you need: For Mastermix: Number of samples+2extra

10 μl total volume

Give 3 μl of DNA in an eppi and add 7μl of the mastermix.

Incubate for about 1h at 37°C.

Add 1 μl Loading dye buffer and load the gel.

Picture of the tesdigest: Expected sizes: L22+term(L21) ≈ 800 bp, L23+term(L21) ≈ 800 bp

L22a+b are correct

• To-do: send for sequencing

Miniprep

Name: Jakob	Date: 19.07.2011
Continue from Experiment: 18.07.2011 Trafo and Grow overnight at 37 °C
Project Name: Red light receptor Documentation: Why are you doing this experiment? Name the parts which you extract. Part name: L22+L21 = ho1 + terminator (BBa_I15008 + B1006) L23+L21 = PcyA + terminator (BBa_I15009 + B1006) Describe your results and mistakes and measure the DNA concentration with the Nanodrop and note the results. L22+L21 a-h=ho1+term DNA conc. ng/µl 260/280 260/230 L22+L21 a 78 1,8 1.3 L22+L23 d 31,7 2,01 2,09 L22+L23 f 30,4 2,58 -11 L22+L23 g 84,8 1,98 2,58 Nothing grow in b,c,e,h L23+L21 a-h=PcyA+term DNA conc. ng/µl 280/230 260/230 L23+L21 a 87,1 1,95 2,62 L23+L21 b 101,1 1,85 2,71 L23+L21 c 31,4 2,91 3,40 L23+L21 d 184,1 1,5 0.98 L23+L21 e 98 1,94 2,72 L23+L21 g 49,3 2,16 3,12 L23+L21 h 122,3 1,94 2,77 Nothing grow in f How did you label your probes and where are they stored? Labeled: L22+21 a-h, L23+L21 a-h, strored: pink rack -20 freezer Lysis cassette NAME OF YOUR EXPERIMENT Investigators:NAME Precipitator PCR Name: Ruediger Date: 19.07.11 Continue from Experiment (Date) PCR 18.07 (Name) Project Name: GFP Pbd PCR-Mixture for one Reaction: For a 50 µl reaction use 32,5µl H20 Name 10µl 5x Phusion Buffer of Primer 2.5µl Primer fw P18, P19, P20 2.5µl Primer dw P28 1µl dNTPs of Template DNA 1µl DNA-Template PCR product of P1,P3,S14 from yesterday 0.5 µl Phusion (add in the end) What program do you use? One set of probes was prepared and then split into 3 tubes each to test them at Annealingtemperatures 44C, 52C and 60C for the first 10 cycles. Then Annealingtemperature 60C for 25 cycles To confirm the PCR-Product has the correct size, load 2 µl of the sample onto an agarose-gel. How did you label the PCR-Product, where is it stored and what do you do next? S14+P18+P28 S14+P19+P28 S14+P20+P28 Stored in PCR product box Lane1 Quick Load Marker Lane2 44C S14+P18+P28 Lane3 44C S14+P19+P28 Lane4 44C S14+P20+P28 Lane5 52C S14+P18+P28 Lane6 52C S14+P19+P28 Lane7 52C S14+P20+P28 Lane8 60 S14+P18+P28 Lane9 60 S14+P19+P28 Lane10 60 S14+P20+P28 Digestion Name: Ruediger Date: 19.07 Continue from Experiment (Date) 19.07 PCR (Name) Ruediger Project Name: GFP Pbd Procedure add H2O (38μl-DNA ) 5 μl NEB4 buffer (stored at iGEM’s, -20°C) 5 μl 10x BSA (used 1:10 diluted sample stored at iGEM’s, -20°C) DNA (500 ng) 1 μl restriction enzymes (stored at iGEM’s, -20°C) heat for 1-2 hours 37°C (6 hours if time) heat for 20 minutes 80°C (inactivation of enzymes) keep at 4°C if you cannot continue Vector (ratio 1:3 to insert) Inserts (500ng) Components Vector (μl) Insert1 (μl) DNA (500ng) 5,6 12,5 4,7 3,5 3,8 BSA (100x) (5μl) NEB4 Buffer (5μl) Enzyme 1 (1μl) SpeI SpeI XbaI XbaI XbaI Enzyme 2 (1μl) PstI PstI PstI PstI PstI H2O (38 μl- DNA) 32,5 25,5 33,7 34,5 34,2 In total 50 μl Measured DNA-concentration with Nanodrop to calculate the volume of DNA to do the digestion: Sample DNA concentration (μg/μl) S14+P20+P28 (short:20) 132 S14+P19+P28 (short 19) 145 S14+P18+P28 (short 18) 107 S39 90 S43 40 Documentation: Why are you doing this experiment? Where are the samples stored? Name of samples, antibiotica resistance, vector used etc. Want to ligate GFPpbd (3 different versions P18/19/20) into PR vectors (one with strong Promotor strong RBS, one with middle Promotor, middle RBS) CM Resistance Mistake: took 100x BSA instead of 10X