Team:Freiburg/Notebook/19 July

• < home >
• < team >
  • → members
  • → attributions
  • → freiburg
• < project >
  • → description
  • → results
  • → modeling
  • → notebook
  • → sample data
• < human practices >
  • → oath
  • → ethics
  • → safety
• < gallery >
• < sponsors >
• < to the forums >

green light receptor

Testdigest with PvuI

Investigators:Julia

digested were Minipreps of Ligationreaction with CcaS.
The Enzym PvuI should cut into two fragments, one of 1666bp, the other 582 bp and vector at 2kb.
Protocol:

for Mastermix of 7 reactions:

30µl H2O
7µl NEB buffer 3
7µl BSA 10x
2µl PvuI

give 3µl of DNA sample to 7µl Mastermix, digest for one hour.
Add 1µl loading dye buffer(6x)a nd let the gel run.

Gelpicture

blue light receptor

Theoretical Gibson-Assembly

Investigators: Sandra, Sophie

Primer Degin for Blue light sensor (lovTAP) + trp promotor (BBa_K322999) and tetR Gen + tetO promotor (BBa_Q04400).

• LOVtap-Trp_up: gaattcgcggccgcttctagtcacacaggaaagtactatgt
  
• LOVtap-Trp_dw: tacttttatctaatctggacatctagtatttctcctctttgtcgataccctttttacgtg
  
• TetR-TetO_up: aaagaggagaaatactagatgtccagattag
  
• TetR-TetO_dw^: ctgcagcggccgctactag
  

^we also have another primer for this one, but we are not sure about the length/melting temperature. Might be changed.

red light receptor

Investigators: Jakob

Testdigest

For one reaction you need: For Mastermix: Number of samples+2extra

10 μl total volume

Give 3 μl of DNA in an eppi and add 7μl of the mastermix.

Incubate for about 1h at 37°C.

Add 1 μl Loading dye buffer and load the gel.

Picture of the tesdigest: Expected sizes: L22+term(L21) ≈ 800 bp, L23+term(L21) ≈ 800 bp

L22a+b are correct

• To-do: send for sequencing

Miniprep

Documentation:

Why are you doing this experiment? Name the parts which you extract.

Describe your results and mistakes and measure the DNA concentration with the Nanodrop and note the results.

How did you label your probes and where are they stored?

Lysis cassette

NAME OF YOUR EXPERIMENT

Investigators:NAME

Precipitator

PCR

PCR-Mixture for one Reaction:

For a 50 µl reaction use

What program do you use?

One set of probes was prepared and then split into 3 tubes each to test them at Annealingtemperatures 44C, 52C and 60C for the first 10 cycles. Then Annealingtemperature 60C for 25 cycles

To confirm the PCR-Product has the correct size, load 2 µl of the sample onto an agarose-gel.

How did you label the PCR-Product, where is it stored and what do you do next?

S14+P18+P28

S14+P19+P28

S14+P20+P28

Stored in PCR product box

Lane1 Quick Load Marker Lane2 44C S14+P18+P28 Lane3 44C S14+P19+P28 Lane4 44C S14+P20+P28 Lane5 52C S14+P18+P28 Lane6 52C S14+P19+P28 Lane7 52C S14+P20+P28 Lane8 60 S14+P18+P28 Lane9 60 S14+P19+P28 Lane10 60 S14+P20+P28

Digestion

Procedure

1. add H₂O (38μl-DNA )
2. 5 μl NEB4 buffer (stored at iGEM’s, -20°C)
3. 5 μl 10x BSA (used 1:10 diluted sample stored at iGEM’s, -20°C)
4. DNA (500 ng)
5. 1 μl restriction enzymes (stored at iGEM’s, -20°C)
6. heat for 1-2 hours 37°C (6 hours if time)
7. heat for 20 minutes 80°C (inactivation of enzymes)
8. keep at 4°C if you cannot continue

Vector (ratio 1:3 to insert)

Inserts (500ng)

Measured DNA-concentration with Nanodrop to calculate the volume of DNA to do the digestion:

Documentation:

Why are you doing this experiment? Where are the samples stored? Name of samples, antibiotica resistance, vector used etc.